A receptor-like kinase mutant with absent endodermal diffusion barrier displays selective nutrient homeostasis defects
- University of Lausanne, Switzerland
- CNRS/INRA/SupAgro/Université Montpellier, France
- Hokkaido University, Japan
- University of Aberdeen, United Kingdom
Figures
Figure 1 with 2 supplements
SGN3 receptor-like kinase is important to establish a functional endodermal barrier.
(A) Lack of endodermal diffusion barrier in sgn3-3 visualized by presence of propidium iodide (PI) in stele. (B) Diagram of the SGN3 protein showing the different domains, T-DNA insertion lines …
-
Figure 1—source data 1
Detail of SGN3 T-DNA and EMS mutants.
Detail of SGN3 mutations. sgn3-1 EMS mutant was lost during the screen and is not available anymore.
- https://doi.org/10.7554/eLife.03115.004
Figure 1—figure supplement 1
Both Casparian strip domain and Casparian strip but not the suberin are affected in sgn3.
(A) Lack of endodermal diffusion barrier in sgn3-3 and sgn3-4 visualized by free diffusion of propidium iodide (PI) into stele. (B) Surface view of Casparian strips by autofluorescence after …
Figure 1—figure supplement 2
Diagram of SGN3 genomic DNA with T-DNA and EMS mutants.
Schematic of SGN3 genomic region showing the insertions sites of the three T-DNA mutants and the EMS mutants. sgn3-2 was found in a forward genetic, GUS-based screen (Alassimone et al., …
Figure 2 with 3 supplements
SGN3 localizes on both sides of the Casparian strip domain and is important for the CASP1-GFP patches to fuse into a contiguous band.
(A) 3D-confocal time lapse imaging of CASP1::CASP1-GFP in Col-0 and sgn3-3 background reveals problems with progression of CASP1-GFP localization in sgn3-3. Images show median and surface image of …
Figure 2—figure supplement 1
Plasma membrane-to-cell wall attachment remains intact in sgn3 upon plasmolysis.
The CSD highlighted by CASP1-GFP is still attached to the cell wall in sgn3-3 upon plasmolysis. Localization of the generic plasma membrane marker Cit-SYP122 expressed under CASP1 promoter in water …
Figure 2—figure supplement 2
SGN3 genomic construct and sgn3 PI phenotype complementation.
(A) C-terminal mVenus fusion with a 9.4-Kb genomic fragment including intron, 5′UTR, and the upstream neighboring gene used to complement sgn3. (B) Complementation of the sgn3-3 PI phenotype in two …
Figure 2—figure supplement 3
Schematic illustrating quantification of onset of expression along the root.
Counting in Figure 2C (‘cells after the onset of elongation’) was done as described in Alassimone et al. (2010). The onset of elongation was determined as the point where an endodermal cell in a …
Figure 3
Relations between sgn3 and molecular players in Casparian strip formation.
(A) ESB1-mCherry localizes to the CASP1-GFP microdomains in sgn3. ESB1-mCherry and CASP1-GFP are expressed under their own promoters. Pictures are maximum projections of confocal z-stacks. (B) …
Figure 4 with 1 supplement
sgn3 is sensitive to environmental conditions and displays an altered water transport and root pressure.
(A) Phenotype of 3-week-old WT, sgn3-3, and sgn3-4 plants grown at 22 or 24°C in long days. Representative pictures are presented. (B) Analysis of shoots fresh weight of WT, sgn3-3, and sgn3-4 …
Figure 4—figure supplement 1
Impact of environmental conditions on growth of sgn3 mutant.
Growth conditions considered as ‘standard condition’ are: temperature 21°C, day length 16 hr, and light intensity of 150 μE. Modification of one of those parameters is indicated, the other …
Figure 5 with 1 supplement
Potassium homeostasis is affected in sgn3.
(A) Expression of genes upregulated in 4 week-old sgn3 leaves. The seven genes presented here are the ones whose expression level was significantly increased in sgn3 (p < 0.15). Those genes were …
-
Figure 5—source data 1
Transcriptional differences between wild type and sgn3 shoots.
Genes affected in sgn3-3 transcriptomic analysis in leaves (p < 0.15) and responses of those genes to abiotic stress. Fold change and p-value marked by asterisk were obtained in Genevestigator for K starvation, drought, nitrate starvation, Fe deficiency, S deficiency, P deficiency, and salt (Hruz et al., 2008).
- https://doi.org/10.7554/eLife.03115.015
-
Figure 5—source data 2
Overview of ionomic experiments.
Ionomic analysis performed on sgn3 leaves (sgn3-3, sgn3-4, and sgn3-19 T-DNA insertion lines) in three different labs (Hokkaido, Lausanne and Aberdeen), two growth systems (hydroponic and soil) and two growth conditions (short days and long days). Values are presented as mean ± SD. t-tests were performed to determine the significant differences to WT (corresponding p-values are indicated).
- https://doi.org/10.7554/eLife.03115.016
Figure 5—figure supplement 1
Ionomic comparision of WT and sgn3 grown under low potassium.
Ionomic analysis performed on WT, sgn3-3, and sgn3-4 plants grown in a poor gravel-like substrate and watered from germination with a nutritive solution with potassium (+K) or without (−K). The …
Tables
Table 1
Details of knockout mutants
| Gene number | Accession | Mutant number | Mutant name | Genotyping primer sequence | References |
|---|---|---|---|---|---|
| AT4G20140 | Col-0 | SALK_043282 | sgn3-3 | LP: ATTCTACGAGCCTTCCCATTC RP: CGCAGTGAACACAGTGAGATC | Present work |
| AT4G20140 | Col-0 | SALK_064029 | sgn3-4 or gso1-1 | LP: CTCGGCTCCCTCGTTAATATC RP: GTTACCTAAACTGGCGGGAAG | Tsuwamoto et al. (2008) The Plant Journal |
| AT4G20140 | Col-0 | SALK_103965 | sgn3-19 | LP: TCCATTATGTGGTTCGAGCTC RP: CTTGTAAACCTTCCCAGAGCC | Present work |
| AT2G28670 | Col-0 | n.a. | esb1-1 | n.a. | Baxter I et al. (2009) PLOS Genet, Lahner B et al. (2003) Nat Biotechnol |
| AT2G36100 | Col-0 | SAIL_265_H05 | casp1-1 | LP: GCGTTTCAGTACGTCCCTTC RP: CACGTGAGGGAAGTGAGTCTC | Roppolo et al. (2011) Nature |
| AT2G27370 | Col-0 | SALK_011092 | casp3-1 | LP: GACTCTTCCTTTCTTCACTC RP: GACCAACACAACCGTACGAAC | Roppolo et al. (2011) Nature |
