MicroRNA-26b protects against MASH development and can be efficiently targeted with lipid nanoparticles

Reviewer #1 (Public Review):

Based on previous publications suggesting a potential role for miR-26b in the pathogenesis of metabolic dysfunction-associated steatohepatitis (MASH), the researchers aim to clarify its function in hepatic health and explore the therapeutical potential of lipid nanoparticles (LNPs) to treat this condition. First, they employed both whole-body and myeloid cell-specific miR-26b KO mice and observed elevated hepatic steatosis features in these mice compared to WT controls when subjected to WTD. Moreover, livers from whole-body miR-26b KO mice also displayed increased levels of inflammation and fibrosis markers. Kinase activity profiling analyses revealed distinct alterations, particularly in kinases associated with inflammatory pathways, in these samples. Treatment with LNPs containing miR-26b mimics restored lipid metabolism and kinase activity in these animals. Finally, similar anti-inflammatory effects were observed in the livers of individuals with cirrhosis, whereas elevated miR-26b levels were found in the plasma of these patients in comparison with healthy control. Overall, the authors conclude that miR-26b plays a protective role in MASH and that its delivery via LNPs efficiently mitigates MASH development.

The study has some strengths, most notably, its employ of a combination of animal models, analyses of potential underlying mechanisms, as well as innovative treatment delivery methods with significant promise. However, it also presents numerous weaknesses that leave the research work somewhat incomplete. The precise role of miR-26b in a human context remains elusive, hindering direct translation to clinical practice. Additionally, the evaluation of the kinase activity, although innovative, does not provide a clear molecular mechanisms-based explanation behind the protective role of this miRNA.

Therefore, to fortify the solidity of their conclusions, these concerns require careful attention and resolution. Once these issues are comprehensively addressed, the study stands to make a significant impact on the field.

Reviewer #2 (Public Review):

Summary:

This manuscript by Peters, Rakateli, et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights into the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

Strengths:

The authors provide a well-designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

Weaknesses:

Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the author's conclusions.

(1) Analysis of the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar in both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

(2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in the liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA
UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

(3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in the liver and blood. This difference in abundance of the two strands is usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands in equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological overabundance of miR-26b-3p would constitute a source of undesired off-targets.

(4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

(5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication by van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

(6) The authors have focused part of their analysis on a few gene makers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes in mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

(7) In Figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively large number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases, there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

Author response:

Provisional author response to Reviewer #1
We would like the reviewer for his/her careful evaluation of our manuscript and appreciate his/her appraisal for the strengths of our study. Regarding the weaknesses, we plan to address these as good as possible during the revision of our manuscript.
We can already state that miR-26b has clear anti-inflammatory effects on human liver slices, which is in line with our results demonstrating that miR-26b plays a protective role in MASH development in mice. The notion that patients with liver cirrhosis have increasing plasma levels of miR-26b, seems contradictory at first glance. However, we believe that this increased miR-26b expression is a compensatory mechanism to counteract the MASH/cirrhotic effects. However, the exact source of this miR-26b remains to be elucidated in future studies.
The performed kinase activity analysis revealed that miR-26b affects kinases that particularly play an important role in inflammation and angiogenesis. Strikingly and supporting these data, these effects could be inverted again by LNP treatment. Combined, these results already provide strong mechanistic insights on molecular and intracellular signalling level. Although the exact target of miR-26b remains elusive and its identification is probably beyond the scope of the current manuscript due to its complexity, we believe that the kinase activity results already provide a solid mechanistic basis.

Provisional author response to Reviewer #2
We would like the reviewer for his/her careful evaluation of our manuscript and appreciate his/her appraisal for the strengths of our study. Regarding the weaknesses, we plan to address these as good as possible during the revision of our manuscript. Particularly the validation suggestions are very valuable and we plan to address these in the revision by performing additional experiments.