Abstract
Autophagy-related gene 6 (ATG6) plays a crucial role in plant immunity. Nonexpressor of pathogenesis-related genes1 (NPR1) acts as a signaling hub of plant immunity. However, the relationship between ATG6 and NPR1 is unclear. Here, we find that ATG6 directly interacts with NPR1. ATG6 overexpression significantly increased nuclear accumulation of NPR1. Furthermore, we demonstrate that ATG6 increases NPR1 protein levels and improves its stability. Interestingly, ATG6 promotes the formation of SINCs (SA-induced NPR1 condensates)-like condensates. Additionally, ATG6 and NPR1 synergistically promote the expression of pathogenesis-related genes. Further results showed that silencing ATG6 in NPR1-GFP exacerbates Pst DC3000/avrRps4 invasion, while double overexpression of ATG6 and NPR1 synergistically inhibits Pst DC3000/avrRps4 invasion. In summary, our findings unveil an interplay of NPR1 with ATG6 and elucidate important molecular mechanisms for enhancing plant immunity.
Highlight
We unveil a novel relationship in which ATG6 positively regulates NPR1 in plant immunity.
Introduction
Plants are constantly challenged by pathogens in nature. In order to survive and reproduce, plants have evolved complex mechanisms to cope with attack by pathogens (Jones and Dangl, 2006). Nonexpressor of pathogenesis-related genes 1 (NPR1) is a key regulator of plant immunity (Chen et al., 2021b). It contains the BTB/POZ (Broad Compex, Tramtrack, and BricaBrac/Pox virus and Zinc finger) domain in the N-terminal region, the ANK (Ankyrin repeats) domain in the middle region, and the nuclear localization sequence (NLS) in the C-terminal region (Cao et al., 1997; Rochon et al., 2006). NPR1 is a receptor of SA (salicylic acid) mainly localized as an oligomer in the cytoplasm and sensitive to the surrounding redox state (Tada et al., 2008; Wu et al., 2012). SA mediates the dynamic oligomer to monomer response of NPR1 (Tada et al., 2008) and promotes translocation of NPR1 into the nucleus, which increases plant resistance to pathogens by activating the expression of immune-related genes (Kinkema et al., 2000; Chen et al., 2021b).
NPR1 is mainly degraded by the ubiquitin proteasome system (UPS) (Spoel et al., 2009; Saleh et al., 2015; Skelly et al., 2019). An increasing researches have shown that autophagy and the UPS pathway play overlapping roles in regulating intracellular protein homeostasis (Zhou et al., 2014; Marshall et al., 2015; Kikuchi et al., 2020). Our previous study showed that ATGs (autophagy-related genes) are involved in NPR1 turnover (Gong et al., 2020). Autophagy negatively regulates Pst DC3000/avrRpm1-induced programmed cell death (PCD) via the SA receptor NPR1 (Yoshimoto et al., 2009). These results imply that ATGs might be involved in plant immunity through the regulation of NPR1 homeostasis. However, the detailed mechanism has not yet been elucidated.
ATG6 is the homologues of yeast Vps30/Atg6 and mammalian BECN1/Beclin1 (Xu et al., 2017). It is a common and required subunit of the class III phosphatidylinositol 3-kinase (PtdIns3K) lipid kinase complexes, which regulates autophagosome nucleation in Arabidopsis thaliana (Arabidopsis) (Qi et al., 2017; Wang et al., 2020). The homozygous atg6 mutant is lethal, suggesting that ATG6 is essential for plant growth and development (Fujiki et al., 2007; Qin et al., 2007; Harrison-Lowe and Olsen, 2008; Patel and Dinesh-Kumar, 2008). In Arabidopsis, N. benthamiana and wheat, ATG6 or its homologues was reported to act as a positive regulator to prevent the invasion of P. syringae pv. tomato (Pst) DC3000 and Pst DC3000/avrRpm1 bacteria (Patel and Dinesh-Kumar, 2008), N. benthamiana mosaic virus (TMV) (Liu et al., 2005), turnip mosaic virus (TuMV) (Li et al., 2018), pepper mild mottle virus (PMMoV) (Jiao et al., 2020), and Blumeria graminis f. sp. tritici (Bgt) fungus (Yue et al., 2015). Several research teams have also elucidated that ATG6 interacted with Bax Inhibitor-1 (NbBI-1) (Xu et al., 2017) and RNA-dependent RNA polymerase (RdRp) (Li et al., 2018) to suppress pathogen invasion. However, the mechanism by which ATG6 suppresses pathogen invasion by regulating NPR1 has not yet been reported.
Here, we show that ATG6 and NPR1 synergistically enhance Arabidopsis resistance to Pst DC3000/avrRps4 infiltration. We discover that ATG6 increases NPR1 protein levels and nuclear accumulation of NPR1. Moreover, ATG6 can stabilize NPR1 and promote the formation of SINCs (SA-induced NPR1 condensates)-like condensates. Our study revealed a unique mechanism in which NPR1 cooperatively increases plant immunity with ATG6.
Results
NPR1 physically interacts with ATG6 in vitro and in vivo
To examine the relationship between ATGs and NPRs, we predicted that some ATGs might interact with NPRs. In a yeast two-hybrid (Y2H) screen, we identified that NPR1, NPR3 and NPR4 could interact with ATG6 and several ATG8 isoforms (Fig. S1 and Results S1 in the Supplemental Data 1). In this study, we mainly investigated the relationship between ATG6 and NPR1 during the process of plant immune response. Firstly, the NPR1 truncations NPR1-N (1-328AA, containing the BTB/POZ domain) and NPR1-C (328-594AA, containing the ANK domain and NLS) were used to identify the interaction domains between NPR1 and ATG6. The results showed that NPR1-C interacted with full-length ATG6 in yeast (Fig. 1a, line 3), indicating that the C terminus of NPR1 was necessary for the interaction between NPR1 and ATG6. The interaction between NPR1 and SnRK2.8 was used as a positive control (Lee et al., 2015). Secondly, pull-down assays were performed in vitro. NPR1-His bound GST-ATG6, but not GST (Fig. 1b). Furthermore, co-immunoprecipitation (Co-IP) assays were performed in N. benthamiana, as shown in Fig. 1c, ATG6-mCherry was co-immunoprecipitated with NPR1-GFP. In Fig. 1d, fluorescence signals of NPR1-GFP and ATG6-mCherry were co-localized in the nucleus under normal and 1 mM SA treatment conditions. The interaction between ATG6 and NPR1 was also verified by a bimolecular fluorescence complementation (BiFC) assay (Fig. S2). These results demonstrate that ATG6 interacts with NPR1 both in vitro and in vivo.

Physical interaction between NPR1 and ATG6.
(a). Interaction of NPR1 with ATG6 in yeast. The CDS of ATG6, NPR1, NPR1-N (1∼984 bp), NPR1-C (984∼1782 bp) and SnRK2.8 were fused to pGADT7 (AD) and pGBKT7 (BD), respectively. Co-transformation of NPR1-BD + AD, BD + ATG6-AD, BD + SnRK2.8-AD, NPR1-N-BD + AD, NPR1-C-BD + AD were used as negative controls. The interaction of NPR1-BD and SnRK2.8-AD was used as a positive control. Yeast growth on SD/-Trp-Leu-His-Ade media represents interaction. Numbers represent the dilution fold of yeast. 0, -1 (10 fold dilution), -2 (100 fold dilution), -3 (1000 fold dilution). (b). In vitro pull-down assays of NPR1-His with GST-ATG6 fusion protein. NPR1-His prokaryotic proteins were incubated with GST-tag Purification Resin conjugated with GST-ATG6, GST and SnRK2.8-GST. Western blotting analysis with anti-GST and anti-His. Black asterisk indicate SnRK2.8-GST bands. Red asterisk indicate GST-ATG6 bands. (c). Co-immunoprecipitation of NPR1 with ATG6 in vivo. Total protein was extracted from N. benthamiana transiently transformed with ATG6-mCherry + GFP and ATG6-mCherry + NPR1-GFP, followed by IP with GFP-Trap. Western blots analysis with ATG6 and GFP antibodies. (d). Co-localization of NPR1-GFP and ATG6-mCherry in N. benthamiana under normal and SA treatment conditions. NPR1-GFP were co-expressed with ATG6-mCherry in N. benthamiana for 2 d followed by confocal observation. Scale bar, 100 μm. All experiments were performed with three biological replicates.
ATG6 co-localized with NPR1 in the nucleus
Remarkably, under normal and SA treatment conditions, we found that ATG6 is localized in the cytoplasm and nucleus, and it co-localized with NPR1 in the nucleus (Fig. 1d). Nuclear localization of ATG6 was also observed in N. benthamiana transiently transformed with ATG6-mCherry and ATG6-GFP under normal and SA treatment conditions (Fig. 2a and b). ATG6-GFP co-localizes with the nuclear localization marker nls-mCherry (Fig. 2b). The nuclear localization signal of ATG6 was also observed in UBQ10::ATG6-GFP overexpressing Arabidopsis (Fig. S3a). To exclude the possibility that the observed localization of ATG6-GFP is due to free GFP. ATG6-GFP and free GFP levels in UBQ10::ATG6-GFP Arabidopsis and N.benthamiana were detected before and after SA treatment. Notably, no free GFP was detected and this means that the fluorescence signal observed by confocal microscopy is ATG6-GFP, not free GFP (Fig. S3d and e).

ATG6 is localized in the cytoplasm and nucleus.
(a). The nuclear localization of ATG6-mCherry in N. benthamiana. Scale bar, 100 μm. (b). Co-localization of ATG6-GFP and nls-mCherry in N. benthamiana. Scale bar, 100 μm. (c). Subcellular fractionation of ATG6-mCherry in N. benthamiana after 1 mM SA treatment. Black asterisk (*) indicate ATG6-mCherry bands. (d). Subcellular fractionation of ATG6-GFP in N. benthamiana after 1 mM SA treatment. Black asterisk (*) indicate ATG6-GFP bands. (e). Subcellular fractionation of ATG6-GFP in ATG6-GFP Arabidopsis after 0.5 mM SA treatment. (f). Subcellular fractionation of ATG6-mCherry in ATG6-mCherry Arabidopsis after 0.5 mM SA treatment. In (c-f), ATG6-mCherry (c and f) and ATG6-GFP (d and e) were detected using ATG6 or GFP antibody. Actin and H3 were used as cytoplasmic and nucleus internal reference, respectively. Numerical values indicate quantitative analysis of ATG6-mCherry and ATG6-GFP using image J. All experiments were performed with three biological replicates.
Moreover, the nuclear and cytoplasmic fractions were separated. Under SA treatment, ATG6-mCherry and ATG6-GFP were detected in the cytoplasmic and nuclear fractions in N. benthamiana (Fig. 2c and d). Similarly, ATG6 was also detected in the nuclear fraction of UBQ10::ATG6-GFP and UBQ10::ATG6-mCherry overexpressing plants, and SA promoted both cytoplasm and nuclear accumulation of ATG6 (Fig. 2e and f). Additionally, we obtained ATG6 and NPR1 double overexpression of Arabidopsis UBQ10::ATG6-mCherry × 35S::NPR1-GFP (ATG6-mCherry ×NPR1-GFP) by crossing and screening (Fig. S4a). In ATG6-mCherry × NPR1-GFP, we observed co-localization of ATG6-mCherry with NPR1-GFP in the nucleus (Fig. S3b). These results are consistent with the prediction of the subcellular location of ATG6 in the Arabidopsis subcellular database (https://suba.live/) (Fig. S3c). Additionally, we have conducted an investigation into the localization of endogenous ATG6 in Col. Our results demonstrate that endogenous ATG6 is present in both the nucleus and cytoplasm, and we have observed that SA treatment promotes the accumulation of ATG6 in the nucleus (Fig. S5). Together, these findings suggest that ATG6 is localized to both cytoplasm and nucleus, and co-localized with NPR1 in the nucleus.
ATG6 overexpression increased nuclear accumulation of NPR1
Previous studies have shown that the nuclear localization of NPR1 is essential for improving plant immunity (Kinkema et al., 2000; Chen et al., 2021b). We observed that a stronger nuclear localization signal of NPR1-GFP in ATG6-mCherry × NPR1-GFP leaves than that in NPR1-GFP under normal condition and 0.5 mM SA treatment for 3 h (Fig. 3a and b). These findings indicate that ATG6 might increase nuclear accumulation of NPR1. To exclude the possibility that the observed localization of NPR1-GFP is due to free GFP, we detected the levels of NPR1-GFP and free GFP in ATG6-mCherry x NPR1-GFP plants before and after SA treatment. Only ∼ 10 % of free GFP was detected in ATG6-mCherry x NPR1-GFP plants before and after SA treatment, confirming that the observed localization of NPR1-GFP is not due to free GFP (Fig. S4b). Furthermore, the nuclear and cytoplasmic fractions of ATG6-mCherry × NPR1-GFP and NPR1-GFP were separated. Under normal conditions, the nuclear fractions NPR1-GFP in ATG6-mCherry × NPR1-GFP and NPR1-GFP were relatively weaker (Fig. 3c), which differs from the above observation (Fig. 3a). We speculate that this phenomenon might be attributed to the rapid turnover of NPR1 in the nucleus (Spoel et al., 2009; Saleh et al., 2015). Consistent with the fluorescence distribution results, the nuclear fractions of NPR1-GFP in ATG6-mCherry × NPR1-GFP were significantly higher than those in NPR1-GFP under 0.5 mM SA treatment for 3 and 6 h (Fig. 3c). Furthermore, Agrobacterium harboring ATG6-mCherry and NPR1-GFP were transiently transformed to N. benthamiana leaves. After 1 d, the leaves were treated with 1 mM SA for 8 and 20 h. Subsequently nucleoplasmic separation experiments were performed. Similar to Arabidopsis, increased nuclear accumulation of NPR1 was found when ATG6 was overexpressed (Fig. 3e). Notably, we found that the ratio (nucleus NPR1/total NPR1) in ATG6-mCherry × NPR1-GFP was not significantly different from that in NPR1-GFP after SA treatment, and a similar phenomenon was observed in N. benthamiana (Fig. 3d and f). These results suggested that the increased nuclear accumulation of NPR1 in ATG6-mCherry x NPR1-GFP plants might attributed to higher levels and more stable NPR1 rather than the enhanced nuclear translocation of NPR1 facilitated by ATG6. Furthermore, we validated the functionality of the ATG6-GFP and ATG6-mCherry fusion proteins utilized in this study by examining the phenotypes of ATG6-GFP and ATG6-mCherry Arabidopsis plants under carbon starvation conditions (Fig. S6 and Results S2 in the Supplemental Data 1).

ATG6 increases the nuclear accumulation of NPR1 under SA treatment.
(a). Confocal images of NPR1-GFP nuclear localization in 7-day-old seedlings of NPR1-GFP and ATG6-mCherry × NPR1-GFP under normal and 0.5 mM SA spray for 3 h. Scale bar, 50 μm. (b). Nuclear localization numbers of NPR1-GFP (per section) in (a), n > 10. (c). Subcellular fractionation of NPR1-GFP in 7-day-old seedlings of NPR1-GFP and ATG6-mCherry × NPR1-GFP after 0.5 mM SA treatment for 0, 3 and 6 h. (d). The ration of NPR1 in the nucleus/total NPR1 in (c). (e). Subcellular fractionation of NPR1-GFP in N. benthamiana after 1 mM SA treatment for 0, 8 and 20 h. (f). The ration of NPR1 in the nucleus/total NPR1 in (e). In (c and e), cytoplasmic and nuclear proteins were extracted from Arabidopsis or N. benthamiana. NPR1-GFP were detected using GFP antibody. Actin and H3 were used as cytoplasmic and nucleus internal reference, respectively. Numerical values indicate quantitative analysis of NPR1-GFP using image J. All experiments were performed with three biological replicates.
ATG6 increases endogenous SA levels and promotes the expression of NPR1 downstream target genes
NPR1 localized in the nucleus is essential for activation of immune gene expression (Kinkema et al., 2000; Chen et al., 2021b). In our study, we observed that ATG6 overexpression increased nuclear accumulation of NPR1 (Fig. 3) and demonstrated an interaction between ATG6 and NPR1 in the nucleus (Fig. 1d). Therefore, we speculate that ATG6 might regulate NPR1 transcriptional activity. Notably, the expression level of ICS1 in ATG6-mCherry × NPR1-GFP seedlings was significantly higher than that in NPR1-GFP under normal and SA treatment conditions (Fig. S7). Free SA levels in ATG6-mCherry × NPR1-GFP were also significantly higher compared to NPR1-GFP under Pst DC3000/avrRps4 treatment. While there was no significant difference was observed under normal condition (Fig. 4a), this may be related to free SA consumption, as it can be converted to bound SA (Ding and Ding, 2020). In addition, the expression of PR1 (pathogenesis-related gene) and PR5 in ATG6-mCherry × NPR1-GFP was significantly higher than that of NPR1-GFP under normal and SA treatment conditions (Fig. 4b and c). The expression of PR1 and PR5 in ATG6-mCherry was significantly higher than that of Col under Pst DC3000/avrRps4 treatment (Fig. S8). These results support the role of ATG6 in facilitating the expression of NPR1 downstream PR1 and PR5 genes.

ATG6 increases endogenous SA levels and promotes the expression of NPR1 downstream target genes
(a). Level of free SA in 3-week-old NPR1-GFP and ATG6-mCherry × NPR1-GFP after Pst DC3000/avrRps4 for 12 h. (b-c). Expression of PR1 (b), PR5 (c) under normal and SA treatment conditions. * or ** indicates that the significant difference compared to the control is at the level of 0.05 or 0.01 (Student t test p value, * p< 0.05 or ** p< 0.01). All experiments were performed with three biological replicates.
ATG6 increases NPR1 protein levels and the formation of SINCs-like condensates
Interestingly, similar to previous reports (Zavaliev et al., 2020), SA promoted the translocation of NPR1 into the nucleus, but still a significant amount of NPR1 was present in the cytoplasm (Fig. 3c and e). Previous studies have shown that SA increased NPR1 protein levels and facilitated the formation of SINCs in the cytoplasm, which are known to promote cell survival (Zavaliev et al., 2020). In our experiments, we observed that under SA treatment, the protein levels of NPR1 in ATG6-mCherry × NPR1-GFP was significantly higher than that in NPR1-GFP (Fig. 5a). To further support our conclusions, we proceeded to silence ATG6 in NPR1-GFP (NPR1-GFP/silencing ATG6) and subsequently assessed the protein level of NPR1-GFP before and after SA treatment. Our findings revealed that the protein level of NPR1-GFP in NPR1-GFP/silencing ATG6 under SA treatment was notably lower than that in the NPR1-GFP/Negative control (Fig. S9). Under SA treatment, the protein levels of NPR1-GFP in N. benthamiana co-transformed with ATG6-mCherry + NPR1-GFP was also significantly higher than that of mCherry + NPR1-GFP (Fig. 5b). We also detected the expression of NPR1 was detected. It is worth noting that NPR1 up-regulation was more obvious in Col after 3 h treatment with Pst DC3000/avrRps4. After 6 h treatment with Pst DC3000/avrRps4, there was no significant difference in the expression of NPR1 between Col and ATG6-mCherry (Fig. S10). These results suggest that ATG6 increases NPR1 protein levels. After SA treatment, more SINCs-like condensates fluorescence were observed in N. benthamiana co-transformed with ATG6-mCherry + NPR1-GFP compared to mCherry + NPR1-GFP (Fig. 5c-d and Supplemental movie 1-2). Taken together, these results suggest that ATG6 increases the protein levels of NPR1 and promotes the formation of SINCs-like condensates, possibly caused by ATG6 increasing SA levels in vivo.

ATG6 increases the NPR1 protein levels and the formation of SINCs-like condensates.
(a). NPR1-GFP protein levels in 7-day-old seedlings of NPR1-GFP and ATG6-mCherry × NPR1-GFP after 0.5 mM SA treatment for 0, 3, 6 and 9 h. Numerical values indicate quantitative analysis of NPR1-GFP protein using image J. (b). NPR1-GFP protein levels in N. benthamiana. ATG6-mCherry + NPR1-GFP, NPR1-GFP + mCherry were co-expressed in N. benthamiana. After 2 days, leaves were treated with 1 mM SA for 8, 20, 24 h. Total proteins were extracted and analyzed. Numerical values indicate quantitative analysis of NPR1-GFP protein using image J. (c). ATG6 promotes the formation of SINCs-like condensates. ATG6-mCherry + NPR1-GFP, NPR1-GFP + mCherry were co-expressed in N. benthamiana. After 2 days, leaves were treated with 1 mM SA for 24 h. Confocal images obtained at excitation with wavelengths of 488 nm, scale bar = 50 μm. (d). SINCs-like condensates numbers of per section in (c), n > 10 sections. ** indicates that the significant difference compared to the control is at the level of 0.01 (Student t test p value, ** p< 0.01). All experiments were performed with three biological replicates.
ATG6 maintains the protein stability of NPR1
Maintaining the stability of NPR1 is critical for enhancing plant immunity (Skelly et al., 2019). To further verify whether ATG6 regulates NPR1 stability, we co-transfected NPR1-GFP with ATG6-mCherry or mCherry in N. benthamiana and performed cell-free degradation assays. Our results showed that NPR1-GFP degradation was significantly delayed when ATG6 was overexpressed (Fig. S11). A similar trend was observed in Arabidopsis, where the NPR1-GFP protein in ATG6-mCherry × NPR1-GFP showed a slower degradation rate compared to NPR1-GFP during 0∼180 min time period in a cell-free degradation assay (Fig. 6a and b). Moreover, when Arabidopsis seedlings were treated with cycloheximide (CHX) to block protein synthesis, we found that NPR1-GFP in NPR1-GFP was degraded after CHX treatment for 3∼9 h and the half-life of NPR1-GFP is ∼3 h, while the half-life of NPR1-GFP in ATG6-mCherry × NPR1-GFP is ∼9 h (Fig. 6c and d). In addition, we also analyzed the degradation of NPR1-GFP in NPR1-GFP and NPR1-GFP/atg5 following 100 μM cycloheximide (CHX) treatment. The results show that the degradation rate of NPR1-GFP in NPR1-GFP/atg5 plants was similarly to that in NPR1-GFP plants (Fig. 6e and f). These results indicate that ATG6 plays a role in maintaining the stability of NPR1, which may also be related to the fact that ATG6 promotes an increase in free SA in vivo, since SA has the function of increasing NPR1 stability (Ding et al., 2016; Skelly et al., 2019).

ATG6 improves the protein stability of NPR1.
(a). NPR1-GFP degradation assay in Arabidopsis. Total proteins from 7-day-old seedlings of NPR1-GFP and ATG6-mCherry × NPR1-GFP were extracted, using Actin as an internal reference. “M” indicates MG115 treatment. (b). Quantification of NPR1-GFP degradation rates in (a) using Image J. In (a and b), the extracts were incubated for 0∼180 min at room temperature (25℃), the degradation rate of NPR1-GFP was analyzed. (c). NPR1-GFP protein turnover. 7-day-old NPR1-GFP and ATG6-mCherry × NPR1-GFP seedlings were treated with 100 μM cycloheximide (CHX) for different times. Total proteins were analyzed, Actin was used as an internal reference. (d). Quantification of NPR1-GFP protein turnover rates in (c) using Image J. (e). NPR1-GFP protein turnover. 7-day-old NPR1-GFP and NPR1-GFP/atg5 seedlings were treated with 100 μM cycloheximide (CHX) for different times. Total proteins were analyzed, Actin was used as an internal reference. (f). Quantification of protein levels of NPR1-GFP in (e) using Image J. All experiments were performed with three biological replicates.
ATG6 and NPR1 jointly inhibit invasion of Pst DC3000/avrRps4
The mRNA expression levels of ATG6 in Col were significantly increased after 6 h, 12 h and 24 h under Pst DC3000/avrRps4 treatment (Fig. 7a). Similarly, both the ATG6 gene and protein were significantly up-regulated under 0.5 mM SA treatment (Fig. 7b and c). These results suggest that the expression of ATG6 could be induced by Pst DC3000/avrRps4 and 0.5 mM SA treatment.

ATG6 and NPR1 jointly inhibit the growth of Pst DC3000/avrRps4.
(a). Expression of ATG6 under Pst DC3000/avrRps4 infiltration in 3-week-old Col leaves. (b). Expression of ATG6 in the presence of 0.5 mM SA in 3-week-old Col leaves. (c). The protein levels of ATG6 after 0.5 mM SA in 3-week-old Col leaves. Total leaf proteins from Arabidopsis were analyzed, Actin was used as an internal reference. Numerical values indicate quantitative analysis of ATG6 protein using image J. (d). Growth of Pst DC3000/avrRps4 in Col/silencing ATG6 and Col/negative control (NC). (e). Phenotypes of 16-day-old amiRNAATG6 # 1 and amiRNAATG6 # 2. Bar, 1 cm. (f). Phenotypes of 23-day-old amiRNAATG6 # 1 and amiRNAATG6 # 2. Bar, 3 cm. (g). Expression of ATG6 in Col, amiRNAATG6 # 1 and amiRNAATG6 # 2 under infiltration treatment of 100 μM β-estradiol. (h). Growth of Pst DC3000/avrRps4 in Arabidopsis leaves of amiRNAATG6# 1, amiRNAATG6 # 2 and Col. (i). Growth of Pst DC3000/avrRps4 in NPR1-GFP/silencing ATG6 and NPR1-GFP/NC. (j). Growth of Pst DC3000/avrRps4 in Arabidopsis leaves of Col, amiRNAATG6 # 1, amiRNAATG6 # 2, npr1, NPR1-GFP, ATG6-mCherry and ATG6-mCherry × NPR1-GFP. In (d, h-j), a low dose of Pst DC3000/avrRps4 (OD600 = 0.001) was infiltrated. After 3 days, the growth of Pst DC3000/avrRps4 was counted. * or ** indicates that the significant difference compared to the control is at the level of 0.05 or 0.01 (Student t test p value, * p< 0.05 or ** p< 0.01). All experiments were performed with three biological replicates.
Considering that ATG6 increases NPR1 protein levels (Fig. 5a-b) and promotes its nuclear accumulation (Fig. 3), as well as maintains NPR1 stability (Fig. 6), then we studied the role of ATG6-NPR1 interactions in plant immunity. However, studying the function of ATG6 is challenging due to the lethality of homozygous atg6 mutant (Qin et al., 2007; Harrison-Lowe and Olsen, 2008; Patel and Dinesh-Kumar, 2008). According to our previous report (Lei et al., 2020; Zhang et al., 2023), ATG6 was silenced using artificial miRNAATG6 (amiRNAATG6) delivered by the gold nanoparticles (AuNPs). First, the effect of ATG6 silencing in Col on the plant immune response was investigated. Similar to atg5, Col/silencing ATG6 exhibited more active growth of Pst DC3000/avrRps4 than Col/negative control (NC) after Pst DC3000/avrRps4 infiltration for 3 days (Fig. 7d). Furthermore, according to the previously reported methods (Ohira et al., 2017; Gomez et al., 2022), we generated two amiRNAATG6 lines (amiRNAATG6 # 1 and amiRNAATG6 # 2) designed against ATG6 and placed under the control of a β-estradiol inducible promoter. There were no significant phenotypic differences in amiRNAATG6 # 1 compared to the Col, while amiRNAATG6 # 2 exhibited a slight leaf developmental defect (Fig. 7e and f). Subsequently, we investigated the expression of ATG6 following treatment with 100 μM β-estradiol. Our results showed that, after 100 μM β-estradiol treatment for 1∼3 d, the expression of ATG6 in both amiRNAATG6 # 1 and amiRNAATG6 # 2 lines was significantly lower than that in Col. Specifically, the expression of ATG6 in the amiRNAATG6 #1 and amiRNAATG6 #2 lines decreased by 50∼70% compared with Col (Fig. 7g). Furthermore, to assess the function of ATG6 in plant immune, we performed infiltrations of Pst DC3000/avrRps4 after 100 uM β-estradiol treatment for 24 h. We compared the growth of Pst DC3000/avrRps4 in the amiRNAATG6 lines and Col. The results clearly demonstrate that the growth of Pst DC3000/avrRps4 in amiRNAATG6 # 1 and amiRNAATG6 # 2 was significantly more compared to Col (Fig. 7h). Moreover, we silenced ATG6 in NPR1-GFP (NPR1-GFP/silencing ATG6), and NPR1-GFP/atg5 (crossed NPR1-GFP with atg5 to obtain NPR1-GFP/atg5) was used as an autophagy-deficient control. There was more Pst DC3000/avrRps4 growth in NPR1-GFP/silencing ATG6 and NPR1-GFP/atg5 compared to NPR1-GFP/NC after Pst DC3000/avrRps4 infiltration (Fig. 7i). In contrast, the growth of Pst DC3000/avrRps4 in NPR1-GFP, ATG6-mCherry, ATG6-mCherry × NPR1-GFP was significantly lower than that in Col and npr1 (Fig. 7j) and was the lowest in ATG6-mCherry × NPR1-GFP (Fig. 7j).
These results confirm that ATG6 and NPR1 jointly enhance Arabidopsis resistance to inhibit Pst DC3000/avrRps4 invasion. Together, these results suggest that ATG6 improves plant resistance to pathogens by regulating NPR1.
Discussion
Although SA signaling and autophagy are related to the plant immune system (Yoshimoto et al., 2009; Munch et al., 2014; Wang et al., 2016), the connection of these two processes in plant immune processes and their interaction is rarely reported. Previous studies have shown that unrestricted pathogen-induced PCD requires SA signalling in autophagy-deficient mutants. SA and its analogue benzo (1,2,3) thiadiazole-7-carbothioic acid (BTH) induce autophagosome production (Yoshimoto et al., 2009). Moreover, autophagy has been shown to negatively regulates Pst DC3000/avrRpm1-induced PCD via the SA receptor NPR1 (Yoshimoto et al., 2009), implying that autophagy regulates SA signaling through a negative feedback loop to limit immune-related PCD. Here, we demonstrated that ATG6 increases NPR1 protein levels and nuclear accumulation (Fig. 3 and 5). Additionally, ATG6 also maintains the stability of NPR1 and promotes the formation of SINCs-like condensates (Fig. 5 and 6). These findings introduce a novel perspective on the positive regulation of NPR1 by ATG6, highlighting their synergistic role in enhancing plant resistance.
Our results confirmed that ATG6 overexpression significantly increased nuclear accumulation of NPR1 (Fig. 3). ATG6 also increases NPR1 protein levels and improves NPR1 stability (Fig. 5 and 6). Therefore, we consider that the increased nuclear accumulation of NPR1 in ATG6-mCherry x NPR1-GFP plants might result from higher levels and more stable NPR1 rather than the enhanced nuclear translocation of NPR1 facilitated by ATG6. To verify this possibility, we determined the ratio of NPR1-GFP in the nuclear localization versus total NPR1-GFP. Notably, the ratio (nucleus NPR1/total NPR1) in ATG6-mCherry × NPR1-GFP was not significantly different from that in NPR1-GFP, and there is a similar phenomenon in N. benthamiana (Fig. 3c-f). Further we analyzed whether ATG6 affects NPR1 protein levels and protein stability. Our results show that ATG6 increases NPR1 protein levels under SA treatment and ATG6 maintains the protein stability of NPR1 (Fig. 5 and 6). These results suggested that the increased nuclear accumulation of NPR1 by ATG6 result from higher levels and more stable NPR1.
NPR1 is an important signaling hub of the plant immune response. Nuclear localization of NPR1 is essential to enhance plant resistance (Kinkema et al., 2000; Chen et al., 2021b), it interacts with transcription factors such as TGAs in the nucleus to activate expression of downstream target genes (Chen et al., 2019; Chen et al., 2021a). A recent study showed that nuclear-located ATG8h recognizes C1, a geminivirus nuclear protein, and promotes C1 degradation through autophagy to limit viral infiltration in solanaceous plants (Li et al., 2020). Here, we confirmed that ATG6 is also distributed in the nucleus and ATG6 is co-localized with NPR1 (Fig. 1d and 2), suggesting that ATG6 interact with NPR1 in the nucleus. ATG6 synergistically inhibits the invasion of Pst DC3000/avrRps4 with NPR1. Chen et al. found that in the nucleus, NPR1 can recruit enhanced disease susceptibility 1 (EDS1), a transcriptional coactivator, to synergistically activate expression of downstream target genes (Chen et al., 2021a). Previous studies have shown that acidic activation domains (AADs) in transcriptional activators (such as Gal4, Gcn4 and VP16) play important roles in activating downstream target genes. Acidic amino acids and hydrophobic residues are the key structural elements of AAD (Pennica et al., 1984; Cress and Triezenberg, 1991; Van Hoy et al., 1993). Chen et al. found that EDS1 contains two ADD domains and confirmed that EDS1 is a transcriptional activator with AAD (Chen et al., 2021a). Here, we also have similar results that ATG6 overexpression significantly enhanced the expression of PR1 and PR5 (Fig. 4b-c and S6), and that the ADD domain containing acidic and hydrophobic amino acids is also found in ATG6 (148-295 AA) (Fig. S12). We speculate that ATG6 might act as a transcriptional coactivator to activate PRs expression synergistically with NPR1.
A recent study showed that SA not only enhances plant resistance by increasing NPR1 nuclear import and transcriptional activity, but also promotes cell survival by coordinating the distribution of NPR1 in the nucleus and cytoplasm (Zavaliev et al., 2020). Notably, NPR1 accumulated in the cytoplasm recruits other immunomodulators (such as EDS1, PAD4 etc) to form SINCs to promote cell survival (Zavaliev et al., 2020). Similarly, we also found that NPR1 accumulated abundantly in the cytoplasm after SA treatment and that ATG6 significantly increased NPR1 protein levels (Fig. 3c, 3e and 5a-b). Obviously, the accumulation of NPR1 in the cytoplasm may be related to ATG6 synergizing with NPR1 to enhance plant resistance. Interestingly, ATG6 overexpression significantly increased the formation of SINCs-like condensates (Fig. 5c-d and Supplemental movie 1-2), which should also be a way for ATG6 and NPR1 to synergistically resist invasion of pathogens. We consider that ATG6 promotes the formation of SINCs-like condensates through the dual action of endogenous and exogenous SA. Considering that ATG6 promotes SINCs-like condensates formation, we further examined changes in cell death in Col, amiRNAATG6# 1, amiRNAATG6 # 2, npr1, NPR1-GFP, ATG6-mCherry and ATG6-mCherry × NPR1-GFP plants. The results of Taipan blue staining showed that Pst DC3000/avrRps4-induced cell death in npr1, amiRNAATG6 # 1 and amiRNAATG6 # 2 was significantly higher compared to Col (Fig. S13). Conversely, Pst DC3000/avrRps4-induced cell death in ATG6-mCherry, NPR1-GFP and ATG6-mCherry × NPR1-GFP was significantly lower compared to Col. Notably, Pst DC3000/avrRps4-induced cell death in ATG6-mCherry × NPR1-GFP was significantly lower compared ATG6-mCherry and NPR1-GFP (Fig. S13). These results suggest that ATG6 and NPR1 jointly inhibit Pst DC3000/avrRps4-induced cell dead.
ATG6 is a common and required subunit of PtdIns3K lipid kinase complexes, which regulates autophagosome nucleation in Arabidopsis (Qi et al., 2017; Bozhkov, 2018). In this study, we also found that ATG6 can maintain the stability of NPR1. Thus, to confirm whether the regulation of NPR1 protein stability by ATG6 is autophagy-dependent, we used autophagy inhibitors (Concanamycin A, ConA and Wortmannin, WM) to detect the degradation of NPR1-GFP. Cell-free degradation assays showed that 100 μM MG115 treatment significantly inhibited the degradation of NPR1-GFP. However, 5 μM concanamycin A and 30 μM Wortmannin treatment did not significantly delay NPR1 degradation (Fig. S14). In addition, we also analyzed the degradation of NPR1-GFP in NPR1-GFP and NPR1-GFP/atg5 following 100 μM cycloheximide (CHX) treatment. The results show that the degradation rate of NPR1-GFP in NPR1-GFP/atg5 plants was similarly to that in NPR1-GFP plants (Fig. 6e and f). These results suggest that autophagy defects do not affect the protein stability of NPR1, and ATG6 promoting NPR1 protein stability maybe its unique autophagy-independent role.
An increasing number of studies have shown that ATGs differentially affect plant immunity. Deletion of ATGs (ATG5, ATG7, ATG10 etc.) leads to reduced resistance of plants to necrotrophic pathogens (Lai et al., 2011; Lenz et al., 2011; Minina et al., 2018). ATGs can directly interact with other proteins to positively regulate plant immunity. In N. benthamiana, ATG8f interacts the effector protein βC1 of the cotton leaf curl multan virus and promotes its degradation to limit pathogen invasion (Haxim et al., 2017). Notably, ATG18a can interact with WRKY33 transcription factor to synergistically against Botrytis invasion (Lai et al., 2011). Our evidence shows that ATG6 interacts with NPR1 and works together to counteract pathogen invasion by positively regulating NPR1 and SA levels in vivo. In conclusion, we unveil a novel relationship in which ATG6 positively regulates NPR1 in plant immunity (Fig. 8). ATG6 interacts with NPR1 to synergistically enhance plant resistance by regulating NPR1 protein levels, stability, nuclear accumulation, and formation of SINCs-like condensates.

Working model for NPR1 regulation by ATG6.
ATG6 interacts directly with NPR1 to increase NPR1 protein level and stability, thereby promoting the formation of SINCs-like condensates and increasing the nuclear accumulation of NPR1. ATG6 synergistically activates PRs expression with NPR1 to jointly enhance resistance to inhibit Pst DC3000/avrRps4 invasion in Arabidopsis.
Material and Methods
Plasmid construction
Details of plasmid construction methods are listed in Methods S1 of Supplemental Data 1, primer used are listed in Table S1 and S2 of Supplemental Data 1. The mapping of vectors is listed in Supplemental Data 2.
Plant material
Arabidopsis
35S::NPR1-GFP (in npr1-2 background) and npr1-1 were kindly provided by Dr. Xinnian Dong of Duke University; atg5-1 (SALK_020601).
UBQ10::ATG6-mCherry, UBQ10::ATG6-GFP and amiRNAATG6lines were obtained by Agrobacterium transformation (Clough and Bent, 1998). ATG6, NPR1 double overexpression of Arabidopsis (ATG6-mCherry × NPR1-GFP) and NPR1-GFP/atg5 were obtained by crossing respectively.
Full description of the Arabidopsis screening is included Methods S2 of Supplemental Data 1. Details of plant material are listed in Table S3 of Supplemental Data 1.
Growth conditions
Arabidopsis thaliana
All Arabidopsis thaliana (Arabidopsis) seeds were treated in 10% sodium hypochlorite for 7 min, washed with ddH2O, and treated in 75% ethanol for 30 s, finally washed three times with ddH2O. Seeds were sown in 1/2 MS with 2% sucrose solid medium, vernalized at 4℃ for 2 days.
For 7-day-old Arabidopsis seedling cultures, the plates were placed under the following conditions: daily cycle of 16 h light (∼80 µmolm−2. s−1) and 8 h dark at 23 ± 2℃.
For 3-week-old Arabidopsis cultures, after 7 days of growth on the plates, the seedlings were transferred to soil for further growth for 2 weeks under the same conditions (Zhang et al., 2018).
N. benthamiana
For 3-week-old N. benthamiana cultures, seeds were sown in the soil and vernalized at 4℃ for 2 days. After 10 days of growth on soil, the seedlings were transferred to soil for further growth for 2 weeks under the same conditions (Jiao et al., 2019).
Treatment conditions
Treatment of 7-day-old seedlings
For SA treatment
7-day-old Arabidopsis seedlings were transferred to 1/2 MS liquid medium containing 0.5 mM SA for 0, 3 and 6 h, respectively. The corresponding results are shown in Fig. 2e, f, 3c, d and 5a.
For cycloheximide (CHX) treatment
Seedlings of Arabidopsis (7 days) were transferred to 1/2 MS liquid medium containing 100 μM CHX for 0, 3, 6 and 9 h, respectively. The corresponding results are shown in Fig. 6c and e.
Treatment of 3-week-old Arabidopsis
For silencing ATG6 in Col and NPR1-GFP
As previously described (Lei et al., 2020; Zhang et al., 2022; Zhang et al., 2023), 1 mM gold nanoparticles (AuNPs) were synthesized. The artificial microRNA (amiRNA)ATG6 (UCAAUUCUAGGAUAACUGCCC) was designed based on the Web MicroRNA Designer (http://wmd3.weigelworld.org/) platform. The complementary sequence of amiRNAATG6 is located on the eighth exon of the ATG6 gene. The sequence of “UUCUCCGAACGUGUCACGUTT” was used as a negative control (NC). NC is a universal negative control without species specificity (Gao et al., 2018; Lei et al., 2020). amiRNAATG6and amiRNANC synthesized by Suzhou GenePharma. AuNPs (1 mM) and amiRNAATG6 (20 µM) were incubated at a 9:1 ratio for 30 min at 25℃, 50 rpm. After incubation, a mixture of AuNPs and amiRNAATG6was diluted 15-fold with the infiltration buffer (pH 5.7, 10 mM MES, 10 mM MgCl2) and infiltrated through the abaxial leaf surface into 3-week-old Col or NPR1-GFP for 1-3 days. The third day was chosen as material for ATG6 silencing. After the third day of AuNPs-amiRNAATG6and AuNPs-amiRNANC infiltration, Pst DC3000/avrRps4 was infiltrated, and then growth of Pst DC3000/avrRps4 was detected.
For β-estradiol treatment
100 μM β-estradiol was infiltrated to treat 3-week-old Arabidopsis leaves. After 24 h of treatment with β-estradiol, Pst DC3000/avrRps4 was infiltrated and then growth of Pst DC3000/avrRps4 was detected after 3 d.
For Pst DC3000/avrRps4 infiltration
Infiltration with Pst DC3000/avrRps4 was performed as previously described (Wang et al., 2016; Skelly et al., 2019). Full description of the Pst DC3000/avrRps4 culture is included in Methods S3 of Supplemental Data 1.
For SA treatment
For 3-week-old Col, 0.5 mM SA was infiltrated into the leaves for 0, 2, 4, 6 and 8 h. The corresponding results are shown in Fig. 7b and c.
Yeast two-hybrid assay
Yeast two-hybrid experiments were performed according to the previously described protocol (Fu et al., 2012). Full description of Yeast two-hybrid is included in Methods S4 of Supplemental Data 1.
Pull down assays in vitro
500 μL of GST, GST-ATG6, SnRK2.8-GST were incubated with GST-tag Purification Resin (Beyotime, P2250) for 2 h at 4°C. The mixture was then centrifuged at 1500 g for 1 min at 4°C, and the resin was washed three times with PBS buffer. Next, the GST-tag purification resin was incubated with the NPR1-His for 2 h at 4°C. After washing three times with PBS buffer, 2 × sample buffers were added to the resin and denatured at 100 °C for 10 mins. The resulting samples were then used for western blotting analysis. Full description of prokaryotic proteins expression is included in Methods S5 of Supplemental Data 1.
Co-immunoprecipitation
0.5 g leaves of N. benthamiana transiently transformed with ATG6-mCherry + GFP and ATG6-mCherry + NPR1-GFP were fully ground in liquid nitrogen and homogenized in 500 μL of lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5 mM EDTA, 5% Glycerol, 0.2% NP40, 1 mM PMSF, 40 μM MG115, protease inhibitor cocktail 500× and phosphatase inhibitor cocktail 5000×). The samples were then incubated on ice for 30 mins, and centrifuged at 10142 g (TGL16, cence, hunan, China) for 15 mins at 4°C. The supernatant (500 μL) was incubated with 20 μL of GFP-Trap Magnetic Agarose beads (ChromoTek, gtma-20) in a 1.5 mL Eppendorf tube for 2 h by rotating at 4°C. After incubation, the GFP-Trap magnetic Agarose beads were washed three times with cold wash buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5 mM EDTA) and denatured at 75°C for 10 minutes after adding 2 × sample buffer. Western blotting was performed with antibodies to ATG6 and GFP.
Nuclear and cytoplasmic separation
Nuclear and cytoplasmic separation were performed according to the previously described method (Kinkema et al., 2000). Full description of nuclear and cytoplasmic separation is given in Methods S6 of Supplemental Data 1.
Protein degradation in vitro
Protein degradation assays were performed according to a previously described method (Spoel et al., 2009; Saleh et al., 2015). Full description of protein degradation is included in Methods S7 of Supplemental Data 1.
Protein Extraction and Western Blotting Analysis
Protein extraction and western blotting were performed as previously described (Lei et al., 2020; Zhang et al., 2022). Protein was denatured at 100°C for 10 mins. NPR1 protein was denatured at 75°C for 10 mins (Lei et al., 2020). Full description is included in Methods S8 of Supplemental Data 1. Antibody information is presented in Table S4 of Supplemental Data 1.
Confocal microscope observation
For nuclear localization of NPR1-GFP observation
7-day-old seedlings of NPR1-GFP and ATG6-mCherry × NPR1-GFP were sprayed with 0.5 mM SA for 0 and 3 h. GFP and mCherry fluorescence signals in leaves were observed under the confocal microscope (Zeiss LSM880). At least 20 image sets were obtained and analyzed.
For the Bimolecular Bluorescence Complementation assay (BiFC)
Agrobacterium was infiltrated into N. benthamiana as previously described (Jiao et al., 2019). Fluorescence signals were observed after 3 days. The full description of BiFC is contained in Methods S9 and S10 of Supplemental Data 1.
For the observation of SINCs-like condensates
Agrobacterium was infiltrated into N. benthamiana. After 2 days, the leaves were treated in 1 mM SA solution for 24 h, and then fluorescence signals were observed. At least 20 image sets were obtained and analyzed. A full description of SINCs-like condensates observation is included in Methods S11 of Supplemental Data 1.
For growth of Pst DC3000/avrRps4
A low dose (OD600 = 0.001) of Pst DC3000/avrRps4 was used for the infiltration experiments. After 3 days, the colony count was counted according to a previous description (Wang et al., 2016; Lei et al., 2020). Full description of the growth of Pst DC3000/avrRps4 is given in Methods S12 of Supplemental Data 1.
Free SA measurement
Free SA was extracted from 3-week-old Arabidopsis using a previously described method (Wang et al., 2016; Gong et al., 2020). Free SA was measured by High-performance liquid chromatography (Shimadzu LC-6A, Japan). Detection conditions: 294 nm excitation wavelength, 426 nm emission wavelength.
Real-Time Quantitative PCR (RT-qPCR)
Total RNA was extracted from Arabidopsis (100 mg) using Trizol RNA reagent (Invitrogen, 10296-028, Waltham, MA, USA). RT-qPCR assays were performed as previously described (Zhang et al., 2018; Zhang et al., 2022). All primers for RT-qPCR are listed individually in Table S5 of Supplemental Data 1. Full description of RT-qPCR is included in Methods S13 of Supplemental Data 1.
Trypan Blue Staining
The leaves of 3-week-old Col, amiRNAATG6# 1, amiRNAATG6 # 2, npr1, NPR1-GFP, ATG6-mCherry and ATG6-mCherry × NPR1-GFP plants, located in the fifth and sixth positions, were infiltrated with Pst DC3000/avrRps4. After 3 days, the leaves were excised and subjected to a 1 min boiling step in trypan blue staining buffer (consisting of 10 g phenol, 10 mL glycerol, 10 mL lactic acid, 10 mL ddH2O, and 10 mg trypan blue), followed by destaining 3 times at 37℃ in 2.5 mg/mL chloral hydrate.
Statistical Analysis
All quantitative data in this study were presented as mean ± SD. The experimental data were analyzed by a two-tailed Student’s t-test. Significance was assigned at P values < 0.05 or < 0.01.
Acknowledgements
We thank Dr. Xinnian Dong (Duke University, USA), Dr. ZhengQing Fu (University of South Carolina) and Dr. Sheng Li (South China Normal University) for their help and contribution.
Abbreviations
amiRNAATG6: artificial miRNAATG6
ATGs: Autophagy-related genes
CHX: Cycloheximide
AuNPs: Gold nanoparticles
NPR1: Nonexpressor of pathogenesis-related genes 1
NLS: Nuclear localization sequence
Pst: P. syringae pv. tomato
SINCs: SA-induced NPR1 condensates
SA: Salicylic acid
ATG6-mCherry × NPR1-GFP: UBQ10::ATG6-mCherry × 35S::NPR1-GFP
Conflicts of interest
The author declares that there are no conflicts of interest.
Funding
This research was supported by the National Natural Science Foundation of China [Grant Number 31570256].
Data availability
The authors confirm that the data supporting the results of this study are available in the article and its supplementary materials.
Supplemental Figures

Physical interaction between NPRs and ATGs in yeast.
The CDS of NPR1, NPR3, NPR4, ATG6 and ATG8d-g were fused to the AD and BD domains, respectively, and co-expressed with yeast cells. Yeast cell growth on SD/-Trp-Leu-His-Ade media represents interaction. Add different concentrations of SA to SD/-Tro-Leu-His-Ade medium to verify the effect of SA on their interactions. All experiments were performed with three biological replicates.

Bimolecular fluorescence complementation assay of NPR1 with ATG6 in N. benthamiana.
Agrobacterium carrying ATG6-nYFP and NPR1-cYFP was co-expressed in leaves of Nicotiana benthamiana for 3 days. As a positive control, NPR1-nYFP and SnRK2.8-cYFP were co-expressed. As negative controls, nYFP and ATG6-cYFP, NPR1-nYFP and cYFP, nYFP and SnRK2.8-cYFP were co-expressed. Confocal images were obtained from chloroplast (Chl), YFP, Bright field. Scale bar = 20 pm. Experiment was performed with three biological replicates.

The nuclear localization of ATG6 in Arabidopsis. Fig. S4 Identification of ATG6-mCherry × NPR1-GFP plants.
(a). The nuclear localization of ATG6-GFP in ATG6-GFP under normal condition. Scale bar, 20 Mm. (b). The nuclear localization of ATG6-mCherry in ATG6-mCherry × NPR1-GFP. Scale bar, 100 um. (c). Predicted subcellular localization of ATG6 by Arabidopsis database (https://suba.live/). (d). ATG6-GFP and free GFP protein levels in ATG6-GFP Arabidopsis. (e). ATG6-GFP and free GFP protein levels in N. benthamiana. Black asterisk (*) indicate ATG6-GFP bands. All experiments were performed with three biological replicates.

Identification of ATG6-mCherry × NPR1-GFP plants.
(a). Total proteins from 7-day-old seedlings were extracted. Western blots analysis with ATG6 and GFP antibodies. Actin was used as an internal reference. Black asterisk (*) indicate ATG6-mCherry bands. (b). NPR1-GFP and free FP protein levels in 7-day-old seedlings of NPR1-GFP and ATG6-mCherry × NPR1-GFP plants after 0.5 mM SA treatment for 0, 3, 6 and 9 h. Numerical values indicate the ration of NPR1-GFP/free FP. All experiments were performed with three biological replicates.

Subcellular fractionation of endogenous ATG6 in Col after 0.5 mM SA treatment for 0, 3, 6 and 20 h.
Cytoplasmic and nuclear proteins were extracted from Arabidopsis. Endogenous ATG6 were detected using ATG6 antibody. Actin and H3 were used as cytoplasmic and nucleus internal reference, respectively. Numerical values indicate quantitative analysis of ATG6 using image J.

Overexpression of ATG6 delayed dark-induced leaf senescence. Fig. S7 Expression of ICS1 under normal and SA treatment conditions.
(a). Phenotypes of detached rosette leaves from 3-week-old of Col, amiRNAATG6 # 1, amiRNAATG6 # 2, ATG6-mCherry, ATG6-GFP and atg5 under constant dark treatment for 4 days. Bar = 1 cm. (b). Relative chlorophyll content in (a). ** indicates that the significant difference compared to the Col is at the level of 0.01 (Student t test p-value, ** p < 0.01).

Expression of ICS1 under normal and 0.5 mM SA treatment conditions.
** indicates that the significant difference compared to the control is at the level of 0.01 (Student t test p value, ** p< 0.01). Experiment was performed with three biological replicates.

Expression of PR1 and PR5 in Col and ATG6-mCherry under normal and Pst DC3000/avrRps4 treatment.
** indicates that the significant difference compared to the control is at the level of 0.01 (Student t test o value, ** p< 0.01). Experiment was performed with three biological replicates.

The protein level of NPR1-GFP in NPR1-GFP/silencing ATG6 and NPR1-GFP/Negative control.
The mixture of AuNPs-amiRNAATG6 or AuNPs-amiRNANgeative control was performed by pressure infiltration through the abaxial leaf surface. After 3 days, NPR1-GFP protein levels were detected by treating with 0.5 mM SA for 0, 3, and 6 h.

Expression of NPR1 in Col and ATG6-mCherry under normal and Pst DC3000/avrRps4 treatment.
** indicates that the significant difference compared to the control is at the level of 0.01 (Student t test p value, ** p< 0.01). Experiment was performed with three biological replicates.

ATG6 improves the protein stability of NPR1 in N. benthamiana.
(a). NPR1-GFP degradation assay in N. benthamiana. Total proteins from N. benthamiana co-transfected with Cherry + NPR1-GFP and ATG6-mCherry + NPR1-GFP were extracted. CBB was used as a control. (b). Quantification of NPR1-GFP degradation rates in (a) using Image J. All experiments were performed with three biological replicates.

Structural analysis of acidic activation domains in ATG6.
Acidic (red) and hydrophobic (blue) amino acid residues in AADs.

NPR1-GFP degradation assay in ATG6-mCherry x NPR1-GFP Arabidopsis.
(a). Trypan blue staining showing cell death in the leaves of Col, amiRNAATG6 # 1, amiRNAATG6 # 2, npr1, NPR1-GFP, ATG6-mCherry and ATG6-mCherry × NPR1-GFP. A low dose of Pst DC3000/avrRps4 (OD600 = 0.001) was infiltrated. After 3 days, Trypan blue staining was performed, Bar, 0.2 cm. (b). Number of dead cells per section in the leaves of Col, amiRNAATG6 # 1, amiRNAATG6 # 2, npr1, NPR1-GFP, ATG6-mCherry and ATG6-mCherry × NPR1-GFP in (a). ** indicates that the significant difference compared to the control is at the level of 0.01 (Student t test p value, ** p< 0.01).

NPR1-GFP degradation assay in ATG6-mCherry × NPR1-GFP Arabidopsis.
Total proteins from 7-day-old seedlings of ATG6-mCherry × NPR1-GFP were extracted. These extracts were then incubated at room temperature (25°C) for 0~120 minutes to analyze the degradation rate of NPR1-GFP. To inhibit the proteasome pathway, 100 MM MG115 was utilized. Additionally, autophagy was inhibited using 5 uM concanamycin A and 30 uM Wortmannin. The analysis of NPR1-GFP was quantitatively performed using Image J software, and the corresponding numerical values were determined.

Verification of ATG6 antibody specificity.
(a). Prokaryotic expression of the GST-ATG6 fusion protein was used to verify the specificity of the ATG6 antibody, and GST and GST-SnRK2.8 were used as negative controls. GST-ATG6 bands was marked with a black asterisk. (b). The levels of ATG6 protein. Levels of ATG6-mCherry and endogenous ATG6 in Col, amiRNAATG6 # 1, amiRNAATG6 # 2 and ATG6-mCherry were detected after 100 uM estradiol treatment for 24 h.
References
- Plant autophagy: mechanisms and functionsJ Exp Bot 69:1281–1285Google Scholar
- The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeatsCell 88:57–63Google Scholar
- Two interacting transcriptional coactivators cooperatively control plant immune responsesSci Adv 7Google Scholar
- NPR1 Promotes Its Own and Target Gene Expression in Plant Defense by Recruiting CDK8Plant Physiol 181:289–304Google Scholar
- More stories to tell: NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1, a salicylic acid receptorPlant Cell Environ Google Scholar
- Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thalianaPlant J 16:735–743Google Scholar
- Critical structural elements of the VP16 transcriptional activation domainScience 251:87–90Google Scholar
- Stories of Salicylic Acid: A Plant Defense HormoneTrends Plant Sci 25:549–565Google Scholar
- Abscisic acid promotes proteasome-mediated degradation of the transcription coactivator NPR1 in Arabidopsis thalianaPlant J 86:20–34Google Scholar
- NPR3 and NPR4 are receptors for the immune signal salicylic acid in plantsNature 486:228–232Google Scholar
- An Arabidopsis homolog of yeast ATG6/VPS30 is essential for pollen germinationPlant Physiol 143:1132–1139Google Scholar
- Chromatin Accessibility Landscape in Human Early Embryos and Its Association with EvolutionCell 173:248–259Google Scholar
- Phosphatidylinositol-4-phosphate controls autophagosome formation in Arabidopsis thalianaNature Communications 13Google Scholar
- ATG4 Mediated Psm ES4326/AvrRpt2-Induced Autophagy Dependent on Salicylic Acid in Arabidopsis ThalianaInt J Mol Sci 21Google Scholar
- Autophagy protein 6 (ATG6) is required for pollen germination in Arabidopsis thalianaAutophagy 4:339–348Google Scholar
- Autophagy functions as an antiviral mechanism against geminiviruses in plantsElife 6Google Scholar
- Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8aInternational Journal of Molecular Sciences 20Google Scholar
- Transcriptomic and functional analyses reveal an antiviral role of autophagy during pepper mild mottle virus infectionBmc Plant Biology 20Google Scholar
- The plant immune systemNature 444:323–329Google Scholar
- Chloroplast Autophagy and Ubiquitination Combine to Manage Oxidative Damage and Starvation ResponsesPlant Physiol 183:1531–1544Google Scholar
- Nuclear localization of NPR1 is required for activation of PR gene expressionPlant Cell 12:2339–2350Google Scholar
- A critical role of autophagy in plant resistance to necrotrophic fungal pathogensPlant J 66:953–968Google Scholar
- Systemic Immunity Requires SnRK2.8-Mediated Nuclear Import of NPR1 in ArabidopsisPlant Cell 27:3425–3438Google Scholar
- Construction of gold-siRNA(NPR1) nanoparticles for effective and quick silencing of NPR1 in Arabidopsis thalianaRsc Advances 10:19300–19308Google Scholar
- Autophagy differentially controls plant basal immunity to biotrophic and necrotrophic pathogensPlant J 66:818–830Google Scholar
- Beclin1 restricts RNA virus infection in plants through suppression and degradation of the viral polymeraseNat Commun 9:1268Google Scholar
- Nuclear autophagy degrades a geminivirus nuclear protein to restrict viral infection in solanaceous plantsNew Phytol 225:1746–1761Google Scholar
- Autophagy regulates programmed cell death during the plant innate immune responseCell 121:567–577Google Scholar
- Autophagic Degradation of the 26S Proteasome Is Mediated by the Dual ATG8/Ubiquitin Receptor RPN10 in ArabidopsisMolecular Cell 58:1053–1066Google Scholar
- Transcriptional stimulation of rate-limiting components of the autophagic pathway improves plant fitnessJ Exp Bot 69:1415–1432Google Scholar
- Autophagy deficiency leads to accumulation of ubiquitinated proteins, ER stress, and cell death in ArabidopsisAutophagy 10:1579–1587Google Scholar
- An estradiol-inducible promoter enables fast, graduated control of gene expression in fission yeastYeast 34:323–334Google Scholar
- Arabidopsis ATG6 is required to limit the pathogen-associated cell death responseAutophagy 4:20–27Google Scholar
- The amino acid sequence of murine p53 determined from a c-DNA cloneVirology 134:477–482Google Scholar
- TRAF Family Proteins Regulate Autophagy Dynamics by Modulating AUTOPHAGY PROTEIN6 Stability in ArabidopsisPlant Cell 29:890–911Google Scholar
- Arabidopsis AtBECLIN 1/AtAtg6/AtVps30 is essential for pollen germination and plant developmentCell Res 17:249–263Google Scholar
- The coactivator function of Arabidopsis NPR1 requires the core of its BTB/POZ domain and the oxidation of C-terminal cysteinesPlant Cell 18:3670–3685Google Scholar
- Posttranslational Modifications of the Master Transcriptional Regulator NPR1 Enable Dynamic but Tight Control of Plant Immune ResponsesCell Host Microbe 18:169–182Google Scholar
- Dynamic ubiquitination determines transcriptional activity of the plant immune coactivator NPR1Elife 8Google Scholar
- Proteasome-mediated turnover of the transcription coactivator NPR1 plays dual roles in regulating plant immunityCell 137:860–872Google Scholar
- Plant immunity requires conformational changes [corrected] of NPR1 via S-nitrosylation and thioredoxinsScience 321:952–956Google Scholar
- The acidic activation domains of the GCN4 and GAL4 proteins are not alpha helical but form beta sheetsCell 72:587–594Google Scholar
- Identification of transcription factors that regulate ATG8 expression and autophagy in ArabidopsisAutophagy 16:123–139Google Scholar
- Salicylic acid promotes autophagy via NPR3 and NPR4 in Arabidopsis senescence and innate immune responseActa Physiologiae Plantarum 38Google Scholar
- The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acidCell Rep 1:639–647Google Scholar
- Plant Bax Inhibitor-1 interacts with ATG6 to regulate autophagy and programmed cell deathAutophagy 13:1161–1175Google Scholar
- Autophagy negatively regulates cell death by controlling NPR1-dependent salicylic acid signaling during senescence and the innate immune response in ArabidopsisPlant Cell 21:2914–2927Google Scholar
- Wheat homologs of yeast ATG6 function in autophagy and are implicated in powdery mildew immunityBMC Plant Biol 15:95Google Scholar
- Formation of NPR1 Condensates Promotes Cell Survival during the Plant Immune ResponseCell 182:1093–1108Google Scholar
- Gold nanoparticles (AuNPs) can rapidly deliver artificial microRNA (AmiRNA)-ATG6 to silence ATG6 expression in ArabidopsisPlant Cell Rep 42:1191–1201Google Scholar
- Expression of AhDREB1, an AP2/ERF Transcription Factor Gene from Peanut, Is Affected by Histone Acetylation and Increases Abscisic Acid Sensitivity and Tolerance to Osmotic Stress in ArabidopsisInt J Mol Sci 19Google Scholar
- Expression of PEI-coated gold nanoparticles carrying exogenous gene in periwinkle mesophyll cells and its practice in huanglongbing researchiScience 25:104479Google Scholar
- E3 ubiquitin ligase CHIP and NBR1-mediated selective autophagy protect additively against proteotoxicity in plant stress responsesPLoS Genet 10:e1004116Google Scholar
Article and author information
Author information
Version history
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.97206. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, Zhang et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 2,774
- downloads
- 366
- citations
- 8
Views, downloads and citations are aggregated across all versions of this paper published by eLife.