Temporal dynamics and developmental memory of 3D chromatin architecture at Hox gene loci
- Ecole Polytechnique Fédérale de Lausanne, Switzerland
- Harvard University, United States
- University of Geneva, Switzerland
Figures
Figure 1 with 7 supplements
Hox clusters in ES cells are organized as 3D compartments.
(A) Quantitative local 4C-seq signal for the Hoxd13 (top), Hoxd9 (middle) and Hoxd4 (bottom) viewpoints in ES cells. Below, the H3K27me3 and H3K4me3 ChIP-seq signals are aligned. The boundaries of …
Figure 1—figure supplement 1
3D compartments in the HoxD cluster are less discrete in ES cells than in embryonic brain cells.
Comparison of quantitative local 4C-seq signals for replicate samples with the indicated viewpoints, either in ES (orange) or E10.5 forebrain (green) cells. All six comparisons between two …
Figure 1—figure supplement 2
3D compartments in the HoxD and HoxB cluster are less discrete in ES cells than in embryonic brain cells.
Comparison of quantitative local 4C-seq signals for replicate samples with the indicated viewpoints, either in ES (orange) or E10.5 forebrain (green) cells. All six comparisons between two …
Figure 1—figure supplement 3
3D compartments in the HoxB cluster are less discrete in ES cells than in embryonic brain cells.
Comparison of quantitative local 4C-seq signals for replicate samples with the indicated viewpoints, either in ES (orange) or E10.5 forebrain (green) cells. All six comparisons between two …
Figure 1—figure supplement 4
3D compartments in the HoxC and HoxA cluster are less discrete in ES cells than in embryonic brain cells.
Comparison of quantitative local 4C-seq signals with the indicated viewpoints in ES (orange) or E10.5 forebrain (green) cells. Viewpoints are indicated with arrowheads and regions excluded around …
Figure 1—figure supplement 5
Distribution of ratios inside and outside the inactive 3D Hox gene compartments in both ES and E10.5 forebrain cells.
The comparison between replicate samples one (as used in the main text) is indicated on the left, the comparison between combined replicate samples is indicated at the center left, the comparison …
Figure 1—figure supplement 6
Different discretion of 3D compartments is not due to overall increased background signal.
(A) Distribution of 4C-seq signal on chromosome 2 from viewpoints in the HoxD cluster. On the right, a schematic representation of chromosome 2 is given, with color codes for the three categories …
Figure 1—figure supplement 7
Increased Hox background transcription in ES cells.
(A) Expression levels of Hox genes and of four housekeeping genes in both ES and E10.5 forebrain cells, as determined by RNA-seq. The large majority of Hox genes show low level activity in ES cells, …
Figure 2 with 2 supplements
Bi-modal 3D organization of Hox clusters upon sequential activation.
(A) Quantitative local 4C-seq signal for the Hoxd13 (left, centromeric side of HoxD cluster) and Hoxd4 (right, telomeric side of HoxD cluster) viewpoints, either in ES (orange), or E8.5 pre-somitic …
Figure 2—figure supplement 1
Upon sequential activation, the HoxD cluster adopts a bi-modal 3D organization.
Quantitative local 4C-seq signals for the indicated Hoxd gene viewpoints. Profiles are displayed for ES (orange) and E8.5 pre-somitic mesoderm (cyan) cells. The viewpoints are indicated with …
Figure 2—figure supplement 2
Upon sequential activation, other Hox clusters adopt a bi-modal 3D organization as well.
Quantitative local 4C-seq signals for the indicated Hox gene viewpoints in other Hox clusters. Profiles are displayed for ES (orange) and E8.5 pre-somitic mesoderm (cyan) cells. The viewpoints are …
Figure 3
Activated Hoxd genes switch compartments.
Quantitative local 4C-seq signals for the Hoxd13, Hoxd11 Hoxd9 and Hoxd4 viewpoints in either E8.5 pre-somitic mesoderm (cyan), E9.5 tail bud (brown) or E10.5 tail bud (purple) cells. The colinear …
Figure 4
The bimodal 3D organization of Hox cluster may help memorize states of colinear expression.
Quantitative local 4C-seq signals for the Hoxd13, Hoxd11 Hoxd9 and Hoxd4 viewpoints, in samples taken at various anterior to posterior positions along the developing body axis from E10.5 embryos. …
Figure 5 with 2 supplements
Sequential Hoxd gene activation occurs without drastic remodeling of long-range interactions.
(A) Distribution of long-range contacts in both the centromeric and telomeric gene deserts surrounding the HoxD cluster. Smoothed 4C-seq signals (11 fragment window size) are shown for the Hoxd13 …
Figure 5—figure supplement 1
Temporal colinearity occurs without dynamic long-range interactions.
(A) Distribution of long-range contacts in the centromeric and telomeric gene deserts surrounding the HoxD cluster. Smoothed 4C-seq signals (11 fragment window size) for the indicated HoxD …
Figure 5—figure supplement 2
Comparison between HiC and 4C-seq datasets obtained in ES cells.
(A) Virtual 4C carried out from HiC datasets, using bins covering the indicated Hoxd genes as viewpoints. Bins used as viewpoints are indicated in red. The interactions with bins covering the …
Figure 6
Model of dynamic bi-modal 3D compartmentalization during temporal colinearity.
(A) Schematic organization of topological domains in ES cells (from Dixon et al. 2012) matching the centromeric and telomeric gene deserts, with an apparent boundary assigned near the Hoxd11 gene …
Author response image 1
Author response image 2
Tables
Table 1
Spearman's rank correlation coefficient between pairs of 4C-seq and ChIP-seq samples
| ChIP-seq | |||
|---|---|---|---|
| 4C-seq | Input | H3K27me3 | H3K4me3 |
| Hoxd13 ES cells 1 | −0.14 | 0.52 | 0.24 |
| Hoxd13 ES cells 2 | −0.07 | 0.40 | 0.22 |
| Hoxd13 E8.5 PSM | −0.03 | 0.58 | 0.13 |
| Hoxd13 E10.5 Forebrain 1 | −0.12 | 0.67 | 0.26 |
| Hoxd13 E10.5 Forebrain 2 | −0.09 | 0.69 | 0.25 |
| Hoxd13 E10.5 Anterior trunk | −0.07 | 0.80 | 0.30 |
| Hoxd9 ES cells 1 | −0.08 | 0.63 | 0.28 |
| Hoxd9 ES cells 2 | −0.13 | 0.59 | 0.26 |
| Hoxd9 E8.5 PSM | −0.05 | 0.31 | 0.29 |
| Hoxd9 E10.5 Forebrain 1 | −0.08 | 0.66 | 0.26 |
| Hoxd9 E10.5 Forebrain 2 | −0.12 | 0.61 | 0.28 |
| Hoxd9 E10.5 Anterior trunk | −0.15 | 0.67 | 0.47 |
| Hoxd4 ES cells 1 | 0.01 | 0.48 | 0.11 |
| Hoxd4 ES cells 2 | −0.07 | 0.50 | 0.29 |
| Hoxd4 E8.5 PSM | −0.04 | 0.04 | 0.38 |
| Hoxd4 E10.5 Forebrain 1 | −0.05 | 0.59 | 0.24 |
| Hoxd4 E10.5 Forebrain 2 | −0.04 | 0.58 | 0.27 |
| Hoxd4 E10.5 Anterior trunk | −0.07 | 0.16 | 0.59 |
| Hoxc13 ES cells 1 | −0.03 | 0.39 | 0.20 |
| Hoxc13 E8.5 PSM | −0.03 | 0.55 | −0.03 |
| Hoxc13 E10.5 Forebrain 1 | −0.07 | 0.57 | 0.18 |
| Hoxc13 E10.5 Anterior trunk | −0.05 | 0.82 | 0.00 |
| Hoxb13 ES cells 1 | −0.05 | 0.12 | 0.02 |
| Hoxb13 ES cells 2 | −0.08 | −0.01 | 0.15 |
| Hoxb13 E8.5 PSM | 0.10 | 0.29 | −0.17 |
| Hoxb13 E10.5 Forebrain 1 | 0.02 | 0.48 | 0.09 |
| Hoxb13 E10.5 Forebrain 2 | 0.08 | 0.44 | 0.10 |
| Hoxb13 E10.5 Anterior trunk | −0.03 | 0.49 | 0.26 |
| Hoxb9 ES cells 1 | 0.01 | 0.47 | 0.09 |
| Hoxb9 ES cells 2 | 0.03 | 0.34 | 0.04 |
| Hoxb9 E8.5 PSM | −0.04 | −0.30 | 0.57 |
| Hoxb9 E10.5 Forebrain 1 | 0.02 | 0.63 | 0.19 |
| Hoxb9 E10.5 Forebrain 2 | 0.03 | 0.59 | 0.16 |
| Hoxb9 E10.5 Anterior trunk | 0.06 | −0.01 | 0.69 |
| Hoxa13 ES cells 1 | 0.10 | 0.52 | 0.14 |
| Hoxa13 E8.5 PSM | 0.10 | 0.58 | 0.12 |
| Hoxa13 E10.5 Forebrain 1 | 0.07 | 0.60 | 0.22 |
| Hoxa13 E10.5 Anterior trunk | 0.06 | 0.73 | 0.20 |
-
Spearman's rank correlation coefficient between pairs of 4C-seq and ChIP-seq samples in different samples (see section ‘Material and methods’ for methodology). For each 4C-seq sample, the highest correlating ChIP-seq sample is highlighted in bold.
Table 2
4C-seq Inverse primer sequences
| Viewpoint | Inverse primer | Sequence |
|---|---|---|
| Hoxd13 | iHoxd13 forward* | AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAAAAATCCTAGACCTGGTCATG |
| chr2:74504328-74504348 | ||
| iHoxd13 reverse* | CAAGCAGAAGACGGCATACGAGGCCGATGGTGCTGTATAGG | |
| chr2:74505579-74505598 | ||
| Hoxd11 | iHoxd11 forward* | AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGCATACTTCCTCAGAAGAGGCA |
| chr2:74523621-74523643 | ||
| iHoxd11 reverse* | CAAGCAGAAGACGGCATACGACTAGGAAAATTCCTAATTTCAGG | |
| chr2:74523881-74523903 | ||
| Hoxd9 | iHoxd9 forward* | AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTACGAACACCTCGTCGCCCT |
| chr2:74536168-74536185 | ||
| iHoxd9 reverse* | CAAGCAGAAGACGGCATACGACCCTCAGCTTGCAGCGAT | |
| chr2:74536797-74536814 | ||
| Hoxd4 | iHoxd4 forward* | AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGACAATAAAGCATCCATAGGCG |
| chr2:74561330-74561353 | ||
| iHoxd4 reverse* | CAAGCAGAAGACGGCATACGATCCAGTGGAATTGGGTGGGAT | |
| chr2:74562171-74562191 | ||
| Hoxc13 | iHoxc13 forward* | AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAGATAATTTTCCTGAGACATTGTAAC |
| chr15:102756108-102756132 | ||
| iHoxc13 reverse* | CAAGCAGAAGACGGCATACGAGCTCAATGTTCCCTTCCCTAACG | |
| chr15:102755251-102755273 | ||
| Hoxb13 | iHoxb13 forward* | AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGACTGTTCCTCGGGGCTAT |
| chr11:96057673-96057692 | ||
| iHoxb13 reverse* | CAAGCAGAAGACGGCATACGAATCTGGCGTTCAGAGAGGCT | |
| chr11:96057448-96057467 | ||
| Hoxb9 | iHoxb9 forward* | AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGATTGAGGAGTCTGGCCACTT |
| chr11:96136070-96136091 | ||
| iHoxb9 reverse* | CAAGCAGAAGACGGCATACGATCATCAAACCAAGCAGGGCA | |
| chr11:96136671-96136690 | ||
| Hoxa13 | iHoxa13 forward* | AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAACACTTGCACAACCAGAAATGC |
| chr6:52212211-52212232 | ||
| iHoxa13 reverse* | CAAGCAGAAGACGGCATACGAGGCGAGGCTCAGGCTTTTAT | |
| chr6:52212476-52212495 | ||
| CNS(39) | iCNS(39) forward† | AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTATCCAAGGAGAAAGGTGTTGGTC |
| chr2:74975258-74975279 | ||
| iCNS(39) reverse† | CAAGCAGAAGACGGCATACGACAGGGCGTTGGGTCACTCT | |
| chr2:74975670-74975687 |
-
Location of primers according to NCBI37 (mm9).
-
*
Primers from Noordermeer D, Leleu M, Splinter E, Rougemont J, De Laat W, Duboule D. 2011. The dynamic architecture of Hox gene clusters. Science 334:222–225.
-
†
Primers from Andrey G, Montavon T, Mascrez B, Gonzalez F, Noordermeer D, Leleu M, Trono D, Spitz F, Duboule D. 2013. A switch between topological domains underlies HoxD genes collinearity in mouse limbs. Science 340:1234167.
Table 3
RT-qPCR primer sequences
| Fragment | Primer | Sequence |
|---|---|---|
| mRNA | mRNA Tubb2c forward* | GCAGTGCGGCAACCAGAT chr2:25080064-25080081 |
| Tubb2c | mRNA Tubb2c reverse* | AGTGGGATCAATGCCATGCT chr2:25079711-25079730 |
| mRNA | mRNA Tbp forward* | TTGACCTAAAGACCATTGCACTTC chr17:15644342-15644365 |
| Tbp | mRNA Tbp reverse* | TTCTCATGATGACTGCAGCAAA chr17:15650497-15650518 |
| mRNA | mRNA Hoxd13 forward* | GGTGTACTGTGCCAAGGATCAG chr2:74507077-74507098 |
| Hoxd13 | mRNA Hoxd13 reverse* | TTAAAGCCACATCCTGGAAAGG over intron boundry |
| mRNA | mRNA Hoxd9 forward* | GCAGCAACTTGACCCAAACA over intron boundry |
| Hoxd9 | mRNA Hoxd9 reverse* | GGTGTAGGGACAGCGCTTTTT chr2:74537278-74537298 |
| mRNA | mRNA Hoxd4 forward | TCAAGCAGCCCGCTGTGGTC chr2:74565709-74565728 |
| Hoxd4 | mRNA Hoxd4 reverse | TCTGGTGTAGGCCGTCCGGG chr2:74566355-74566374 |
| mRNA | mRNA Hoxb13 forward | GTCCATTCTGGAAAGCAG chr11:96056334-96056351 |
| Hoxb13 | mRNA Hoxb13 reverse | AAACTTGTTGGCTGCATACT chr11:96057389-96057408 |
| mRNA | mRNA Hoxb9 forward | GGCAGGGAGGCTGTCCTGTCT chr11:96133282-96133302 |
| Hoxb9 | mRNA Hoxb9 reverse | GCCAGTTGGCAGAGGGGTTGG chr11:96135938-96135958 |
-
Location of primers according to NCBI37 (mm9).
-
*
Primers from Montavon T, Le Garrec JF, Kerszberg M, Duboule D. 2008. Modeling Hox gene regulation in digits: reverse collinearity and the molecular origin of thumbness. Genes Dev 22:346–359.
Author response table 1
| View point | ES rep 1 vs FB rep 1 | ES rep 2 vs FB rep 1 | ES rep 1 vs FB rep 2 | ES all vs FB all | ES rep 1 vs ES rep 2 | FB rep 1 vs FB rep 2 |
|---|---|---|---|---|---|---|
| Hoxd13 | 9.92E - 21 | 1.70E - 11 | 7.63E - 08 | 2.21E - 34 | 0.59 | 1.09E - 04 |
| Hoxd9 | 3.02E - 02 | 0.36 | 0.91 | 2.61E - 03 | 0.90 | 0.27 |
| Hoxd4 | 1.90E - 09 | 0.015 | 0.014 | 1.36E - 11 | 0.78 | 0.11 |
| Hoxb13 | 1.37E - 04 | 7.65E - 03 | 0.010 | 4.42E - 14 | 0.037 | 0.51 |
| Hoxb9 | 2.75E - 07 | 0.019 | 0.012 | 2.21E - 09 | 0.20 | 0.25 |
-
p-values of difference in distribution between replicate samples. ES: ES cells, FB: forebrain.
