Abstract
The UFD-1 (ubiquitin fusion degradation 1)-NPL-4 (nuclear protein localization homolog 4) heterodimer is involved in extracting ubiquitinated proteins from several plasma membrane locations, including the endoplasmic reticulum. This heterodimer complex helps in the degradation of ubiquitinated proteins via proteasome with the help of AAA+ ATPase CDC-48. While the ubiquitin-proteasome system is known to have important roles in maintaining innate immune responses, the role of the UFD-1-NPL-4 complex in regulating immunity remains elusive. In this study, we investigate the role of the UFD-1-NPL-4 complex in maintaining Caenorhabditis elegans innate immune responses. Inhibition of the UFD-1-NPL-4 complex activates an inflammation-like response that reduces the survival of the wild-type worms on the pathogenic bacterium Pseudomonas aeruginosa despite diminishing colonization of the gut with the bacterium. This inflammation-like response improves the survival of severely immunocompromised worms on pathogenic bacteria but is detrimental on nonpathogenic bacteria. Transcriptomics studies reveal that the GATA transcription factor ELT-2 mediates the inflammation-like response upon inhibition of the UFD-1-NPL-4 complex. Our studies uncover important roles of the UFD-1-NPL-4 complex in innate immunity and reveal the existence of inflammation-like responses in C. elegans.
Introduction
Maintenance of a healthy proteome involves the degradation of misfolded proteins (Vembar and Brodsky, 2008; Vilchez et al., 2014). Proteasomes are a major site for the degradation of misfolded proteins (Clague and Urbe, 2010; Ding and Yin, 2008). Proteins are tagged for proteasomal degradation by ubiquitin through a series of enzymatic reactions (Dikic, 2017). In addition to the proteasomal degradation of proteins, ubiquitination controls a vast array of cellular signals and functions (Husnjak and Dikic, 2012; Mukhopadhyay and Riezman, 2007). The ubiquitination pathways also have important roles in innate immunity regulation (Garcia-Sanchez et al., 2021; Li et al., 2016). The host ubiquitination pathways are involved in the targeting of bacterial proteins, lipopolysaccharides, and bacteria-containing vacuoles, resulting in selective macroautophagy or xenophagy of bacterial pathogens (Chai et al., 2019; Haldar et al., 2015; Otten et al., 2021; Tripathi-Giesgen et al., 2021). Because of the important roles of ubiquitination in host defenses, bacterial pathogens have evolved multiple strategies to target the host ubiquitination pathways (Bomberger et al., 2011; Herhaus and Dikic, 2018; Ribet and Cossart, 2018). Therefore, it is possible that inhibition of the ubiquitination pathways would activate immune responses via compensatory mechanisms.
The proteasomal degradation requires ubiquitin-tagged proteins to be unfolded and extracted from macromolecular complexes (Boom and Meyer, 2018). CDC-48 (VCP/p97 in vertebrates) is a highly conserved AAA+ ATPase that uses its protein unfoldase activity to extract a variety of ubiquitinated polypeptides from membranes or macromolecular complexes (Bodnar and Rapoport, 2017; Meyer et al., 2012). CDC-48 uses different cofactor proteins to recognize its client proteins (Meyer et al., 2012). The UFD-1 (ubiquitin fusion degradation 1)-NPL-4 (nuclear protein localization homolog 4) heterodimer is a CDC-48 cofactor that is involved in the extraction of misfolded and ubiquitinated proteins from several plasma membrane locations, including the endoplasmic reticulum (ER) (Meyer et al., 2000; Wolf and Stolz, 2012; Ye et al., 2001). Therefore, the UFD-1-NPL-4 complex is critical for the ER-associated degradation (ERAD) of misfolded proteins (Wu and Rapoport, 2018). In addition to ERAD, the ER has evolved other strategies to deal with misfolded proteins (Singh, 2023), including a series of unfolded protein response (UPR) pathways that enhance the folding capacity of the ER by synthesis of molecular chaperones and reduction of protein translation (Hetz et al., 2015). The ER-UPR pathways are required for an optimum immune response (Engel and Barton, 2010; Richardson et al., 2010; Sun et al., 2012). However, the role of the UFD-1-NPL-4 complex, which is required for ERAD, in regulating immune responses remains poorly explored. Because ubiquitin-dependent pathways have important roles in immunity, it will be interesting to explore the role of the UFD-1-NPL-4 complex in regulating immune responses.
In this study, we showed that the inhibition of the UFD-1-NPL-4 complex results in the activation of an inflammation-like response in Caenorhabditis elegans. The wild-type worms had a drastic reduction in survival on the pathogenic bacterium Pseudomonas aeruginosa despite having diminished colonization of the gut with the bacterium. Inhibition of the UFD-1-NPL-4 complex also led to diminished bacterial colonization in mutants of ER-UPR and immunity pathways. The diminished bacterial colonization improved the survival of severely immunocompromised mutants on pathogenic bacteria. However, on nonpathogenic bacteria, on which the severely immunocompromised mutants exhibit a normal lifespan, inhibition of the UFD-1-NPL-4 complex resulted in a drastic reduction in lifespan. Transcriptomic studies revealed that inhibition of the UFD-1-NPL-4 complex resulted in the activation of the intracellular pathogen response. Analysis for transcription factor enrichment for upregulated genes identified that the GATA transcription factor ELT-2 mediated the inflammation-like response upon inhibition of the UFD-1-NPL-4 complex. Our studies uncovered important roles of the UFD-1-NPL-4 complex in innate immunity and revealed the existence of inflammation-like responses in C. elegans.
Results
Inhibition of the UFD-1-NPL-4 complex reduces survival of C. elegans on P. aeruginosa
To explore the role of the UFD-1-NPL-4 complex in the innate immune response of C. elegans, we knocked down ufd-1 and npl-4 by RNA interference (RNAi) and studied the survival of the worms on the pathogenic bacterium P. aeruginosa PA14. Knockdown of ufd-1 and npl-4 resulted in a drastic reduction in the survival of N2 wild-type worms on P. aeruginosa compared to worms grown on control RNAi (Figure 1A). The animals also had a reduced lifespan on Escherichia coli HT115 upon knockdown of ufd-1 and npl-4 (Figure 1B). The relationship between C. elegans innate immunity and longevity pathways is complex. Mutants that have reduced lifespan but improved immunity have been identified (Amrit et al., 2019; Otarigho and Aballay, 2021; Ren and Ambros, 2015). Moreover, immunocompromised animals such as mutants of the MAP kinase pathway mediated by NSY-1/SEK-1/PMK-1 have a normal lifespan despite having drastically reduced survival on pathogenic bacteria (Kim et al., 2002; Liberati et al., 2004). Therefore, we explored the mechanisms that led to the reduced survival of ufd-1 and npl-4 knockdown animals on P. aeruginosa. Colonization of the gut with P. aeruginosa is a major determinant of infection and survival of C. elegans under slow-killing conditions (Das et al., 2023; Tan et al., 1999). Because knockdown of ufd-1 and npl-4 reduced survival on P. aeruginosa, we asked whether the animals had enhanced colonization of the gut with P. aeruginosa after ufd-1 and npl-4 RNAi. Surprisingly, we observed that ufd-1 and npl-4 knockdown resulted in reduced colonization of the gut with P. aeruginosa (Figure 1C and 1D). To validate further, we performed the colony-forming unit assay (CFU) upon knockdown of ufd-1 and npl-4. There was a significant decline in the CFU per worm in ufd-1 and npl-4 knockdown worms, indicating reduced numbers of live bacteria in these worms (Figure 1E).

Inhibition of the UFD-1-NPL-4 complex reduces survival of C. elegans on P. aeruginosa
(A) Representative survival plots of N2 animals on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control, ufd-1, and npl-4 RNAi. P<0.001 for ufd-1 and npl-4 RNAi compared to EV control.
(B) Representative survival plots of N2 animals grown on bacteria for RNAi against ufd-1 and npl-4 along with the EV control at 20°C. Day 0 represents young adults. P<0.001 for ufd-1 and npl-4 RNAi compared to EV control.
(C) Representative fluorescence (top) and the corresponding brightfield (bottom) images of N2 animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control, ufd-1, and npl-4 RNAi bacteria. Scale bar = 200 μm.
(D) Quantification of GFP levels of N2 animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control, ufd-1, and npl-4 RNAi bacteria. ***P < 0.001 via the t-test (n = 16 worms each).
(E) Colony-forming units (CFU) per animal of N2 worms incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control, ufd-1, and npl-4 RNAi bacteria. **P < 0.01 via the t-test (n = 6 biological replicates).
Reduced colonization of the gut by P. aeruginosa could be because of reduced uptake of the bacterium in ufd-1 and npl-4 knockdown animals. The rate of pharyngeal pumping is an indicator of the uptake of bacterial food. We studied whether inhibition of ufd-1 and npl-4 affected the pharyngeal pumping rate. The knockdown of ufd-1 and npl-4 did not affect the pharyngeal pumping rate (Figure S1A), indicating that the reduced colonization was unlikely due to the reduced uptake of bacteria. Next, we tested whether exposure to P. aeruginosa affected the pharyngeal pumping in ufd-1 and npl-4 knockdown animals. Exposure to P. aeruginosa for 12 hours resulted in a minimal reduction in the pharyngeal pumping rate in ufd-1 and npl-4 knockdown animals compared to control animals (Figure S1B). These results suggested that the reduced colonization of ufd-1 and npl-4 knockdown animals by P. aeruginosa was unlikely because of the reduced uptake of bacteria. Taken together, these results suggested that the inhibition of the UFD-1-NPL-4 complex reduced the survival of C. elegans on P. aeruginosa despite diminished colonization of the gut with the bacterium. Because ufd-1 and npl-4 RNAi led to very similar phenotypes, we further used only ufd-1 RNAi to decipher the mechanisms of reduced survival and diminished colonization on P. aeruginosa.
Reduced colonization with P. aeruginosa upon ufd-1 knockdown is independent of the ER-UPR pathways
Knockdown of the UFD-1-NPL-4 complex is known to cause ER stress, resulting in the upregulation of the ER-UPR pathways (Mouysset et al., 2006; Sasagawa et al., 2007). Because ER stress and UPR pathways modulate innate immunity (Richardson et al., 2010; Singh and Aballay, 2017; Sun et al., 2012), we asked whether the ER-UPR pathways were involved in the regulation of survival and colonization of ufd-1 knockdown animals on P. aeruginosa. We studied the survival and colonization of mutants of different ER-UPR pathways, including xbp-1(tm2482), atf-6(ok551), and pek-1(ok275) on P. aeruginosa. The survival of xbp-1(tm2482) animals upon ufd-1 knockdown was indistinct from the control animals (Figure 2A). However, ufd-1 knockdown resulted in drastically reduced gut colonization with P. aeruginosa in xbp-1(tm2482) animals (Figure 2B and 2C). This indicated that the xbp-1 pathway was not required for the reduced P. aeruginosa colonization of ufd-1 knockdown animals.

Reduced colonization with P. aeruginosa upon ufd-1 knockdown is independent of the ER-UPR pathways
(A) Representative survival plots of xbp-1(tm2482) animals on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control and ufd-1 RNAi. The difference between the EV and ufd-1 RNAi survival plots is nonsignificant.
(B) Representative fluorescence images of xbp-1(tm2482) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm.
(C) Quantification of GFP levels of xbp-1(tm2482) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. **P < 0.01 via the t-test (n = 16 worms each).
(D) Representative survival plots of atf-6(ok551) animals on P. aeruginosa PA14 at 25°C after treatment with the EV control and ufd-1 RNAi. P<0.001.
(E) Representative fluorescence images of atf-6(ok551) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm.
(F) Quantification of GFP levels of atf-6(ok551) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***P < 0.001 via the t-test (n = 16 worms each).
(G) Representative survival plots of pek-1(ok275) animals on P. aeruginosa PA14 at 25°C after treatment with the EV control and ufd-1 RNAi. P<0.001.
(H) Representative fluorescence images of pek-1(ok275) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm.
(I) Quantification of GFP levels of pek-1(ok275) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***P < 0.001 via the t-test (n = 24–25 worms each).
The atf-6(ok551) animals exhibited reduced survival on P. aeruginosa upon ufd-1 RNAi compared to the control RNAi (Figure 2D). Similar to N2, ufd-1 knockdown resulted in reduced colonization of the gut with P. aeruginosa in atf-6(ok551) animals (Figure 2E and 2F). The pek-1(ok275) animals exhibited similar phenotypes of reduced survival and diminished colonization on P. aeruginosa upon ufd-1 knockdown (Figure 2G-I). These results indicated that the reduced colonization and survival of ufd-1 knockdown animals on P. aeruginosa were independent of the ER-UPR pathways.
Reduced colonization with P. aeruginosa upon ufd-1 knockdown is independent of the major immunity pathways
Next, we tested whether any of the immunity pathways were involved in regulating the reduced colonization by ufd-1 knockdown. To this end, we studied the survival and colonization of mutants of different immunity pathways on P. aeruginosa upon knockdown of ufd-1. The pmk-1(km25) animals, which are part of a MAP kinase pathway mediated by NSY-1/SEK-1/PMK-1 (Kim et al., 2002), had a similar survival rate on control and ufd-1 RNAi (Figure 3A). However, ufd-1 knockdown drastically reduced colonization in pmk-1(km25) animals (Figure 3B and 3C). This indicated that the pmk-1 pathway is unlikely to be involved in mediating ufd-1 knockdown effects, and the similar survival rate of control and ufd-1 RNAi animals is merely coincidental. Indeed, a mutant of the upstream regulator of the PMK-1 pathway, the Toll/interleukin-1 receptor domain protein (TIR-1) (Liberati et al., 2004; Peterson et al., 2022), exhibited phenotypes similar to pmk-1(km25) animals (Figure S2A-C).

Reduced colonization with P. aeruginosa upon ufd-1 knockdown is independent of the major immunity pathways
(A) Representative survival plots of pmk-1(km25) animals on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control and ufd-1 RNAi. The difference between the EV and ufd-1 RNAi survival plots is nonsignificant.
(B) Representative fluorescence images of pmk-1(km25) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm.
(C) Quantification of GFP levels of pmk-1(km25) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***P < 0.001 via the t-test (n = 16 worms each).
(D) Representative survival plots of dbl-1(nk3) animals on P. aeruginosa PA14 at 25°C after treatment with the EV control and ufd-1 RNAi. The difference between the EV and ufd-1 RNAi survival plots is nonsignificant.
(E) Representative fluorescence images of dbl-1(nk3) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm.
(F) Quantification of GFP levels of dbl-1(nk3) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***P < 0.001 via the t-test (n = 16 worms each).
(G) Representative survival plots of hlh-30(tm1978) animals on P. aeruginosa PA14 at 25°C after treatment with the EV control and ufd-1 RNAi. P<0.001.
(H) Representative fluorescence images of hlh-30(tm1978) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm.
(I) Quantification of GFP levels of hlh-30(tm1978) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***P < 0.001 via the t-test (n = 16 worms each).
The mutants of the TGF-β/DBL-1 (Mallo et al., 2002) and TFEB/HLH-30 (Visvikis et al., 2014) immunity pathways also exhibited phenotypes similar to pmk-1(km25) animals. The knockdown of ufd-1 resulted in drastically reduced colonization of dbl-1(nk3) and hlh-30(tm1978) animals without affecting their survival on P. aeruginosa (Figure 3D-I). These results indicated that the reduced colonization with P. aeruginosa upon ufd-1 knockdown was independent of these immunity pathways.
Inhibition of the UFD-1-NPL-4 complex improves survival of severely immunocompromised C. elegans on P. aeruginosa
Knockdown of ufd-1 reduced colonization in wild-type animals as well as mutants of ER-UPR and innate immunity pathways. Interestingly, despite variable survival rates on control RNAi, all strains had similar survival rates upon knockdown of ufd-1 (Figure S3). We reasoned that ufd-1 knockdown might lead to an inflammation-like response that results in diminished gut colonization by P. aeruginosa and reduces the survival of healthy but not immunocompromised animals. If the knockdown of the UFD-1-NPL-4 complex indeed resulted in an inflammation-like response, their knockdown should improve the survival of severely immunocompromised animals. In C. elegans, the canonical p38 MAP kinase signaling cascade consists of NSY-1 (ASK1 MAPKKK), SEK-1 (MKK3/MKK6 MAPKK), and PMK-1 (p38 MAPK) (Kim et al., 2002). Compared to pmk-1 knockout, the knockout of sek-1 leads to more severe effects on survival upon infection with P. aeruginosa (Meng et al., 2021). Indeed, we observed that most of the sek-1(km4) animals on control RNAi died within 24 hours of exposure to P. aeruginosa (Figure 4A). Importantly, the knockdown of ufd-1 resulted in a drastic improvement in the survival of sek-1(km4) animals (Figure 4A). To test whether the improved survival of sek-1(km4) animals upon the knockdown of ufd-1 was because of inhibition of the UFD-1-NPL-4 complex, we studied the survival of sek-1(km4) animals upon npl-4 RNAi. The knockdown of npl-4 also resulted in drastically enhanced survival of sek-1(km4) animals (Figure 4A).

Inhibition of the UFD-1-NPL-4 complex improves survival of severely immunocompromised C. elegans on P. aeruginosa
(A) Representative survival plots of sek-1(km4) animals on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control, ufd-1, and npl-4 RNAi. P<0.001 for ufd-1 and npl-4 RNAi compared to EV control.
(B) Representative fluorescence images of sek-1(km4) animals incubated on P. aeruginosa-GFP for 12 hours at 25°C after growth on the EV control, ufd-1, and npl-4 RNAi bacteria. Scale bar = 200 μm.
(C) Quantification of GFP levels of sek-1(km4) animals incubated on P. aeruginosa-GFP for 12 hours at 25°C after growth on the EV control, ufd-1, and npl-4 RNAi bacteria. ***P < 0.001 via the t-test (n = 19–20 worms each).
(D) Representative survival plots of sek-1(km4) animals grown on bacteria for RNAi against ufd-1 and npl-4 along with the EV control at 20°C. Day 0 represents young adults. P<0.001 for ufd-1 and npl-4 RNAi compared to EV control.
(E) Representative survival plots of dbl-1(nk3);pmk-1(km25) animals on P. aeruginosa PA14 at 25°C after treatment with the EV control and ufd-1 RNAi. P<0.001.
(F) Representative fluorescence images of dbl-1(nk3);pmk-1(km25) animals incubated on P. aeruginosa-GFP for 12 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm.
(G) Quantification of GFP levels of dbl-1(nk3);pmk-1(km25) animals incubated on P. aeruginosa-GFP for 12 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***P < 0.001 via the t-test (n = 24 worms each).
Knockdown of both ufd-1 and npl-4 in sek-1(km4) animals resulted in reduced gut colonization by P. aeruginosa compared to control RNAi (Figure 4B and 4C). Because sek-1(km4) animals do not have a reduced lifespan on E. coli diet (Kim et al., 2002), we studied how inhibition of the UFD-1-NPL-4 complex affected the lifespan of sek-1(km4) animals. We reasoned that if the inhibition of the UFD-1-NPL-4 complex truly led to an inflammation-like response, it should result in a reduced lifespan of sek-1(km4) animals on E. coli despite improving their survival on P. aeruginosa. Indeed, the knockdown of ufd-1 and npl-4 drastically reduced the lifespan of sek-1(km4) animals on E. coli HT115 (Figure 4D). These results suggested that inhibition of the UFD-1-NPL-4 complex led to an inflammation-like response, which improves survival of severely immunocompromised animals under infection conditions but reduces survival of such animals under non-infection conditions.
To further establish that inhibition of the UFD-1-NPL-4 complex resulted in the improved survival of severely immunocompromised animals on P. aeruginosa, we created a dbl-1(nk3);pmk-1(km25) double mutant. The TGF-β/DBL-1 and p38 MAPK/PMK-1 control immunity via parallel pathways (Singh and Aballay, 2020), and the dbl-1(nk3);pmk-1(km25) animals show reduced survival on P. aeruginosa compared to individual mutants (Figure 4E). The knockdown of ufd-1 resulted in improved survival (Figure 4E) and reduced colonization (Figure 4F and 4G) of dbl-1(nk3);pmk-1(km25) animals on P. aeruginosa. Taken together, these data showed that inhibition of the UFD-1-NPL-4 complex improved the survival of severely immunocompromised animals on P. aeruginosa.
Knockdown of ufd-1 results in the upregulation of protease and intracellular pathogen response genes
To understand the molecular basis of the phenotypes observed upon knockdown of ufd-1, we used RNA sequencing to focus on transcriptional changes induced by ufd-1 RNAi. Of the 439 differentially regulated genes, 319 were upregulated, while 120 were down-regulated (Figure 5A and Table S1). Gene ontology (GO) analysis for biological processes for upregulated genes showed enrichment for innate immune response (Figure 5B). As ufd-1 is required for ERAD, different ER-UPR pathway genes were also enriched in the upregulated genes. In addition, enrichment for proteolysis genes was also observed. GO analysis for cellular components and molecular function for upregulated genes showed enrichment for lysosomes and peptidase activities, respectively (Figure 5C and 5D). These results indicated that the knockdown of ufd-1 might result in increased proteolysis activities via lysosomes. GO analysis for biological processes for downregulated genes also showed enrichment for innate immune response (Figure S4A). This indicated that ufd-1 might be required for the expression of some innate immune response genes. GO analysis for cellular components and molecular function for downregulated genes primarily identified functions related to nucleosomes (Figure S4B and S4C). Indeed, UFD-1 is known to localize to the nucleus and is required for chromatin stability (Mouysset et al., 2008).

Knockdown of ufd-1 results in the upregulation of protease and intracellular pathogen response genes
(A) Volcano plot of upregulated and downregulated genes in ufd-1 RNAi versus empty vector (EV) control RNAi N2 animals. Orange and green dots represent significantly upregulated and downregulated genes, respectively, while the grey dots represent the genes that are not differentially regulated
(B)-(D) Gene ontology enrichment analysis for ufd-1 RNAi upregulated genes for biological processes (B), cellular component (C), and molecular function (D).
(E) Venn diagram showing the overlap between genes upregulated upon ufd-1 RNAi and upregulated upon Nematocida parisii infection (Bakowski et al., 2014). The P-value for the overlap between the data is 8.2×10-110.
(F) Venn diagram showing the overlap between genes upregulated upon ufd-1 RNAi and upregulated upon Orsay virus infection (Sarkies et al., 2013). The P-value for the overlap between the data is 2.7×10-62.
Next, we compared the upregulated genes with previously published gene expression data using WormExp (Yang et al., 2016b). Interestingly, we observed that the ufd-1 RNAi upregulated genes had a very high overlap with genes upregulated by intracellular pathogens Nematocida parisii (Bakowski et al., 2014) (Figure 5E) and Orsay virus (Sarkies et al., 2013) (Figure 5F). Infection with the intracellular pathogens N. parisii and Orsay virus results in the activation of an intracellular pathogen response (IPR), which includes several protein containing ALS2CR12 signature (pals) genes as well as genes involved in proteolysis (Bakowski et al., 2014; Sarkies et al., 2013). Indeed, ufd-1 RNAi resulted in the upregulation of several pals and proteolysis genes (Table S1). These results indicated that the knockdown of ufd-1 might mimic an intracellular pathogen infection and result in the activation of the IPR.
GATA transcription factor ELT-2 mediates the ufd-1 knockdown phenotypes
To identify the genes downstream of ufd-1 knockdown that were responsible for reduced colonization, we knocked down individual genes that were upregulated upon ufd-1 RNAi and studied colonization of the gut with P. aeruginosa. We hypothesized that the reduced colonization might be because of increased expression of proteolysis genes. Therefore, we knocked down the proteolysis genes that were upregulated by ufd-1 RNAi. Knockdown of none of the protease genes led to increased colonization in ufd-1 knockdown animals (Figure S5A). Because ufd-1 knockdown also resulted in the upregulation of several pals genes, which are part of the IPR, we next targeted the pals genes upregulated by ufd-1 RNAi. Knockdown of none of the pals genes led to increased colonization in ufd-1 knockdown animals (Figure S5B). These results indicated that either the proteases and IPR genes are not involved in the regulation of colonization in ufd-1 knockdown animals, or these genes function redundantly, and multiple genes are required for the phenotype.
To identify the transcription factors that regulate the diminished colonization and reduced survival phenotype of ufd-1 knockdown, we carried out transcription factor enrichment analysis for upregulated genes using WormExp. The ufd-1 RNAi upregulated genes substantially overlapped with the genes regulated by the GATA transcription factor ELT-2 (Dineen et al., 2018; Mann et al., 2016) (Figure 6A and 6B). Indeed, ELT-2 is known to regulate protease and pals genes (Mann et al., 2016). To test whether ELT-2 might be required for the ufd-1 knockdown phenotypes, we studied P. aeruginosa colonization in N2 animals upon the knockdown of ufd-1 and elt-2. Knockdown of elt-2 resulted in a significant increase in P. aeruginosa colonization in ufd-1 knockdown animals (Figure 6C and 6D). Similar to N2 worms, the knockdown of elt-2 resulted in a significant increase in P. aeruginosa colonization in ufd-1 knockdown sek-1(km4) animals (Figure 6E and 6F). Because ufd-1 knockdown in sek-1(km4) worms improves their survival on P. aeruginosa (Figure 4A), we also studied whether elt-2 was responsible for the increased survival of sek-1(km4) worms upon ufd-1 knockdown. Indeed, the knockdown of elt-2 abolished the beneficial effects of ufd-1 knockdown on the survival of sek-1(km4) worms on P. aeruginosa (Figure 6G). Taken together, these results indicated that the inflammation-like response triggered by the inhibition of the UFD-1-NPL-4 complex is mediated by ELT-2.

GATA transcription factor ELT-2 mediates the ufd-1 knockdown phenotypes
(A) Venn diagram showing the overlap between genes upregulated upon ufd-1 RNAi and upregulated in wt versus elt-2(-) larvae (Dineen et al., 2018). The P-value for the overlap between the data is 9.5×10-52.
(B) Venn diagram showing the overlap between genes upregulated upon ufd-1 RNAi and the low-complexity ELT-2 target genes (Mann et al., 2016). The P-value for the overlap between the data is 1.5×10-34.
(C) Representative fluorescence (top) and the corresponding brightfield (bottom) images of N2 animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the empty vector (EV) control, ufd-1, EV+elt-2, EV+ufd-1, and ufd-1+elt-2 RNAi bacteria (see Methods for the details). Scale bar = 200 μm.
(D) Quantification of GFP levels of N2 animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control, ufd-1, EV+elt-2, EV+ufd-1, and ufd-1+elt-2 RNAi bacteria. ***P < 0.001 via the t-test (n = 20 worms each).
(E) Representative fluorescence (top) and the corresponding brightfield (bottom) images of sek-1(km4) animals incubated on P. aeruginosa-GFP for 12 hours at 25°C after growth on the EV control, ufd-1, EV+elt-2, EV+ufd-1, and ufd-1+elt-2 RNAi bacteria. Scale bar = 200 μm.
(F) Quantification of GFP levels of sek-1(km4) animals incubated on P. aeruginosa-GFP for 12 hours at 25°C after growth on the EV control, ufd-1, EV+elt-2, EV+ufd-1, and ufd-1+elt-2 RNAi bacteria. ***P < 0.001 and **P < 0.01via the t-test (n = 16–19 worms each).
(G) Representative survival plots of sek-1(km4) animals on P. aeruginosa PA14 at 25°C after treatment with the EV control, ufd-1, EV+elt-2, EV+ufd-1, and ufd-1+elt-2 RNAi bacteria. P<0.001 for ufd-1+elt-2 RNAi compared to EV+ufd-1 RNAi.
Discussion
In this study, we show that inhibition of the UFD-1-NPL-4 complex leads to an inflammation-like response in C. elegans. Inhibition of the UFD-1-NPL-4 complex leads to reduced gut colonization with P. aeruginosa in wild-type animals as well as mutants of different ER-UPR and immunity pathways. Despite the reduction in pathogen colonization, the wild-type animals exhibit reduced survival, indicating an inflammatory response. However, immunocompromised mutants, which have drastically reduced survival on pathogenic bacteria, exhibit reduced colonization and improved survival on inhibition of the UFD-1-NPL-4 complex. This indicates that the inflammatory response activated by the inhibition of the UFD-1-NPL-4 complex compensates for the dampened immune response of the immunocompromised mutants. Despite beneficial effects on the survival on pathogenic bacteria, inhibition of the UFD-1-NPL-4 complex leads to adverse effects on the lifespan of immunocompromised mutants. This is because the immunocompromised mutants have a normal lifespan on nonpathogenic bacteria, and the inflammatory response becomes detrimental on such bacterial diets.
We find that the knockdown of ufd-1 led to the upregulation of several genes that are part of the IPR activated by intracellular pathogens N. parisii and Orsay virus (Bakowski et al., 2014; Sarkies et al., 2013). The ubiquitination components have been shown to be required for targeting the intracellular pathogen N. parisii (Bakowski et al., 2014). As a counterattack, the pathogen probably targets the ubiquitin-proteasome system of the host (Bakowski et al., 2014). Therefore, the intracellular pathogens N. parisii and Orsay virus might activate the IPR by inhibiting the ubiquitin-proteasome system (Bakowski et al., 2014; Reddy et al., 2019). We show that inhibition of the UFD-1-NPL-4 complex activates the IPR. The activation of the IPR by the inhibition of the UFD-1-NPL-4 complex could be a consequence of the direct inhibition of this complex itself or an indirect perturbation of the proteasomal degradation of proteins. In future studies, it will be intriguing to decipher whether intracellular pathogens target the UFD-1-NPL-4 complex.
We demonstrate that the GATA transcription factor ELT-2 mediated the inflammatory response downstream of the inhibition of the UFD-1-NPL-4 complex. ELT-2 is known to be required for defense as well as recovery responses against a variety of pathogens (Head and Aballay, 2014; Shapira et al., 2006; Yang et al., 2016a). Previous studies have reported interactions of ELT-2 with the proteasome system. The non-proteolytic activity of the 19S proteasome subunit RPT-6 was shown to regulate the ELT-2-mediated immune response (Olaitan and Aballay, 2018). Another study showed that the bacterial pathogen Burkholderia pseudomallei leads to the downregulation of ELT-2 target genes (Lee et al., 2013). It was demonstrated that the downregulation of ELT-2 targets was associated with the degradation of ELT-2 protein by the host ubiquitin-proteasome system. Therefore, multiple mechanisms could regulate the activity of ELT-2 via the ubiquitin-proteasome system. In future studies, it will be interesting to study how inhibition of the UFD-1-NPL-4 complex modulates the activities of the GATA transcription factor ELT-2.
Materials and Methods
Bacterial strains
The following bacterial strains were used in the current study: Escherichia coli OP50, E. coli HT115(DE3), Pseudomonas aeruginosa PA14, and P. aeruginosa PA14 expressing green fluorescent protein (P. aeruginosa PA14-GFP). The cultures of E. coli OP50, E. coli HT115(DE3), and P. aeruginosa PA14 were grown in Luria-Bertani (LB) broth at 37°C. The P. aeruginosa PA14-GFP cultures were grown in LB broth with 50 µg/mL kanamycin at 37°C.
C. elegans strains and growth conditions
C. elegans hermaphrodites were maintained at 20°C on nematode growth medium (NGM) plates seeded with E. coli OP50 as the food source unless otherwise indicated. Bristol N2 was used as the wild-type control unless otherwise indicated. The following strains were used in the study: KU4 sek-1(km4), KU25 pmk-1(km25), NU3 dbl-1(nk3), JIN1375 hlh-30(tm1978), xbp-1(tm2482), RB545 pek-1(ok275), RB772 atf-6(ok551), and RB1085 tir-1(qd4). Some of the strains were obtained from the Caenorhabditis Genetics Center (University of Minnesota, Minneapolis, MN). The dbl-1(nk3);pmk-1(km25) strain was obtained by a standard genetic cross.
Construction of the npl-4 RNAi clone
The 1581-base-pair full-length cDNA of npl-4.1 was amplified using the forward primer 5’- GCTCCCGGGATGGTACTTGAAGTCCCTCA -3’ and the reverse primer 5’-AGGTCTAGAATCGGCAGCTGGCAATCCAC -3’. Because the nucleotide sequence of the npl-4.1 gene is 99% identical to that of the npl-4.2 gene, the cloned cDNA will target both of these genes. Therefore, the clone is referred to as npl-4. The fragment was cloned into the SmaI and XbaI sites of pL4440 (Open Biosystems) and transformed into E. coli HT115(DE3) cells.
RNA interference (RNAi)
RNAi was used to generate loss-of-function phenotypes by feeding worms with E. coli strain HT115(DE3) expressing double-stranded RNA homologous to a target C. elegans gene. RNAi was carried out as described previously (Das et al., 2023). Briefly, E. coli HT115(DE3) with the appropriate vectors were grown in LB broth containing ampicillin (100 μg/mL) at 37°C overnight on a shaker, concentrated ten times, and plated onto RNAi NGM plates containing 100 μg/mL ampicillin and 3 mM isopropyl β-D-thiogalactoside (IPTG). The plated bacteria were allowed to grow overnight at 37°C. For synchronization of worms, gravid adults were transferred to RNAi-expressing bacterial lawns and allowed to lay eggs for 2 hours. The gravid adults were removed, and the eggs were developed at 20°C for 96 hours. For protease and IPR genes co-RNAi with ufd-1, E. coli HT115(DE3) with the appropriate vectors were grown separately at 37°C overnight until growth saturation. Then, the RNAi cultures were mixed in a ratio of 1:1, concentrated ten times, and plated onto RNAi plates, followed by overnight growth at 37°C. We used all the protease and pals genes that were upregulated upon ufd-1 RNAi and were present in the Ahringer RNAi library. For experiments involving elt-2 RNAi, the worms were grown on the control empty vector (EV) and ufd-1 RNAi for 48 hours at 20°C to obtain the L4 stage worms. Afterward, the worms grown on EV were transferred to EV+elt-2 RNAi plates, and those grown on ufd-1 RNAi were transferred to EV+ufd-1 and ufd-1+elt-2 RNAi plates. This was followed by the incubation of the worms at 20°C for another 48 hours before transferring to P. aeruginosa plates.
C. elegans killing assay on P. aeruginosa PA14
The full-lawn killing assays of C. elegans on P. aeruginosa PA14 were carried out as described earlier (Singh and Aballay, 2019a). Briefly, P. aeruginosa PA14 cultures were grown by inoculating individual bacterial colonies into 2 mL of LB broth and growing them for 8–10 hours on a shaker at 37°C. Then, 20 µL of the culture was spread on the complete surface of 3.5-cm-diameter standard slow-killing (SK) plates (modified NGM agar plates (0.35% instead of 0.25% peptone)). The plates were incubated at 37°C for 12-16 hours and then cooled to room temperature for at least 30 min before seeding with synchronized gravid adult hermaphrodite worms. The killing assays were performed at 25°C, and live animals were transferred to fresh plates after every 24 hours. Animals were scored at the indicated times and considered dead when they failed to respond to touch. At least three independent experiments were performed for each condition.
P. aeruginosa-GFP colonization assay
The P. aeruginosa PA14-GFP colonization assays were carried out as described earlier (Das et al., 2023; Singh and Aballay, 2019b). Briefly, bacterial cultures were prepared by inoculating individual bacterial colonies into 2 mL of LB broth containing 50 μg/mL kanamycin and growing them for 8-10 hours on a shaker at 37°C. Then, 20 μL of the culture was spread on the complete surface of 3.5-cm-diameter SK plates containing 50 μg/mL kanamycin. The plates were incubated at 37°C for 12-16 hours and then cooled to room temperature for at least 30 min before seeding with gravid adult hermaphrodite worms. The assays were performed at 25°C. At indicated times, the worms were picked under a non-fluorescence stereomicroscope and visualized within 5 minutes under a fluorescence microscope.
Quantification of intestinal bacterial loads
The quantification of intestinal P. aeruginosa PA14-GFP load was carried by measuring colony-forming units (CFU) as described earlier (Das et al., 2023). Briefly, P. aeruginosa PA14-GFP lawns were prepared as described above. At the indicated times for each experiment, the animals were transferred from P. aeruginosa-GFP plates to the center of fresh E. coli OP50 plates thrice for 10 minutes each to eliminate bacteria stuck to their body. Afterward, ten animals/condition were transferred into 50 μL of PBS containing 0.01% triton X-100 and ground using glass beads. Serial dilutions of the lysates (101, 102, 103, 104) were seeded onto LB plates containing 50 μg/mL of kanamycin to select for P. aeruginosa-GFP cells and grown overnight at 37°C. Single colonies were counted the next day and represented as the number of bacterial cells or CFU per animal. Six independent experiments were performed for each condition.
Pharyngeal Pumping Assay
For the pharyngeal pumping assay without P. aeruginosa PA14 exposure, wild-type N2 animals were grown on appropriate RNAi clones till 1-day-old adults before the measurements. For the pharyngeal pumping assay with P. aeruginosa PA14 exposure, wild-type N2 animals were grown on appropriate RNAi clones till 1-day-old adults, followed by exposure to P. aeruginosa PA14 for 12 hours at 25°C before measurements. The number of contractions of the terminal bulb of the pharynx was counted for 30 seconds per worm. The pumping rates for at least 30 worms were recorded for each condition.
C. elegans lifespan assays
Lifespan assays were performed as described earlier (Das et al., 2023). Briefly, the assays were performed on RNAi plates containing E. coli HT115(DE3) with appropriate vectors in the presence of 50 µg/mL of 5-fluorodeoxyuridine (FUdR). Animals were synchronized on RNAi plates without FUdR and incubated at 20°C. At the late L4 larval stage, the animals were transferred onto the corresponding RNAi plates containing 50 µg/mL of FUdR and incubated at 20°C. Animals were scored every day as live, dead, or gone. Animals that failed to display touch-provoked movement were scored as dead. Animals that crawled off the plates were censored. Experimental groups contained more than 60 animals per condition per replicate. Young adult animals were considered as day 0 for the lifespan analysis. Three independent experiments were performed.
RNA isolation
RNA isolation was carried out as described earlier (Singh and Aballay, 2017). Briefly, animals were synchronized by egg laying. Approximately 35 N2 gravid adult animals were transferred to 10-cm RNAi plates seeded with E. coli HT115 expressing the appropriate vectors and allowed to lay eggs for 4 hours. The gravid adults were then removed, and the eggs were allowed to develop at 20°C for 96 hours. The animals were then collected, washed with M9 buffer, and frozen in TRIzol reagent (Life Technologies, Carlsbad, CA). Total RNA was extracted using the RNeasy Plus Universal Kit (Qiagen, Netherlands). Residual genomic DNA was removed using TURBO DNase (Life Technologies, Carlsbad, CA).
RNA sequencing and data analysis
Total RNA samples for N2 animals grown on control empty vector and ufd-1 RNAi were isolated from three biological replicates as described above. Library preparation and sequencing were performed at the Novogene Corporation Inc, USA. The cDNA libraries were sequenced on HiseqX sequencing platform using 150 bp paired-end nucleotide reads.
The RNA sequence data were analyzed using the web platform Galaxy (https://usegalaxy.org/). The paired reads were first trimmed using the Trimmomatic tool. The trimmed reads obtained for each sample were mapped to the C. elegans genome (WS220) using the aligner STAR. The number of reads mapped to each gene was counted using the htseq-count tool. Differential gene expression analysis was then performed using DESeq2. Genes exhibiting at least two-fold change and P-value <0.01 were considered differentially expressed. Gene ontology analysis was performed using the DAVID Bioinformatics Database (https://david.ncifcrf.gov/tools.jsp). The overlap of the upregulated genes with previously published datasets was carried out with WormExp v 2.0 (https://wormexp.zoologie.uni-kiel.de/wormexp/) (Yang et al., 2016b). The Venn diagrams were obtained using the web tool BioVenn (https://www.biovenn.nl/) (Hulsen et al., 2008).
Fluorescence imaging
Fluorescence imaging was carried out as described previously (Gokul and Singh, 2022; Ravi et al., 2023). Briefly, the animals were anesthetized using an M9 salt solution containing 50 mM sodium azide and mounted onto 2% agarose pads. The animals were then visualized using a Nikon SMZ-1000 fluorescence stereomicroscope. The fluorescence intensity was quantified using Image J software.
Quantification and statistical analysis
The statistical analysis was performed with Prism 8 (GraphPad). All error bars represent mean±standard deviation (SD). The two-sample t-test was used when needed, and the data were judged to be statistically significant when p < 0.05. In the figures, asterisks (*) denote statistical significance as follows: *, p<0.05, **, p<0.01, ***, p<0.001, as compared with the appropriate controls. The Kaplan-Meier method was used to calculate the survival fractions, and statistical significance between survival curves was determined using the log-rank test. All experiments were performed in triplicate.
Acknowledgements
Some strains used in this study were provided by the Caenorhabditis Genetics Center (CGC), which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440).
Funding
This work was supported by the following grants: Ramalingaswami Re-entry Fellowship (Ref. No. BT/RLF/Re-entry/50/2020) awarded by the Department of Biotechnology, India, STARS grant (File No. MoE-STARS/STARS-2/2023-0116) awarded by the Ministry of Education, India, Startup Research Grant, SERB (Ref. No. SRG/2020/000022) awarded by DST, India, and IISER Mohali intramural funds. R.R. was supported by a junior research fellowship from the Council of Scientific & Industrial Research (CSIR), India.
Competing interest
The authors declare that they have no competing interest.
Data Availability
The RNA sequencing data for N2 worms grown on empty vector control and ufd-1 RNAi have been submitted to the public repository, the Sequence Read Archive, with BioProject ID PRJNA1033335. All data generated or analyzed during this study are included in the manuscript and supporting files.
Supplementary Figures

Inhibition of the UFD-1-NPL-4 complex does not affect the pharyngeal pumping rate
(A) Pharyngeal pumps per 30 sec of N2 animals grown on ufd-1 and npl-4 RNAi along with the empty vector (EV) control RNAi. *P < 0.05 via the t-test. n.s., nonsignificant (n = 45 worms each).
(B) Pharyngeal pumps per 30 sec of N2 animals grown on EV control, ufd-1, and npl-4 RNAi followed by incubation on P. aeruginosa PA14 at 25°C for 12 hours. ***P < 0.001 and **P < 0.01 via the t-test (n = 30 worms each).

Reduced gut colonization upon ufd-1 knockdown is independent of the tir-1 immunity pathway
(A) Representative survival plots of tir-1(qd4) animals on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control and ufd-1 RNAi. The difference between the EV and ufd-1 RNAi survival plots is nonsignificant.
(B) Representative fluorescence images of tir-1(qd4) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm.
(C) Quantification of GFP levels of tir-1(qd4) animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***P < 0.001 via the t-test (n = 20 worms each).

Knockdown of ufd-1 dictates survival of different worm strains on P. aeruginosa
(A) Representative survival plots of worm strains on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control RNAi.
(B) Representative survival plots of worm strains on P. aeruginosa PA14 at 25°C after treatment with ufd-1 RNAi.
The data in (A) and (B) is pooled from the data from Figures 1-3 and Figure S2.

Gene ontology enrichment analysis for ufd-1 RNAi downregulated gene
(A)-(C) Gene ontology enrichment analysis for ufd-1 RNAi downregulated genes for biological processes (A), cellular component (B), and molecular function (C).

Individual protease or intracellular pathogen response genes are not involved in reduced colonization of ufd-1 RNAi animals
(A) Quantification of GFP levels of N2 animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on indicated RNAi bacteria. P-values in comparison to EV and EV+ufd-1 RNAi are indicated. ***P < 0.001 and **P < 0.01 via the t-test. n.s., nonsignificant (n = 18–19 worms each).
(B) Quantification of GFP levels of N2 animals incubated on P. aeruginosa-GFP for 24 hours at 25°C after growth on indicated RNAi bacteria. P-values in comparison to EV are shown. P-values for all the co-RNAi treatments in comparison to EV+ufd-1 RNAi are nonsignificant. n = 19–20 worms each.
Table S1: Upregulated and downregulated genes in ufd-1 RNAi versus empty vector (EV) control RNAi N2 animals. Genes exhibiting at least two-fold change and P-value <0.01 were considered differentially expressed.
References
- The longevity-promoting factor, TCER-1, widely represses stress resistance and innate immunityNat Commun 10:3042https://doi.org/10.1038/s41467-019-10759-zGoogle Scholar
- Ubiquitin-Mediated Response to Microsporidia and Virus Infection in C. elegansPLoS Pathog 10https://doi.org/10.1371/journal.ppat.1004200Google Scholar
- Molecular Mechanism of Substrate Processing by the Cdc48 ATPase ComplexCell 169:722–735https://doi.org/10.1016/j.cell.2017.04.020Google Scholar
- A Pseudomonas aeruginosa Toxin that Hijacks the Host Ubiquitin Proteolytic SystemPLoS Pathog 7:e1001325https://doi.org/10.1371/journal.ppat.1001325Google Scholar
- VCP/p97-Mediated Unfolding as a Principle in Protein Homeostasis and SignalingMol Cell 69:182–194https://doi.org/10.1016/j.molcel.2017.10.028Google Scholar
- A Mycobacterium tuberculosis surface protein recruits ubiquitin to trigger host xenophagyNat Commun 10:1973https://doi.org/10.1038/s41467-019-09955-8Google Scholar
- Ubiquitin: Same Molecule, Different Degradation PathwaysCell 143:682–685https://doi.org/10.1016/j.cell.2010.11.012Google Scholar
- Calcineurin inhibition enhances Caenorhabditis elegans lifespan by defecation defects-mediated calorie restriction and nuclear hormone signalingElife 12:RP89572Google Scholar
- Proteasomal and Autophagic Degradation SystemsAnnu Rev Biochem 86:193–224Google Scholar
- Quantitating transcription factor redundancy: The relative roles of the ELT-2 and ELT-7 GATA factors in the C. elegans endodermDev Biol 435:150–161https://doi.org/10.1016/j.ydbio.2017.12.023Google Scholar
- Sorting, recognition and activation of the misfolded protein degradation pathways through macroautophagy and the proteasomeAutophagy 4:141–150https://doi.org/10.4161/auto.5190Google Scholar
- Unfolding new roles for XBP1 in immunityNat Immunol 11:365–367https://doi.org/10.1038/ni0510-365Google Scholar
- Ubiquitin-related processes and innate immunity in C. elegansCell Mol Life Sci 78:4305–4333https://doi.org/10.1007/s00018-021-03787-wGoogle Scholar
- Dithiothreitol causes toxicity in C. elegans by modulating the methionine-homocysteine cycleElife 11:e76021https://doi.org/10.7554/eLife.76021Google Scholar
- Ubiquitin systems mark pathogen-containing vacuoles as targets for host defense by guanylate binding proteinsProc Natl Acad Sci U S A 112:E5628–E5637https://doi.org/10.1073/pnas.1515966112Google Scholar
- Recovery from an Acute Infection in C. elegans Requires the GATA Transcription Factor ELT-2PLoS Genet 10https://doi.org/10.1371/journal.pgen.1004609Google Scholar
- Regulation of Salmonella -host cell interactions via the ubiquitin systemInt J Med Microbiol 308:176–184https://doi.org/10.1016/j.ijmm.2017.11.003Google Scholar
- Proteostasis control by the unfolded protein responseNat Cell Biol 17:829–838https://doi.org/10.1038/ncb3184Google Scholar
- BioVenn -A web application for the comparison and visualization of biological lists using area-proportional Venn diagramsBMC Genomics 9:488https://doi.org/10.1186/1471-2164-9-488Google Scholar
- Ubiquitin-Binding Proteins: Decoders of Ubiquitin-Mediated Cellular FunctionsAnnu Rev Biochem 81:291–322https://doi.org/10.1146/annurev-biochem-051810-094654Google Scholar
- A Conserved p38 MAP Kinase Pathway in Caenorhabditis elegans Innate ImmunityScience 297:623–626https://doi.org/10.1126/science.1073759Google Scholar
- Burkholderia pseudomallei suppresses Caenorhabditis elegans immunity by specific degradation of a GATA transcription factorProc Natl Acad Sci 110:15067–15072https://doi.org/10.1073/pnas.1311725110Google Scholar
- The ubiquitin system: a critical regulator of innate immunity and pathogen–host interactionsCell Mol Immunol 13:560–576https://doi.org/10.1038/cmi.2016.40Google Scholar
- Requirement for a conserved Toll/interleukin-1 resistance domain protein in the Caenorhabditis elegans immune responseProc Natl Acad Sci 101:6593–6598https://doi.org/10.1073/pnas.0308625101Google Scholar
- Inducible Antibacterial Defense System in C. elegansCurr Biol 12:1209–1214Google Scholar
- Deactivation of the GATA Transcription Factor ELT-2 Is a Major Driver of Normal Aging in C. elegansPLoS Genet 12:e1005956https://doi.org/10.1371/journal.pgen.1005956Google Scholar
- Global profiling of distinct cysteine redox forms reveals wide-ranging redox regulation in C. elegansNat Commun 12:1415https://doi.org/10.1038/s41467-021-21686-3Google Scholar
- Emerging functions of the VCP / p97 AAA-ATPase in the ubiquitin systemNat Cell Biol 14:117–123https://doi.org/10.1038/ncb2407Google Scholar
- A complex of mammalian Ufd1 and Npl4 links the AAA-ATPase, p97, to ubiquitin and nuclear transport pathwaysEMBO J 19:2181–2192https://doi.org/10.1093/emboj/19.10.2181Google Scholar
- Cell cycle progression requires the CDC-48UFD-1/NPL-4 complex for efficient DNA replicationProc Natl Acad Sci U S A 105:12879–12884https://doi.org/10.1073/pnas.0805944105Google Scholar
- A conserved role of Caenorhabditis elegans CDC-48 in ER-associated protein degradationJ Struct Biol 156:41–49https://doi.org/10.1016/j.jsb.2006.02.015Google Scholar
- Proteasome-Independent Functions of Ubiquitin in Endocytosis and SignalingScience (80-) 315:201–205Google Scholar
- Non-proteolytic activity of 19S proteasome subunit RPT-6 regulates GATA transcription during response to infectionPLoS Genet 14:e1007693Google Scholar
- Immunity-longevity tradeoff neurally controlled by GABAergic transcription factor PITX1/UNC-30Cell Rep 35:109187https://doi.org/10.1016/j.celrep.2021.109187Google Scholar
- Ubiquitylation of lipopolysaccharide by RNF213 during bacterial infectionNature 594:111–116https://doi.org/10.1038/s41586-021-03566-4Google Scholar
- Pathogen infection and cholesterol deficiency activate the C. elegans p38 immune pathway through a TIR-1/SARM1 phase transitionElife 11:e74206Google Scholar
- Thiol reductive stress activates the hypoxia response pathwayEMBO J 42:e114093https://doi.org/10.15252/embj.2023114093Google Scholar
- Antagonistic paralogs control a switch between growth and pathogen resistance in C. elegansPLoS Pathog 15:e1007528https://doi.org/10.1371/journal.ppat.1007528Google Scholar
- Caenorhabditis elegans microRNAs of the let-7 family act in innate immune response circuits and confer robust developmental timing against pathogen stressProc Natl Acad Sci U S A 112:E2366–E2375https://doi.org/10.1073/pnas.1422858112Google Scholar
- Ubiquitin, SUMO, and NEDD8: Key Targets of Bacterial PathogensTrends Cell Biol 28:926–940https://doi.org/10.1016/j.tcb.2018.07.005Google Scholar
- An essential role for XBP-1 in host protection against immune activation in C. elegansNature 463:1092–1095https://doi.org/10.1038/nature08762Google Scholar
- Competition between virus-derived and endogenous small RNAs regulates gene expression in Caenorhabditis elegansGenome Res 23:1258–1270https://doi.org/10.1101/gr.153296.112Google Scholar
- ER E3 ubiquitin ligase HRD-1 and its specific partner chaperone BiP play important roles in ERAD and developmental growth in Caenorhabditis elegansGenes to Cells 12:1063–1073https://doi.org/10.1111/j.1365-2443.2007.01108.xGoogle Scholar
- A conserved role for a GATA transcription factor in regulating epithelial innate immune responsesProc Natl Acad Sci U S A 103:14086–91https://doi.org/10.1073/pnas.0603424103Google Scholar
- ERASing endoplasmic reticulum stress: the faster, the betterTrends Cell Biol 33:179–181https://doi.org/10.1016/j.tcb.2022.12.003Google Scholar
- Neural control of behavioral and molecular defenses in C. elegansCurr Opin Neurobiol 62:34–40https://doi.org/10.1016/j.conb.2019.10.012Google Scholar
- Intestinal infection regulates behavior and learning via neuroendocrine signalingElife 8:e50033https://doi.org/10.7554/eLife.50033Google Scholar
- Microbial colonization activates an immune fight-and-flight response via neuroendocrine signalingDev Cell 49:89–99https://doi.org/10.1016/j.devcel.2019.02.001Google Scholar
- Endoplasmic reticulum stress caused by lipoprotein accumulation suppresses immunity against bacterial pathogens and contributes to immunosenescenceMBio 8:e00778–17https://doi.org/10.1128/mBio.00778-17Google Scholar
- Organismal regulation of XBP-1-mediated unfolded protein response during development and immune activationEMBO Rep 13:855–860https://doi.org/10.1038/embor.2012.100Google Scholar
- Killing of Caenorhabditis elegans by Pseudomonas aeruginosa used to model mammalian bacterial pathogenesisProc Natl Acad Sci U S A 96:715–20https://doi.org/10.1073/pnas.96.2.715Google Scholar
- The ubiquitin ligation machinery in the defense against bacterial pathogensEMBO Rep 22:e52864https://doi.org/10.15252/embr.202152864Google Scholar
- One step at a time: endoplasmic reticulum-associated degradationNat Rev Mol Cell Biol 9:944–957https://doi.org/10.1038/nrm2546Google Scholar
- The role of protein clearance mechanisms in organismal ageing and age-related diseasesNat Commun 5:5659https://doi.org/10.1038/ncomms6659Google Scholar
- Innate host defense requires TFEB-mediated transcription of cytoprotective and antimicrobial genesImmunity 40:896–909https://doi.org/10.1016/j.immuni.2014.05.002Google Scholar
- The Cdc48 machine in endoplasmic reticulum associated protein degradation IZBiochim Biophys Acta 1823:117–124https://doi.org/10.1016/j.bbamcr.2011.09.002Google Scholar
- Mechanistic insights into ER-associated protein degradationCurr Opin Cell Biol 53:22–28https://doi.org/10.1016/j.ceb.2018.04.004Google Scholar
- GATA transcription factor as a likely key regulator of the Caenorhabditis elegans innate immune response against gut pathogensZoology 119:244–253https://doi.org/10.1016/j.zool.2016.05.013Google Scholar
- WormExp: A web-based application for a Caenorhabditis elegans-specific gene expression enrichment analysisBioinformatics 32:943–945https://doi.org/10.1093/bioinformatics/btv667Google Scholar
- The AAA ATPase Cdc48/p97 and its partners transport proteins from the ER into the cytosolNature 414:652–656Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.94310. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, Rao et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,706
- downloads
- 78
- citations
- 11
Views, downloads and citations are aggregated across all versions of this paper published by eLife.