Abstract
Tyrosine kinases play a crucial role in cell proliferation and survival and are extensively investigated as targets for cancer treatment. However, the efficacy of most tyrosine kinase inhibitors (TKIs) in cancer therapy is limited due to resistance. In this study, we identify a synergistic combination therapy involving TKIs for the treatment of triple negative breast cancer. By employing pairwise tyrosine kinase knockout CRISPR screens, we identify FYN and KDM4 as critical targets whose inhibition enhances the effectiveness of TKIs, such as NVP-ADW742 (IGF-1R inhibitor), gefitinib (EGFR inhibitor), and imatinib (ABL inhibitor) both in vitro and in vivo. Mechanistically, treatment with TKIs upregulates the transcription of KDM4, which in turn demethylates H3K9me3 at FYN enhancer for FYN transcription. This compensatory activation of FYN and KDM4 contributes to the resistance against TKIs. FYN expression is associated with therapy resistance and persistence by demonstrating its upregulation in various experimental models of drug-tolerant persisters and residual disease following targeted therapy, chemotherapy, and radiotherapy. Collectively, our study provides novel targets and mechanistic insights that can guide the development of effective combinatorial targeted therapies, thus maximizing the therapeutic benefits of TKIs.
Introduction
Tyrosine kinases have emerged as important drug targets in cancer therapy due to their druggability and pivotal roles in cell proliferation and survival(1). They are implicated in various aspects of cancer development(2), such as cell survival, proliferation, angiogenesis, and invasion, making them attractive targets for drug intervention. Consequently, tyrosine kinase inhibitors (TKIs) have gained considerable attention as primary agents for cancer treatment.
Triple negative breast cancer (TNBC) treatment has limited options for targeted therapy. TNBC, characterized by the absence of estrogen receptor, progesterone receptor, and HER2 expression, exhibits elevated activity of tyrosine kinases, including EGFR and IGF1R(3, 4). However, several clinical trials investigating TKIs, such as VEGFR inhibitors, EGFR inhibitors, and FGFR inhibitors, in TNBC treatment have yielded disappointing results due to inadequate efficacy. Therefore, it is crucial to comprehend the mechanisms underlying TNBC’s suboptimal response to TKIs to enable the development of more effective targeted therapies against TNBC.
The therapeutic efficacy of TKIs is compromised by intrinsic and acquired resistance(5). For instance, EGFR inhibitor gefitinib extended the median progression-free survival by only five months compared to conventional chemotherapy in non-small cell lung cancer (NSCLC) patients with EGFR mutation(6). Significant subset of drug resistance is driven by gene interactions that enable compensatory changes in signal transduction upon drug treatment. Compensatory activation of mitogenic signals, such as MET, PIK3CA amplification, and MAPK/ERK signaling activation, counterbalances the inhibition of EGFR by TKI osimertinib in a significant portion of NSCLC patients(7). Simultaneous inhibition of multiple signaling molecules that compensate for each other’s loss is proposed as an effective strategy to overcome resistance to kinase inhibitor therapy, emphasizing the importance of combinatorial therapy(8).
Until recently, a highly scalable method for screening combinatorial therapy has been lacking. Combinatorial CRISPR screens have emerged as efficient tools to identify synergistic targets for combinatorial therapy. We and others recently developed combinatorial CRISPR screens to elucidate pairwise gene interactions(9–12). Our combinatorial genetic screen platform, combinatorial genetics en Masse (combiGEM), was successfully implemented to identify combinations of epigenetic regulators causing synthetic lethality in ovarian cancer cells (9).
In this study, we utilize CombiGEM-CRISPR technology to identify tyrosine kinase inhibitor combinations with synergistic effect in TNBC cell line and xenograft models for potential combinatorial therapy against TNBC. We highlight FYN as a key therapeutic target that, when inhibited, enhances the cytotoxic effect of inhibition of other tyrosine kinases (IGF1R, EGFR, and ABL2). Mechanistic studies reveal KDM4 as a crucial epigenetic regulator that demethylates H3K9me3 and transcriptionally upregulates FYN upon TKI treatment. In vitro and in vivo validation demonstrates the synergistic TNBC-shrinking effects of combining PP2, saracatinib (Src family kinase / FYN inhibitor) or QC6352 (KDM4 inhibitor) with TKIs. Additionally, we demonstrate the clinical significance of our findings by observing upregulation of FYN in various models of drug tolerant persisters and residual tumors after chemo-, radio-, or targeted therapy. Therefore, simultaneous targeting of FYN-KDM4 and tyrosine kinase pathways through combinatorial therapy holds promise for effective therapy against TNBC.
Results
Pairwise tyrosine kinase knockout CRISPR screen reveals synergistic tyrosine kinase inhibition combination
For efficient translation of CRISPR screening data to drug combination, we selected 76 tyrosine kinases that could be inhibited by at least one drug from the drug repurposing hub database (table S1) (13). For pairwise CombiGEM library construction, we chose three guide RNAs from the optimized Brunello single guide RNA (sgRNA) list(14) employing the iterative cloning method as previously described(9, 15). The resulting library enabled screens of pairwise knockouts of the 76 tyrosine kinase genes, encompassing 54,289 sgRNA pairs representing 3,003 pairwise gene disruptions (Fig. 1A). To validate our library, we performed next-generation sequencing and confirmed that 99.5% (2,989/3,003) of gene pairs were represented by at least 6 pairs of sgRNAs, with the log10 reads per million of 0.5 (Fig. S1A).

Pairwise CRISPR screen reveals combinations of synthetic lethal tyrosine kinase ablations.
(A) Schematic diagram of combinatorial screens performed in TNBC cell line MDA-MB-231. (B) Scatter plot of expected growth phenotype Z score and observed growth phenotype Z score of each gene combination. Green dots indicate gene combinations where the identical gene is targeted by the two sgRNAs. Red dots indicate candidate synthetic lethal gene pairs listed in table S1. (C) Scatter plot of growth phenotype Z score and normalized GI score of each gene combination. (D) Scatter plot of gene level GI score and RIGER p value calculated with GI scores of each sgRNA pairs that target the given gene pair.
Triple negative breast cancer cell line MDA-MB-231 cells stably expressing Cas9 were transduced with the lentiviral library at low multiplicity of infection (MOI) of 0.3. Genomic DNA was harvested 3 days after transduction (designated as day 0[D0]), and 23 days after transduction (D20) (Fig. 1A) to perform PCR amplification of sgRNA pairs for subsequent next-generation sequencing (NGS) analysis. sgRNAs, instead of barcodes in our previous CombiGEM screens, were directly sequenced using paired-end sequencing to rule out uncoupling of barcodes of sgRNAs and barcodes (Fig. S1B-C). We counted the occurrences of each sgRNA pair in the NGS data and calculated the normalized log2 fold change in counts between the day 20 and day 0 samples as the growth phenotype score Z (see Methods). The Z scores for the two permutations of an sgRNA pair (r=0.50 between sgRNA-A + sgRNA-B and sgRNA-B + sgRNA-A pairs), the biological replicates, (r = 0.74 between replicates #2 and #3), and independent sgRNA pairs targeting the same set of genes were positively correlated (r=0.3-0.72) (Fig. S1D-G).
Gene pairs that synergistically kill cells were identified by calculating gene interaction scores (GI). The GI scores were derived by comparing the growth phenotype score Z resulting from the disruption of a gene pair (ZA+B, observed Z score) to the sum of Z scores obtained from the disruption of each gene individually within the pair (ZA+Con + ZB+Con, expected Z score) (Fig. 1B). The expected and observed Z scores for each gene (or sgRNA) pair exhibited a strong positive correlation (r=0.97 gene level, r=0.88 sgRNA level), suggesting that most random pairwise combinations of tyrosine kinase perturbations show additive effects (Fig. 1B and S1H). GI scores were calculated by quantifying each gene pair’s normalized deviation from the quadratic fit of the expected-observed Z score plot(10) (Fig.1C and Fig. S1I, see methods).
We selected thirty synthetic lethal gene pairs using cutoffs for gene level GI score <-2 and p<0.01 for GI scores determined by RIGER analysis(16) and Z<-5 (Fig. 1D and dataset S1). Among these, the SRC-YES pair was one of the strongest synthetic lethal gene pairings (GI= −3.95). Notably, SRC-YES belong to the same tyrosine kinase family and are known to be functionally redundant and are expected to be synthetic lethal(17). These findings provide evidence for the effectiveness of our screening approach in identifying synthetic lethal gene pairs.
Synthetic lethal gene pairs are next validated by expressing the pair of sgRNAs targeting them. To achieve this, we introduced lentiviral vectors carrying two distinct sgRNAs targeting the candidate synthetic lethal pairs, each tagged with a different fluorescent protein (GFP and mCherry). MDA-MB-231 Cas9 cells were transduced with the lentivirus at a low titer (MOI ∼0.5), resulting in a mixed population of cells expressing either one or both sgRNAs along with their respective fluorescent proteins (Figs. 2A and S2A). We monitored the decrease in the number of GFP/mCherry double-positive cells to evludate synthetic lethality (see methods). We validated the efficacy of the sgRNAs used in Figure 2A through the T7 endonuclease assay, which confirmed efficient gene editing (Fig. S2B). Consistent with our CRISPR screening results, we observed that the disruption of six out of eight synergistic target gene combinations led to a reduction in cell viability beyond what was predicted by the Bliss independence model (Fig. 2B). Moreover, the relative viability of double knockout cells and the rate of synergistic killing demonstrated a strong correlation with our screening data (r = 0.65 for both viability and synergistic effect; Fig. S2C). Collectively, our findings provide compelling evidence that our screening approach successfully identified synthetic lethal gene pairs with a high level of confidence.

FYN is critical mediator of TKI resistance.
(A) Schematic diagram of in vitro validation of synthetic lethal gene pairs using sgRNAs. (B) Summary of synergistic killing by sgRNAs targeting indicated gene pairs (n=3). (C) Network analysis of the 30 candidate synthetic lethal gene pairs highlighted in figure 1D. The size of each node is manually drawn to be proportional to the number of connections the gene has. (D-E) FYN and SRC mRNA expressions in (D) microarray data of primary breast cancers of GSE25066 cohort, and (E) in cancer cell line encyclopedia, for indicated subtypes. (F) Summary of MTT assay with MDA-MB-231 cells treated with the TKI combinations at indicated concentrations (n=2). Synergistic killing is calculated using SynergyFinder with Bliss independence model. (G) Dose response curve of the indicated TKI in the presence and absence of 5μM PP2 treated for 72 hours (n=3). (H) MTT assay with MDA-MB-231 Cas9 cells expressing indicated sgRNAs treated with indicated TKIs for 72 hours (n=3). (I) Cell death and cell proliferation in MDA-MB-231 cells treated with NVP-ADW742, gefitinib and PP2 either as single agent or as combination for 72 hours (n=3). (J) western blot analysis of MDA-MB-231 cells treated with indicated drugs for 48 hours (K) western blot analysis of MDA-MB-231 Cas9 cells expressing indicated sgRNA and treated with indicated drugs for 48 hours. (L) MTT assay of MDA-MB-231 cells treated with indicated drugs for 72 hours (SB203580: 10μ M, NVP-ADW742: 4μM, gefitinib: 10μM, imatinib: 10μM) (n=3). PP2, Saracatinib, NVP-ADW742, gefitinib and imatinib were treated at 5μM, 5μM, 4μM, 12μM, 12μM unless otherwise indicated. All data are plotted as mean±s.d. One sample t-test for B, and unpaired two-sided Student’s t-test in D,E,H and L. *, p<0.05; **, p<0.01; ***, p<0.001; n.s., p>0.05. All replicates are biological replicates.
FYN inhibition synergizes with IGF1R, EGFR, ABL2 inhibitions in cell killing
We noticed that several validated synergistic target gene pairs included FYN (e.g. FYN+IGF1R, FYN+EGFR, and FYN+ABL2). Notably, network analysis of the 30 candidate synergistic tyrosine kinase pairs revealed that FYN is one of the key nodes participating in synergistic interactions with multiple genes (Fig. 2C). Expression of FYN, a member of Src family kinase, has been implicated in cancer malignancy including drug resistance(18–21). Particularly, recent studies highlighted significant contribution of FYN in TNBC malignancy by promoting epithelial-to-mesenchymal transition (EMT)(22, 23). Interestingly, we found that FYN, but not SRC, exhibited significant upregulation in triple-negative breast cancer (TNBC) compared to other subtypes, as evidenced by microarray data from primary tumor samples (24) and the cancer cell line encyclopedia (CCLE)(25) (Figs. 2D-E). In contrast, other key nodes in figure 2C, including FGFR2, FRK and TEK were not expressed at appreciable levels in MDA-MB-231 (log2(TPM+1) for TEK: 0.0704, FRK:0.124, FGFR2:0.227), and their expressions were not significantly upregulated in TNBCs compared to other breast cancer subtypes (Fig. S3). Therefore, we proceeded further in focusing on validating FYN as key candidate synthetic lethal gene. These findings suggest that FYN could represent an attractive drug target for TNBC treatment. To investigate this further, we assessed whether simultaneous inhibition of FYN by PP2, which selectively targets the SRC family kinase inhibitor with the highest potency against FYN, in combination with other kinase inhibitors (TKIs), could inhibit cancer cell growth(26). PP2 as a single agent significantly downregulated MDA-MB-231 cell viability (Fig. S4A). Therefore, we focused on synergistic cell death by TKI combinations above additive effects by each TKI. To this end, analysis using SynergyFinder plus(27)revealed that all TKI combinations involving PP2 and NVP-ADW742 (IGF1R inhibitor), gefitinib (EGFR inhibitor) or imatinib (ABL inhibitor) synergistically induced cell death in MDA-MB-231 cells (Fig. 2F). Dose-response curves demonstrated that co-treatment with PP2 reduced the IC50 of the tested TKIs by 34-61%, indicating that PP2 sensitized cancer cells to TKI treatment (Fig. 2G). Similar synergy was observed when TKI combinations included saracatinib, a SRC family kinase inhibitor(28), in place of PP2 (Fig. S4B). Moreover, specific ablation of FYN, but not SRC, sensitized cells to TKIs, highlighting the critical role of FYN as a member of SRC kinase family responsible for TKI resistance (Figs. 2H and S4C). Ablation of FYN itself did not significantly decrease cell viability (Fig. S4D). Importantly, we observed similar synergy between the same drug combinations in other TNBC cell lines, including Hs578T, HCC1143, HCC1395, and HCC1937 cells (Figs. S4E-H). Further assessment using live-dead and BrdU assays revealed that both the PP2+NVP-ADW742 and PP2+gefitinib combinations synergistically induced cell death while inhibiting cell growth (Fig. 2I).
Persistent activation of MAPK pathway and PI3K-AKT pathway has been associated with TKI resistance in various cancers(5). Therefore, we investigated which downstream pathways were involved in sensitizing cells to TKI treatment. Notably, the p38 MAPK was significantly attenuated following treatment with either PP2 or saracatinib treatment (Fig. 2J). Previous studies with imatinib resistant CML cells identified ERK signaling as critical downstream of FYN activation(19, 20). However, FYN inhibition failed to significantly downregulate phosphorylated ERK level upon imatinib treatment, indicating downstream signals of FYN leading to drug resistance may be context dependent. Genetic ablation of FYN similarly reduced p38 activation (Fig. 2K). Attenuation of p38 activity was also observed in an independent TNBC cell line, Hs578T (Figs. S4I-J). Importantly, treatment of p38 MAPK pathway inhibitor SB203580 markedly sensitized cells to TKI treatment (Fig. 2L), while SB203580 as single agent did not significantly change cell viability (Fig. S4K)
FYN mRNA is induced upon TKI treatment in KDM4 dependent manner
Our discovery that inhibition of FYN synergizes with multiple TKIs possessing distinct target profiles suggests that FYN may play a role in general resistance mechanisms against TKI therapy. Consistently, we observed an increase in both protein and mRNA levels of FYN following TKI treatment, indicating that upregulation of FYN confers compensatory survival signal in TKI-treated cells (Fig. 3A-B). The phosphorylation levels of FYN was increased proportional to FYN protein level, indicating specific kinase activity of FYN did not change (Fig. S5A). Previous study suggested that increased expression of EGR1 transcription factor is responsible for FYN mRNA accumulation in imatinib resistant CML(18). Consistently, EGR1 expression was increased upon TKI treatment in MDA-MB-231 cells. However, EGR1 expression was not increased in TKI treated MDA-MB-231 cells, nor did its knockout significantly downregulated FYN mRNA levels (Fig. S5B). To elucidate the mechanisms underlying the accumulation of FYN, we treated MDA-MB-231 cells with inhibitors targeting key epigenetic modifiers and assessed their synergistic effects with NVP-ADW742 in cell killing, as well as their impact on FYN mRNA accumulation. Multiple drugs, including pinometostat (DOT1L inhibitor(29)), tazemetostat (EZH2 inhibitor(30)), A366 (G9a inhibitor(31)) and GSK-J4 (KDM6 inhibitor(32)) strongly decreased cell viability upon TKI treatment (Fig. S5C). As the increase in FYN mRNA is responsible for TKI resistance, we reasoned that the drug that directly affect FYN mRNA level and hence cell viability should be an inhibitor of epigenetic regulator that enhances transcription. To this end, we focused on pinometostat and GSK-J4 for further validations. Intriguingly, while GSK-J4 decreased FYN mRNA upon NVP-ADW742 treatment, pinometostat failed to decrease it (Fig. S5D).. Consistent with this, treatment with NVP-ADW742 increased the expression of most members of the jumonji domain histone demethylase family (Fig. 3C). This observation is consistent with a previous study on taxane-resistant H1299 lung cancer cells(33), suggesting that histone demethylases may play critical roles in activating a drug resistance gene program. However, the ablation of KDM6, the primary targets of GSK-J4, failed to significantly decrease FYN expression (Fig. S5E). GSK-J4 is known to inhibit other jumonji domain histone demethylase family proteins including KDM4 and KDM5(34). Therefore, we tested the possibility that other histone demethylase may be involved in regulating FYN expression. Among jumonji domain histone demethylases, KDM4, and to a lesser extent KDM3, were the only gene family members whose ablation inhibited FYN upregulation and p38 activation upon TKI treatment (Figs. 3D and S5F). Ablation of KDM5, which has been shown to induce drug tolerance in cancer cells(35), did not significantly alter FYN expression (Fig. S5G). Like NVP-ADW742 treatment, gefitinib treatment increased KDM4 demethylase levels (Fig. S5H). We also analyzed two independent TNBC organoids obtained from primary tumors and found concurrent upregulation of KDM4 with FYN mRNAs upon NVP-ADW742 and gefitinib treatment (Fig. S5I). Critically, time course experiment with NVP-ADW742 treated MDA-MB-231 revealed that accumulation of KDM4A protein preceded FYN protein (Fig. 3E), suggesting that KDM4A accumulation may be responsible for FYN accumulation. Both KDM3 and KDM4 demethylates methylated H3K9, thereby promoting the opening heterochromatin for transcription(36). Remarkably, expression of KDM4A, the most abundantly expressed gene among KDM4 demethylases in TNBC cell lines (Fig. S6A) was enriched in TNBC compared to other breast cancer subtypes (Fig. 3F) and was positively correlated with FYN expression in CCLE database, suggesting that KDM4 regulates FYN mRNA levels (Fig. 3G). Genetic ablation of KDM3 or KDM4 (Fig. S6B-C) decreased FYN and p38 activity. Also, genetic ablation of KDM3 or KDM4 sensitizing MDA-MB-231 cells to TKIs (Figs. 3H-I). The Ablation of KDM3 or KDM4 only had modest but statistically insignificant effect on cell viability (Fig. S6D). Likewise, treatment of KDM4 inhibitor QC6352(37) synergized with TKIs in killing MDA-MB-231 cells (Fig. 3J). QC6352 treatment also significantly attenuated FYN accumulation upon NVP-ADW742 treatment (Fig. 3K-L). This was consistent with the RNA sequencing data results in the previous study with breast cancer stem cells treated with QC6352(38). Specifically, FYN was the most significantly downregulated SRC family kinase upon QC6352 treatment (Fig. 3M). Analysis of chromatin IP (ChIP) sequencing data from the same study revealed KDM4A enrichment near FYN promoter; and QC6352 treatment increased H3K9me3 enrichment at the same locus (Fig. 3N). Indeed, this FYN promoter locus exhibited a reduction in H3K9me3 following NVP-ADW742 treatment, while QC6352 treatment restored H3K9me3 enrichment (Fig. 3O). This finding suggests that KDM4 may directly demethylate H3K9me3 at FYN promoter to upregulate FYN transcription. In contrast, H3K27me3 marks, which is demethylated by KDM6 family demethylases, were not significantly changed at FYN promoter upon NVP-ADW742 treatment (Fig. S6E). FYN accumulation and resistance to TKIs were also confirmed to be attenuated by QC6352 treatment in other independent TNBC cell lines (Figs. S6F-G).

Activation of KDM4 upregulates FYN, conferring drug resistance.
(A) Western blot analysis of MDA-MB-231 cells treated with indicated drugs. Numbers below blots indicate quantification of average±s.d. expression level normalized to GAPDH in three independent experiments. (B) RT-qPCR analysis of FYN expression levels in MDA-MB-231 cells treated with indicated drugs for 48 hours (n=3). (C) RT-qPCR analysis of indicated jumonji family histone demethylase expression levels after 48 hours treatment of NVP-ADW742 (n=3). (D) Changes in FYN mRNA levels upon 48 hours of NVP-ADW742 treatment in MDA-MB-231 Cas9 cells expressing indicated sgRNAs (n=4). (E) KDM4A mRNA levels in primary tumor tissues of indicated subtypes in GSE25066 cohort. (F) Positive correlation of FYN and KDM4A mRNA levels in CCLE database. (G) western blot analysis of MDA-MB-231 Cas9 cells expressing indicated sgRNA and treated with indicated drugs for 48 hours. (H) MTT assay of MDA-MB-231 Cas9 cells expressing indicated sgRNAs and treated with indicated drugs for 72 hours (n=3). (I) SynergyFinder analysis of MDA-MB-231 cells treated with indicated drug combinations (n=2). (J-K) western blot analysis (J) and RT-qPCR analysis (K) of MDA-MB-231 cells treated with indicated drugs for 48 hours (n=3). (L) mRNA expression levels of SRC family kinases in breast cancer stem cells treated with QC6352 in RNA sequencing data described in Metzger et. al.(38) (M) H3K9me3 and KDM4A enrichment at genomic locus encoding FYN promoter in ChIP sequencing data described in the same study as (L). (N) H3K9me3 Chromatin immunoprecipitation-qPCR analysis of MDA-MB-231 cells treated with indicated drug for 48 hours at specified genomic loci (n=3). QC6352, PP2, NVP-ADW742, gefitinib and imatinib were treated at 10μM, 5μM, 4μM, 12μM, 12μM, respectively, unless otherwise indicated. All data are plotted as mean±s.d. Unpaired two-sided Student’s t-test in B,C,D,E,H and K. Paired two-sided Student’s t-test in N. *, p<0.05; **, p<0.01; ***, p<0.001; n.s., p>0.05. All replicates are biological replicates.
FYN/KDM4 inhibition synergizes with TKI treatment in vivo
We proceeded to investigate the potential clinical application of our synthetic lethal gene pairs as combinatorial therapy by assessing the in vivo efficacy of pharmacological interventions targeting these gene pairs using MDA-MB-231 xenograft models. Strikingly, co-treatment of saracatinib and NVP-ADW742 synergistically reduced tumor size, whereas treatment with either agent alone was ineffective in slowing tumor growth (Fig. 4A). All treatment groups exhibited minimal changes in body weight, indicating that the overall health of the animals was not adversely affected by the combination treatment (Fig. S7A). Saracatinib-gefitinib combination was not tested as saracatinib can inhibit EGFR(28). Similarly, KDM4 inhibitor QC6352 synergized with gefitinib in reducing MDA-MB-231 xenograft tumor growth without causing overt changes in animal health (Figs. 4B and S7B). Additionally, the expression levels of FYN and KDM4A were found to be correlated with poor prognosis in a previously reported breast cancer cohort(24), highlighting the potential of targeting these two genes as therapeutic targets for TNBC (Fig. 4C). Collectively, our results demonstrate that upregulation of KDM4 upon TKI treatment reduces H3K9me3 mark in FYN enhancer, thereby increasing FYN expression and promoting cell survival under TKI treatment (Fig. 4D).

Combination therapy targeting FYN+IGF1R and KDM4+EGFR synergistically eliminates tumor in vivo.
(A-B) Tumor volume for MDA-MB-231 xenografts treated with indicated drugs. Additive effects were calculated by Bliss independence model (n=5). (C) Distant relapse free survival of GSE25066 patient cohort classified by FYN (left) and KDM4A (right) mRNA expression. (D) Schematics diagram of the mechanism of KDM4-FYN conferring TKI resistance. All data are plotted as mean±s.d. *, p<0.05; **, p<0.01; ***, p<0.001; n.s., p>0.05. All replicates are biological replicates.
FYN is associated with drug tolerant persister phenotype
The observed epigenetic alterations in regulators conferring resistance to multiple cancer drugs closely resemble non-genetic changes associated with the generation of drug-tolerant persisters(35). Indeed, prolonged incubation of MDA-MB-231 cells treated with TKIs or conventional chemotherapy drugs such as doxorubicin or paclitaxel resulted in increased levels of FYN (Fig. 5A). Curiously, KDM4A expression was only upregulated upon treatment with NVP-ADW742 and gefitinib, suggesting that while FYN upregulation is a general feature of drug tolerant cells, the mechanism of FYN upregulation may vary depending on the specific drug being used. Analysis of previously published RNA sequencing data from a series of osimertinib tolerant EGFR mutated lung cancer cell lines(39) revealed higher expression levels of FYN and KDM4A in the drug persisters, but not SRC (Fig. 5B). Consistently, we confirmed upregulation of FYN at both the protein and mRNA levels in gefitinib and osimertinib resistant PC9 and HCC827 cells (Figs. 5C-D). Pharmacological inhibition of FYN or downregulation of FYN expression through inhibition of KDM4 sensitized gefitinib resistant PC9 cells to EGFR inhibitor, suggesting that FYN-KDM4 are responsible for gefitinib resistant phenotype in this cell line (Figs.5E-G).

FYN and KDM4 are associated with drug tolerance.
(A) MDA-MB-231 cells treated with indicated drugs for short (acute: 2 days) and long (DTP: 10 days) time periods. A: 1μM NVP-ADW742, G: 5μM gefitinib, I: 5μM imatinib, D: 100nM doxorubicin, P: 5nM paclitaxel. Numbers below blots indicate quantification of average±s.d. expression level normalized to GAPDH in three independent experiments. (B) Summary of mRNA expressions of indicated genes in EGFR mutant lung cancer cells (parental) and their derivative osimertinib tolerant persisters (DTP). (C-D) western blots (C) and RT-qPCR (D) analyses of indicated parental and EGFR inhibitor resistant lung cancer cells. (E-F) MTT assay with PC9 parental (par.) and gefitinib resistant (GR) cells treated with indicated drug combinations (gefi: 2μM gefitinib, PP2: 5μM PP2, Sara: 5μM saracatinib, QC6352: 10μM QC6352) for 72 hours. (G) western blot analysis with PC9 cells treated with 10μM QC6352 for 48 hours. (H) FYN mRNA expression levels of parental and DTP populations in various cancers treated with indicated drugs.. (I) FYN mRNA expression levels of residual disease after indicated treatments. All data are plotted as mean±s.d. Paired two-sided Student’s t-test in B, H (HER2+ BRCA set and HGSOC carboplatin set), and I (BRCA set and ESCA set), and unpaired two-sided Student’s t-test in H (COAD and PAAD sets) and I (COAD set). The expression data in B,H,I are obtained from NCBI gene expression omnibus. The accession numbers of the expression data analyzed are listed in Supplementary table S2. *, p<0.05; **, p<0.01; ***, p<0.001; n.s., p>0.05. All replicates are biological replicates.
Importantly, upregulation of FYN has been consistently observed in multiple independent studies involving drug-tolerant cancer cell lines and patient-derived xenografts treated with various drugs that have distinct target profiles, including TKIs (lapatinib, a HER2 inhibitor, against HER2 positive breast cancer(40)) and chemotherapy drugs (irinotecan, topoisomerase inhibitor against colorectal cancer(41); gemcitabine against pancreatic cancer(42); and carboplatin against high grade serous ovarian carcinoma(43)) (Fig. 5H). Moreover, enrichment of FYN has also been observed in residual disease following chemotherapy, including neoadjuvant chemostherapy plus bevacizumab treated HER2 negative breast cancer(44), neoadjuvant chemoradiotherapy combined plus atezolizumab treated esophageal cancer(45), and chemoradiotherapy treated colorectal cancer(46), indicating its potential role in mediating drug tolerance during chemotherapy (Fig. 5I). While the causal relationship between FYN expression drug tolerance in response to various therapeutic interventions warrants further study, these evidence suggest that FYN expression is associated with drug tolerance. Notably, an analogous increase in KDM4 was not consistently observed across all tumor models tested in Figures 5H-I (Fig. S8A-B). This suggests that, as previously noted in Figure 5A, while FYN serves as a general mediator of drug tolerance, the specific mechanisms underlying its upregulation may vary depending on the cancer type and the drug being administered. Taken together, these lines of evidence further support our findings in TNBC cell lines and suggest that FYN acts as a common mediator of drug tolerance.
Discussion
In this study, we employed combinatorial CRISPR screening to identify combinations of TKIs that exhibit synergistic effects in eliminating triple-negative breast cancer (TNBC). We discovered and validated that concurrent targeting of FYN, along with other tyrosine kinases such as IGF1R, EGFR or ABL2 can synergistically eradicate TNBC and impede cancer growth. Our findings also provide evidence that the transcriptional upregulation of FYN, facilitated by the activation of KDM4 histone demethylases, confers resistance and persistence to TKIs. Upregulation of FYN is a general feature of drug tolerant cancer cells, suggesting the association of FYN expression with drug resistance and tumor recurrence after treatment.
This research provides basis for breakthrough combinatorial therapy achieving effective targeted therapy with minimal risk of developing resistance. Our combinatorial CRISPR screening demonstrates that treatment with TKIs or histone demethylase inhibitors enhances the sensitivity of cells to other TKIs. Consequently, drug combinations exhibit a more potent inhibition of cancer growth than the simple sum of the therapeutic effects of individual drugs. Furthermore, synergistic drug combinations enable a reduction in the dosage of each drug, with minimal compromise in therapeutic efficacy. Such combinations yield a therapeutic response comparable to that achieved with significantly higher doses of each individual agent. We anticipate that combinatorial therapy has the potential to mitigate side effects by minimizing the dosage of each drug, thus widening the therapeutic window. Further studies should elucidate the downstream mechanisms by which FYN upregulation contributes to drug tolerance. SRC family kinases are known to upregulate multiple signaling pathways including ERK, AKT and p38 pathway(47). Although our study showed that, at least in MDA-MB-231 cell line, FYN depends on p38 activity for TKI resistance (figs. 2J-L), it should further be shown while this downstream mechanism is generalizable in other cancers. The downstream mechanism of p38 that contributes to drug resistance would also be of great interest to identify novel therapeutic approaches minimizing drug tolerance. Also, our combinatorial CRISPR screen results warrant further studies with other synthetic lethal gene combinations other than those involving FYN that are not deeply investigated in this study. Particularly, FGFR2, TEK, FRK identified as key nodes in figure 2C may be of particular interest as they are also associated with cancer cell survival(48, 49).
It is intriguing to observe that FYN is specifically upregulated in various models of drug resistance and tolerance. SRC family kinases, which includes FYN, have been linked to drug resistance(47, 50). In line with this, phosphoproteomic analysis of neoadjuvant chemotherapy resistant TNBC patient derived xenografts showed upregulated SRC family kinase networks including kinases and their substrates and adaptors(51). Our findings reveal that FYN is specifically upregulated at the mRNA level possibly through epigenetic regulations, providing further depth to our understanding of drug resistance in cancer therapy. The epigenetic reprogramming of the drug tolerant cells may be distinct depending on the tumor type or the therapeutic interventions, as KDM4A, which we show is increased upon TKI treatment in TNBC cell line in figure 3, is not significantly regulated in other cancers analyzed in figure 5. Therefore, the context dependent mechanisms underlying FYN upregulation, and its essentiality in constituting drug tolerance remains as subjects for further study.
Furthermore, our work highlights the significance of histone demethylases in TKI resistance. Numerous histone demethylases have been implicated in drug resistance and tolerance across different cancer drug types. For instance, the KDM5 family of H3K4 demethylases has been associated with the drug-tolerant persister phenotype against multiple TKIs(35). In our study, we identify KDM4 as a critical factor in the generation of drug-tolerant persisters in breast cancer. KDM4 is known to be upregulated in various cancers, including breast cancer, and promotes key malignant traits. Previous studies have demonstrated the essential role of KDM4 in induced pluripotency through its interaction with pluripotency factors(52). These findings suggest that an KDM4 inhibitor could be a promising therapeutic target with specific activity against cancer stem cells. Consistently, specific inhibitors targeting KDM4 have recently been developed and shown to inhibit the generation of breast cancer stem cells(38). The mechanisms underlying KDM4 upregulation upon drug treatment is currently unclear and remains as subjects for further study. Nevertheless, given our discoveries regarding the involvement of KDM4 in drug resistance in breast and lung cancer, the development of novel drugs targeting KDM4 holds significant therapeutic potential.
Materials and methods
Cell Culture
HEK293T, MDA-MB-231, Hs578T cells were obtained from American Type Cell Culture (ATCC) HCC1143, HCC1395, HCC1937 were obtained from Korean cell line bank. HEK293T and MDA-MB-231 were grown in DMEM supplemented with 10% FBS and penicillin/streptomycin. Hs578T and HCC1143, HCC1395, HCC1937 were grown in RPMI1640 supplemented with 10% FBS. Parental and gefitinib-, and Osimertinib-resistant PC9 and HCC827 cells were kind gifts from Jae Cheol Lee (Asan Medical Center, Seoul, Korea) and were grown in RPMI1640 supplemented with 10% FBS. Gefitinib and osimertinib resistant cells are maintained in the presence of 1μM gefitnib and 0.5μM osimertinib, respectively. Gefitinib resistant derivatives of PC9 and HCC827 cells were generated as described previously by treating cells with escalating dose of gefitinib (53). All cell culture medium and supplements are purchased from Welgene Inc.
Combinatorial library construction
Combinatorial library was constructed as previously described(15). The sgRNAs used in the screens were cloned in pAWp28 storage vector in two versions: one version containing human U6 driven sgRNA with wild type scaffold, and another containing mouse U6 driven sgRNA with cr2 variant scaffold. The sgRNA expression cassette consisting of U6 promoter and sgRNA were subject to one-pot, iterative cloning into lentiviral pTK799 vector using BglII-MfeI restriction sites flanking the sgRNA expression cassette and BamHI-EcoRI sites in pTK799. pTK799 vector is derived from pAWp12(15) by replacing CMV-GFP selectable marker to EFS-Puro.
Combinatorial CRISPR screening procedure
Lentivirus was generated in HEK293T cells by transfecting lentiviral transfer vector, and helper vectors (psPAX2, and pVSV-G) using Fugene HD (Promega). Lentiviral supernatant was collected 48 hours after transfection, and was frozen and stored in −80C. The appropriate titer for lentiviral transduction was determined by transducing MDA-MB231 cells with two-fold serial dilution of lentiviral supernatant, selecting with puromycin 2 days after transduction for 2 days, and determining cell viability with AQuaeous one cell viability, MTS assay (Promega). After determining the titer of lentiviral supernatant, 100 million MDA-MB231 cells carrying constitutively expressed Cas9 were transduced with CombiGEM library at MOI of 0.3. The expected initial coverage is 100 million x 0.3/ (54,289 different sgRNA combinations)= 553. Three days after transduction, the cells were either harvested as day 0 sample or selected with 2μg/mL puromycin (Invitrogen). Cells were treated with benzonase before harvesting to minimize carryover of plasmid DNA in lentiviral supernatant. Cells were grown in the presence of 2μg/mL puromycin for 20 days before harvesting.
The genomic DNA of harvested cells were isolated using Blood & Cell Culture Maxi kit (Qiagen). The PCR amplicon spanning the two sgRNAs were generated with PCR using Q5 High Fidelity DNA polymerase (New England Biolabs) and the following primers:
F: CAAGCAGAAGACGGCATACGAGAT CCTAGTAACTATAGAGGCTTAATGTGCG
R: AATGATACGGCGACCACCGAGATCTACAC NNNNNN ACACGAATTCTGCCGTGGATCCAA
The six nucleotides described as “NNNNNN” in reverse primer above represents unique index to identify biological replicates in multiplexed NGS run.
The PCR protocol involves 60 seconds of initial DNA denaturation at 98C, and 20 cycles of 10 seconds denaturation at 98C, 10 seconds annealing at 67C, and 120 seconds elongation at 72C. All genomic DNA isolated were used in PCR reaction at concentration of 40μg/mL. All PCR products were combined and precipitated with isopropanol at room temperature. The precipitated DNA was resuspended in 400μL EB buffer (Qiagen) and gel purified. The purified PCR products were sent for NGS by NextSeq500 paired end sequencing with the following sequencing primers:
Forward read: GGACTAGCCTTATTTGAACTTGCTATGCAGCTTTCTGCTTAGCTCTCAAAC
Forward index read: CGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
Reverse read: GCA CCG AGT CGG TGC TTT TTT GGA TCC ACG GCA GAA TTC GTGT
The raw GI scores calculated as deviation from the quadratic fit of the expected-observed Z score plot. The GI scores were normalized by dividing the raw GI scores with the standard deviation of the GI scores obtained from the 200 nearest neighbors in terms of expected Z scores (Fig. S1I)(11).
Data analysis
The sgRNA sequences were identified and their occurrences were counted with C++ script deposited in Github (https://github.com/tackhoonkim/combinatorial-CRISPR-screens-2023).
Validation of screens using sgRNAs
Individual sgRNA was cloned to either pTK1329, and pTK1336 that are both derived from pAWp12 with EFS-GFP and EFS-mCherry, respectively, as selectable markers. Validation of synthetic lethality between gene A and B were analyzed by transducing MDA-MB-231 Cas9 cells with four combinations of lentiviral supernatant pairs (MOI ∼ 0.5 each) containing (1) GFP-sgA and mCherry-sgB; (2) GFP-sgA and mCherry-sgCon; (3) GFP-sgCon and mCherry-sgB; (4) GFP-sgCon and mCherry-sgCon. The fraction of GFP/mCherry double positive cells were analyzed using BD Accuri C6 and its accompanying software. The expected fold change in sgA+sgB were calculated as FCsgA+sgCon x FCsgCon+sgB, where FC is normalized fold change in fraction of GFP/mCherry double positive cells relative to those transduced with GFP-sgCon and mCherry-sgCon.
MTT Cell viability assay
Cells were seeded at 1000-2000 cells/well in 96 well plate. Tyrosine kinase inhibitors at indicated combination of dose were treated 12 hours after seeding, and cells were grown for 3 days. The relative viability was measured by EzCytox cell viability assay (Dojindo). The absorbance at 450nm wavelength was measured using EnVision multimode plate reader (PerkinElmer).
Cell death and cell proliferation assay
Cells were incubated with tyrosine kinase inhibitors for 48 hours. Cell proliferation was quantified with BrdU assay using FITC conjugated BrdU antibody (Biolegend, 364103) and propidum iodide/RNase A solution (Cell Signaling), analyzed with BD Accuri C6 and accompanied software. Cell death was quantified with Live-Dead cell staining kit (Molecular Probes) by flow cytometry analysis using BD Accuri C6 and accompanied software.
Western blot analysis
Cells were treated with drugs for 48 hours unless otherwise indicated. Western blots were performed as previously reported. Briefly, Cells were lysed in RIPA buffer (50mM Tris-HCl pH 7.5, 150mM sodium chloride, 0.1% sodium dodecyl sulfate, 0.5% sodium deoxycholate, 1% NP-40, 1mM EDTA) supplemented with protease inhibitor (aprotinin, leupeptin, pepstatin A, and phenylmethylsulfonyl fluoride [PMSF]) and phosphatase inhibitor (sodium fluoride and sodium orthovanadate) cocktail. Antibodies used for western blot analysis were: anti-SRC (Santa Cruz biotechnology, mouse sc-), anti-FYN (Cell Signaling Technology, rabbit #4023), anti-phospho-FYN Y530 (Invitrogen, PA5-36644), anti-GAPDH (Cell Signaling Technology, rabbit #5174), anti-KDM4A (Bethyl Laboratories, rabbit A300-861A), anti-phospho-ERK T202/Y204 (Cell Signaling Technology, rabbit #9101), anti-ERK (Cell Signaling Technology, rabbit #9102), anti-phospho-STAT3 Y705 (Cell Signaling Technology, rabbit #9145), anti-STAT3 (Cell Signaling Technology,), anti-phospho-AKT (Cell Signaling Technology, mouse #4051), anti-AKT (Cell Signaling Technology,), anti-phospho-p38 (Cell Signaling Technology,), anti-p38 (Cell Signaling Technology,).
RT-qPCR analysis
RNA is extracted from cultured cells with Trizol (Invitrogen) according to the manufacturer’s instructions. The precipitated RNA pellet was resuspended in RNase free water (Enzynomics), and was subject to reverse transcription with M-MLV reverse transcriptase (Enzynomics) at 37C for 2 hours, followed by heat inactivation at 95C for 5 minutes. The resulting cDNA was used for quantitative real time PCR using TOPreal SYBR Green qPCR premix (low ROX, Enzynomics) reagent and CFX96 Real-Time PCR detection system (Bio-Rad).
Xenograft assay
All animal experiments were approved by IACUC of Korea Institute of Science and Technology (KIST). Six-week-old female nude mice were injected with 5 x 106 MDA-MB-231 cells suspended in 1:1 (w/w) mixture of PBS and growth factor reduced Matrigel (Corning) in fourth inguinal mammary fat pad. Starting two weeks after tumor cell injection, saracatinib (50mg/kg mouse body weight, MedChemExpress), NVP-ADW742 (20mg/kg, Sigma), gefitinib (20mg/kg, MedChemExpress), QC6352 (10mg/kg, MedChemExpress) in 45% saline+40% polyethyleneglycol 300 (sigma)+5% Tween-80 (sigma)+5% DMSO (sigma) were injected intraperitoneally every 24 hours for two weeks. Tumor volume was measured by digital caliper and calculated as (width)2 x length x 0.5.
Public database analyses
Gene Expression Omnibus (GEO) data with breast cancer cohort (GSE25066(24)) were analyzed using web based platform Cancer Target Gene Screening (https://ctgs.biohackers.net)(54). Cancer Cell Line Encyclopedia (CCLE) data were analyzed using depmap R package version 1.14. The list of GEO data used for analysis are listed in table S2.
Primary TNBC organoid culture and drug treatment
Specimens was obtained from enrolled patients with TNBC breast cancer with IRB approval. Tumor tissue was collected and transferred using cold RPMI1640 media at the National Cancer Center (Goyang, Republic of Korea). Then the tissues were dissected with a blade on Petri dish and enzymatically digested with dissociated kit (Multi Tissue Dissociation Kit 1, 130-110-201) by gentle MACS Dissociators (Miltenyi Biotec, Germany). After cell counting, 1 × 105 cells were embedded in 40 μl of Matrigel (Corning) and seeded into each well of a 24-well cell culture plate. After the matrigel was solidified, 500 μL organoid medium supplemented with advanced DMEM/F12 medium (Invitrogen, USA), B27 (Invitrogen, USA, 17504), 1.25 mM N-acetylcysteine (Sigma, USA, A9165), 5 ng/mL EGF (PeproTech, USA, AF-100-15), 20 ng/mL FGF-10 (Peprotech, 100-26), 5ng/ml FGF7 (Peprotech, AF-100-19), 50ng/ml R-spondin 1 (Qkine, Qk006), 5 mM nicotinamide (Sigma, N0636), 500 nM A83-01 (Tocris, 2939), 1X GlutaMAX (Gibco, 35050-061), 100ug/ml primocin (Invivogen, ant-pm), 10mM HEPES (Gibco, 15630-080), 1X Noggin (U-Protein Express BV, N002), 1X ITS (Gibco, 12585014), 100nM β-estradiol (Sigma, E2758), 1ug/ml Hydrocortisone (Sigma, H0888), 5nM Heregulin (PeproTech, AF-100-03), 500nM SB202190 (R&D system, 1264), 10uM Y27632 (TOCRIS, 1254) as described by Clevers and colleagues (55), was added to each well and the cells grown under standard culture conditions (37 ℃, 5% CO2).
Availability of data and materials
The NGS data for CRISPR screening results are available under NCBI SRA accession code PRJNA976939.
Acknowledgements
We thank BioMicro Center of MIT for sequencing analysis. We thank Jae Cheol Lee (Asan Medical Center, Korea) for providing gefitinib resistant lung cancer cell lines. This work was supported by Korea Institute of Science and Technology (KIST) Institutional Programs (2E32331 to T.K.); and National Research Foundation of Korea, funded by the Korean government (MSIT) (2021R1A2C1093499 to T.K., 2020M3A9A5036362 to S.Y.K).
Additional information
Author contributions
T.K., B.-S.P., H.J. and J.K. performed experiments. T.K. and T.K.L. supervised the research. S.H. S.-Y.J. and S.Y.K. performed experiments with TNBC patient derived organoids. D.K., S.K.L. generated and provided osimertinib resistant HCC827 cell line.
Ethics Statement
All experiments with human tumor organoids were conducted in accordance with the requirements of the National Cancer Center Institutional Review Board (IRB).
Additional files
References
- 1.Small-molecule kinase inhibitors: an analysis of FDA-approved drugsDrug Discovery Today 21:5–10Google Scholar
- 2.Hallmarks of Cancer: The Next GenerationCell 144:646–74Google Scholar
- 3.Targeted Therapeutic Strategies for Triple-Negative Breast CancerFrontiers in Oncology 11Google Scholar
- 4.High IGF-IR Activity in Triple-Negative Breast Cancer Cell Lines and Tumorgrafts Correlates with Sensitivity to Anti–IGF-IR TherapyClinical Cancer Research 17:2314–27Google Scholar
- 5.Mechanisms of resistance to EGFR-targeted drugs: lung cancerESMO Open 1:e000060Google Scholar
- 6.Gefitinib or Chemotherapy for Non–Small-Cell Lung Cancer with Mutated EGFRNew England Journal of Medicine 362:2380–8Google Scholar
- 7.Resistance mechanisms to osimertinib in EGFR-mutated non-small cell lung cancerBritish Journal of Cancer 121:725–37Google Scholar
- 8.Rational combinations of targeted cancer therapies: background, advances and challengesNature Reviews Drug Discovery 22:213–34Google Scholar
- 9.Multiplexed barcoded CRISPR-Cas9 screening enabled by CombiGEMProceedings of the National Academy of Sciences 113:2544–9Google Scholar
- 10.Mapping the Genetic Landscape of Human CellsCell 174:953–67Google Scholar
- 11.Synergistic drug combinations for cancer identified in a CRISPR screen for pairwise genetic interactionsNature Biotechnology 35:463–74Google Scholar
- 12.Combinatorial CRISPR–Cas9 screens for de novo mapping of genetic interactionsNature Methods 14:573–6Google Scholar
- 13.The Drug Repurposing Hub: a next-generation drug library and information resourceNature medicine 23:405–8Google Scholar
- 14.Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9Nature Biotechnology 34:184–91Google Scholar
- 15.Massively parallel high-order combinatorial genetics in human cellsNat Biotech 33:952–61Google Scholar
- 16.Highly parallel identification of essential genes in cancer cellsProceedings of the National Academy of Sciences 105:20380Google Scholar
- 17.Combined deficiencies of Src, Fyn, and Yes tyrosine kinases in mutant miceGenes & Development 8:1999–2007Google Scholar
- 18.A NOX2/Egr-1/Fyn pathway delineates new targets for TKI-resistant malignanciesOncotarget 6Google Scholar
- 19.Persistent Activation of the Fyn/ERK Kinase Signaling Axis Mediates Imatinib Resistance in Chronic Myelogenous Leukemia Cells through Upregulation of Intracellular SPARCCancer Research 70:9659–70Google Scholar
- 20.A new mechanism of resistance to ABL1 tyrosine kinase inhibitors in a BCR-ABL1-positive cell lineLeukemia Research 61:44–52Google Scholar
- 21.Gene expression profiling of imatinib and PD166326-resistant CML cell lines identifies Fyn as a gene associated with resistance to BCR-ABL inhibitorsMolecular Cancer Therapeutics 8:1924–33Google Scholar
- 22.FYN promotes mesenchymal phenotypes of basal type breast cancer cells through STAT5/NOTCH2 signaling nodeOncogene 37:1857–68Google Scholar
- 23.FYN promotes breast cancer progression through epithelial-mesenchymal transitionOncol Rep 36:1000–6Google Scholar
- 24.A Genomic Predictor of Response and Survival Following Taxane-Anthracycline Chemotherapy for Invasive Breast CancerJAMA 305:1873–81Google Scholar
- 25.Next-generation characterization of the Cancer Cell Line EncyclopediaNature 569:503Google Scholar
- 26.Discovery of a novel, potent, and Src family-selective tyrosine kinase inhibitor. Study of Lck- and FynT-dependent T cell activationJ Biol Chem 271:695–701Google Scholar
- 27.SynergyFinder Plus: Toward Better Interpretation and Annotation of Drug Combination Screening DatasetsGenomics, Proteomics & Bioinformatics 20:587–96Google Scholar
- 28.Preclinical anticancer activity of the potent, oral Src inhibitor AZD0530Molecular Oncology 3:248–61Google Scholar
- 29.Potent inhibition of DOT1L as treatment of MLL-fusion leukemiaBlood 122:1017–25Google Scholar
- 30.Durable tumor regression in genetically altered malignant rhabdoid tumors by inhibition of methyltransferase EZH2Proceedings of the National Academy of Sciences 110:7922–7Google Scholar
- 31.Discovery and Development of Potent and Selective Inhibitors of Histone Methyltransferase G9aACS Medicinal Chemistry Letters 5:205–9Google Scholar
- 32.A selective jumonji H3K27 demethylase inhibitor modulates the proinflammatory macrophage responseNature 488:404Google Scholar
- 33.Taxane-Platin-Resistant Lung Cancers Co-develop Hypersensitivity to JumonjiC Demethylase InhibitorsCell Reports 19:1669–84Google Scholar
- 34.Inhibition of demethylases by GSK-J1/J4Nature 514:E1–E2Google Scholar
- 35.A Chromatin-Mediated Reversible Drug-Tolerant State in Cancer Cell SubpopulationsCell 141:69–80Google Scholar
- 36.Writing, erasing and reading histone lysine methylationsExperimental & Molecular Medicine 49:e324Google Scholar
- 37.Design of KDM4 Inhibitors with Antiproliferative Effects in Cancer ModelsACS Medicinal Chemistry Letters 8:869–74Google Scholar
- 38.KDM4 Inhibition Targets Breast Cancer Stem–like CellsCancer Research 77:5900–12Google Scholar
- 39.Knowledge graph-based recommendation framework identifies drivers of resistance in EGFR mutant non-small cell lung cancerNature Communications 13:1667Google Scholar
- 40.Ontogeny and Vulnerabilities of Drug-Tolerant Persisters in HER2+ Breast CancerCancer Discovery 12:1022–45Google Scholar
- 41.Colorectal Cancer Cells Enter a Diapause-like DTP State to Survive ChemotherapyCell 184:226–42Google Scholar
- 42.mTOR inhibition attenuates chemosensitivity through the induction of chemotherapy resistant persistersNature Communications 13:7047Google Scholar
- 43.In high-grade ovarian carcinoma, platinum-sensitive tumor recurrence and acquired-resistance derive from quiescent residual cancer cells that overexpress CRYAB, CEACAM6, and SOX2The Journal of Pathology 257:367–78Google Scholar
- 44.Assessment of early response biomarkers in relation to long-term survival in patients with HER2-negative breast cancer receiving neoadjuvant chemotherapy plus bevacizumab: Results from the Phase II PROMIX trialInternational Journal of Cancer 142:618–28Google Scholar
- 45.Neoadjuvant Chemoradiotherapy Combined with Atezolizumab for Resectable Esophageal Adenocarcinoma: A Single-arm Phase II Feasibility Trial (PERFECT)Clinical Cancer Research 27:3351–9Google Scholar
- 46.New specific molecular targets for radio-chemotherapy of rectal cancerMolecular Oncology 4:52–64Google Scholar
- 47.Targeting Src family kinases in anti-cancer therapies: turning promise into triumphTrends in Pharmacological Sciences 33:122–8Google Scholar
- 48.Aberrant FGFR signaling mediates resistance to CDK4/6 inhibitors in ER+ breast cancerNature Communications 10:1373Google Scholar
- 49.FRK plays an oncogenic role in non-small cell lung cancer by enhancing the stemness phenotype via induction of metabolic reprogrammingInternational Journal of Cancer 146:208–22Google Scholar
- 50.Inhibiting EGF Receptor or SRC Family Kinase Signaling Overcomes BRAF Inhibitor Resistance in MelanomaCancer Discovery 3:158–67Google Scholar
- 51.Identification of Src Family Kinases as Potential Therapeutic Targets for Chemotherapy-Resistant Triple Negative Breast CancerCancers [Internet] 14Google Scholar
- 52.Jmjd1a and Jmjd2c histone H3 Lys 9 demethylases regulate self-renewal in embryonic stem cellsGenes & Development 21:2545–57Google Scholar
- 53.Activation of the AXL kinase causes resistance to EGFR-targeted therapy in lung cancerNature Genetics 44:852–60Google Scholar
- 54.Cancer Target Gene Screening: a web application for breast cancer target gene screening using multi-omics data analysisBriefings in Bioinformatics 21:663–75Google Scholar
- 55.A Living Biobank of Breast Cancer Organoids Captures Disease HeterogeneityCell 172:373–86Google Scholar
Article and author information
Author information
Version history
- Preprint posted:
- Sent for peer review:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.93921. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, Kim et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,945
- downloads
- 170
- citations
- 8
Views, downloads and citations are aggregated across all versions of this paper published by eLife.