1. Biochemistry and Chemical Biology
Download icon

Prediction and characterization of enzymatic activities guided by sequence similarity and genome neighborhood networks

  1. Suwen Zhao
  2. Ayano Sakai
  3. Xinshuai Zhang
  4. Matthew W Vetting
  5. Ritesh Kumar
  6. Brandan Hillerich
  7. Brian San Francisco
  8. Jose Solbiati
  9. Adam Steves
  10. Shoshana Brown
  11. Eyal Akiva
  12. Alan Barber
  13. Ronald D Seidel
  14. Patricia C Babbitt
  15. Steven C Almo  Is a corresponding author
  16. John A Gerlt  Is a corresponding author
  17. Matthew P Jacobson  Is a corresponding author
  1. University of California, San Francisco, United States
  2. University of Illinois at Urbana-Champaign, United States
  3. Albert Einstein College of Medicine, United States
Research Article
Cite this article as: eLife 2014;3:e03275 doi: 10.7554/eLife.03275
10 figures, 11 tables and 13 data sets

Figures

The reactions catalyzed by proline racemase (ProR), 4R-hydroxyproline 2-epimerase (4HypE), and trans-3-hydroxy-L-proline dehydratase (t3HypD) and the metabolic pathways in which they participate.

cHyp oxidase, Pyr4H2C deaminase, a-KGSA dehydrogenase, and ?1-Pyr2C reductase belong to the D-amino acid oxidase (DAAO), dihydrodipicolinate synthase (DHDPS), aldehyde dehydrogenase, and ornithine cyclodeaminase (OCD) (or malate/L-lactate dehydrogenase 2 [MLD2]) superfamilies, respectively. Abbreviations: L-Pro: L-proline; D-Pro: D-proline; 5-AV: 5-aminovalerate; t4Hyp: trans-4-hydroxy-L-proline; c4Hyp: cis-4-hydroxy-D-proline; Pyr4H2C: ?1-pyrroline 4-hydroxy 2-carboxylate; a-KGSA: a-ketoglutarate semialdehyde; a-KG: a-ketoglutarate; t3Hyp: trans-3-hyroxy-L-proline; ?2-Pyr2C: ?2-pyrroline 2-carboxylate; ?1-Pyr2C: ?1-pyrroline 2-carboxylate.

https://doi.org/10.7554/eLife.03275.003
Sequence similarity networks (SSNs) for the PRS.

(A) The SSN displayed with an e-value threshold of 10-55 (~35% sequence identity). (B) The SSN displayed with an e-value threshold of 10-110 (~60% sequence identity).

https://doi.org/10.7554/eLife.03275.004
The genome neighborhood network (GGN) for the PRS.

(A) The GNN displayed with an e-value threshold of 10-20. The nodes are colored by the color of query nodes in the SSN (Figure 2A). The clusters are labeled with the UniProtKB/TrEMBL annotations. (B–I) Selected superfamily clusters from the GNN showing node colors. (B) D-proline reductase PrdA. (C) D-proline reductase, PrdB. (D) D-amino acid oxidase (DAAO). (E) Dihydrodipicolinate synthase (DHDPS). (F) Aldehyde dehydrogenase. (G) Ornithine cyclodeaminase (OCD). (H) Malate/L-lactate dehydrogenase 2 (MLD2). (I) Proline racemase.

https://doi.org/10.7554/eLife.03275.005
Library of proline and proline betaine derivatives tested for ESI-MS screening.

These substrates were divided into four groups to avoid mass duplication.

https://doi.org/10.7554/eLife.03275.006
Structures of members of the PRS.

(A) Structure of Q4KGU2 (locus tag: PFL_1412; cluster 2) with PYC illustrating the utilization of the carboxyl group to bridge the N-terminal amide backbone groups of two opposing a-helices. While In B9K4G4 (D) and B9JQV3 (C) the relative positions of residues that coordinate the prolyl nitrogen (Asp 232, His 90) are conserved His 90 is replaced by a Ser. (B) Structure of Q4KGU2 with t4Hyp illustrating the interactions Q4KGU2 with the 4-hydroxyl group and the relative positions of the two catalytic cysteine residues. (C) Structure of B9JQV3 (locus tag: Avi_0518, cluster 9) with t4Hyp illustrating the interactions of B9JQV3 with the 4-hydroxyl group of t4Hyp and the relative positions of the catalytic Ser (Ser 93, trans?cis) and Cys (Cys 236, cis?trans). (D) Structure of B9K4G4 (Avi_7022, cluster 3) with PYC illustrating the position of the catalytic Ser (Ser 90, dehydration), and the non-catalytic orientation of Thr 256 which replaces the Cys observed in Cys/Cys containing PRS members. In addition, the catalytic Ser (Ser 90) is positioned by hydrogen bonding interactions between the side chain of Asn 93 (shown) and the backbone nitrogen of Asn 93 (not shown). Based on this work, all ProR family members with a catalytic Ser at this position (including B9JQV3, determined here) are proposed to have this motif.

https://doi.org/10.7554/eLife.03275.012
Sequence divergent members of the ornithine cyclodeaminase superfamily (OCDS) have been the assigned novel pyrroline-2-carboxylate reductase (Pyr2C reductase) function in this work.

(A) The OCDS SSN displayed at the e-value cutoff 10-45 (~35% sequence identity). The Pyr2C reductase function is located in four clusters; these proteins are shown in large colored circles, labeled from 1 to 16, and color-coded by the colors of the PRS query sequences shown in Figure 2B. Proteins representing several previously characterized functions in the OCDS are shown by large diamonds, with borders in hotpink (L-alanine dehydrogenase [Schröder et al., 2004]), brown (ornithine cyclodeaminase [Goodman et al., 2004]), magenta (lysine cyclodeaminase [Gatto et al., 2006]), red (ketamine reductase [Hallen et al., 2011]), green (L-arginine dehydrogenase [Li and Lu, 2009]) and palegreen (tauropine dehydrogenase [Kan-No et al., 2005; Plese et al., 2008]), respectively. Their annotations are shown in italics. The diamonds with blue and olive borders are Pyr2C reductases recently characterized by Watanabe et al. (2014). (B) Kinetics data for the Pyr2C reductase activity for the 16 members of the OCDS shown in panel A using NADPH as the cosubstrate.

https://doi.org/10.7554/eLife.03275.014
Mapping members of GNN clusters back to the SSN for the PRS.

(A) SSN for the PRS with cluster numbers. (B) D-amino acid oxidase (DAAO). (C) Dihydrodipicolinate synthase (DHDPS). (D) Aldehyde dehydrogenase. (E) Ornithine cyclodeaminase (OCD). (F) Malate/L-lactate dehydrogenase 2 (MLD2). (G) The color scheme for B–F.

https://doi.org/10.7554/eLife.03275.016
Experimentally characterized enzymes reported by Swiss-Prot (small colored circles) and newly characterized in this work (large colored circles).

Colors match the color scheme in Figure 2B.

https://doi.org/10.7554/eLife.03275.017
Demonstration of the 4HypE, 3HypE, and t3HypD reactions by 1H NMR.

(A) 1H NMR spectra of the 4Hyp substrate mixture in 25 mM Na+-phosphate buffer, pD 8, in D2O (top) and 4Hyp mixture with A3QFI1 (cluster 1, blue) showing 4Hyp epimerization (bottom). The red arrow indicates the proton at C2 for epimerization. The enzyme was stored in glycerol, so the spectra show resonances for glycerol between 3.4 and 3.7 ppm. (B) 1H NMR spectra of the t3Hyp substrate mixture in 25 mM Na+-phosphate buffer, pD 8, in D2O (top), t3Hyp mixture with D0B556 (cluster 3, light sky blue) showing 3Hyp epimerization (middle), and t3Hyp mixture with B9K4G4 (cluster 3, light sky blue) showing t3Hyp dehydration (bottom). The red arrow indicates the proton at C2 for epimerization; the green arrow indicates the proton at C3 for dehydration.

https://doi.org/10.7554/eLife.03275.018
Representative 1H NMR spectra for ?1-pyrroline-2-carboxylate (?1-Pyr2C) reductase activity.

(A) 1H NMR spectrum of ?1-Pyr2C substrate in sodium phosphate, pD 8.0, in D2O. (B) 1H NMR spectrum of Q7CVK1 (locus tag: Atu4676) incubated with ?1-Pyr2C, NADPH, and the cofactor regeneration system of alcohol dehydrogenase (NADP+-dependent) and isopropanol in sodium phosphate, pD 8.0 in D2O. (C) 1H NMR spectrum of L-proline in 25 mM sodium phosphate, pD 8.0, in D2O.

https://doi.org/10.7554/eLife.03275.019

Tables

Table 1

Mass spectroscopy screening results in D2O. Hits were observed by mass shift for racemization/epimerization (+1) and dehydration (-17) for reactions performed

https://doi.org/10.7554/eLife.03275.007
Locus tagUniProtL-ProD-Prot4Hypc4Hypt3Hypcis-3-OH-L-Pro
Cluster 1: blue
Pden_4859A3QFI100+1+100
Shew_2363A9AQW900+1+100
Bmul_5265A6WXX700+1+1+1+1
Oant_1111D2QN4400+1+1+1+1
Slin_1478B9JHU600+1+1+1+1
Arad_8151Q8FYS000+1+100
BR1792A1BBM500+ 1+1+1+1
Cluster 2: red
A1S_1325A3M4A900+1+1+1+1
Bamb_3550Q0B9R900+1+1+1+1
BceJ2315_47180B4EHE600+1+1+1+1
BMULJ_04062B3D6W200+1+1+1+1
BTH_II2067Q2T3J400+1+1-170
CV_2826Q7NU7700+1+1+1+1
Csal_2705Q1QU0600+1+100
PFL_1412A5VZY600+1+1+1+1
Pput_1285Q1QBF3+1+1+1+1+1+1
Pcryo_1219A3M4A900+1+1+1+1
XCC2415Q8P83300+1+1+1+1
Bmul_4447A9AL5200+1+1+1+1
ABAYE2385B0VB4400+1+1+1+1
BURPS1106B_1521C5ZMD2+1+1+1+1+1+1
BURPS1710b_A1887Q3JHA900+1+1+1+1
PA1268Q9I47600+1+100
Cluster 3: ligthskyblue
Pden_1184A1B1950000-170
SIAM614_28502A0NXQ90000-170
Atu4684A9CH0100+1+1-170
Avi_7022B9K4G40000-170
Oant_0439A6WW1600+1+100
SM_b20270Q92WR900+1+1-170
BMEI1586Q8YFD600+1+1+1+1
BR0337Q8G2I30000-170
Cluster 5: navy
BC_0905Q81HB100+1+1-170
BCE_0994Q73CS000+1+1-170
BT9727_0799Q6HMS900+1+1-170
Cluster 9: orange
Avi_0518B9JQV300+1+1+1+1
Atu0398A9CKB400+1+1+1+1
RHE_CH00452Q2KD1300+1+1+1+1
Arad_0731B9J8G800+1+1+1+1
Cluster 11: palegreen
Sros_6004D2AV8700+1+100
Cluster 12: olive
Bamb_3769Q0B9500000-170
Bmul_4260A9AKG800+1+1+1+1
Cluster 16: salmon
Csal_2339Q1QV1900+1+100
Maqu_2141A1U2K1000000
Cluster 17: lime
Rsph17029_3164A3PPJ800+1+100
RSP_3519Q3IWG200+1+100
Cluster 18: cyan
SIAM614_28492A0NXQ700+1+100
SADFL11_2813B9R4E300+1+100
SPOA0266Q5LKW300+1+1+1+1
Cluster 22: steelblue
Spea_1705A8H3920000-170
Swoo_2821B1KJ7600+1+1-170
Cluster 61:
Plim_2713D5SQS400+1+1+1+1
Table 2

Kinetic constants for 3/4HypE and t3HypD activities of the screened PRS targets

https://doi.org/10.7554/eLife.03275.008
ClusterLocus tagUniProtFunctionkcat [s-1]Km [mM]kcat/KM[M-1s-1]
1Pden_4859A1BBM54HypE16 ± 225 ± 5630
Shew_2363A3QFI14HypE50 ± 612 ± 34000
Bmul_5265A9AQW93HypE0.34 ± 0.03- a- a
4HypE5.6 ± 0.511 ± 2530
Oant_1111A6WXX73HypE2.4 ± 0.231 ± 777
4HypE89 ± 27.1 ± 0.613000
2BTH_II2067Q2T3J4t3HypD17 ± 326 ± 9660
4HypE40 ± 41.4 ± 0.428000
CV_2826Q7NU773HypE30 ± 0.657 ± 4520
4HypE70 ± 76.8 ± 310000
Pput_1285A5VZY63HypE4.8 ± 0.619 ± 5250
4HypE26 ± 0.70.54 ± 0.0848000
ProR2.8 ± 0.1200 ± 2014
XCC2415Q8P8334HypE28 ± 0.40.67 ± 0.0542000
3HypE1.3 ± 0.0715 ± 386
3Pden_1184A1B195t3HypDnd bnd bnd b
SIAM614_28502A0NXQ9t3HypD15 ± 0.97.8 ± 11900
Atu4684A9CH01t3HypD27 ± 14.2 ± 0.86300
4HypE0.40 ± 0.022.0 ± 0.3200
Avi_7022B9K4G4t3HypD4.3 ± 0.415 ± 3280
Oant_0439A6WW164HypE0.064 ± 0.0021.3 ± 0.249
SM_b20270Q92WR9t3HypD7.9 ± 0.23.8 ± 0.42100
4HypE0.089 ± 0.016.3 ± 214
BMEI1586D0B5563HypE0.085 ± 0.0032.6 ± 0.433
4HypE0.082 ± 0.0054.5 ± 118
BR0337Q8G2I3t3HypD17 ± 25.1 ± 23300
5BCE_0994Q73CS0t3HypDnd bnd bnd b
4HypE1.2 ± 0.033.2 ± 0.3370
BT9727_0799Q6HMS9t3HypD23 ± 57.5 ± 33100
4HypE0.16- a- a
9Avi_0518B9JQV33HypE0.75 ± 0.044.8 ± 0.9160
4HypE1.3 ± 0.075.6 ± 0.5230
Atu0398A9CKB43HypE4.0 ± 0.625 ± 7160
4HypE0.86 ± 0.14.6 ± 2190
RHE_CH00452Q2KD133HypE0.94 ± 0.062.1 ± 0.7450
4HypE1.9 ± 0.082.1 ± 0.3880
11Sros_6004D2AV874HypE14 ± 0.87.8 ± 11800
12Bamb_3769Q0B950t3HypD43 ± 413 ± 33400
Bmul_4260A9AKG83HypE30 ± 118 ± 21700
4HypE1.3 ± 0.042.7 ± 0.3470
16Csal_2339Q1QV194HypE0.070 ± 0.0052.5 ± 0.728
17RSP_3519Q3IWG24HypEnd bnd bnd b
Rsph17029_3164A3PPJ84HypEnd bnd bnd b
18SIAM614_28492A0NXQ74HypE55 ± 33.2 ± 0.517000
SADFL11_2813B9R4E34HypE67 ± 54.1 ± 0.816000
22Spea_1705A8H392t3HypD0.15 ± 0.03- b- b
Swoo_2821B1KJ76t3HypD4.1 ± 0.46.7 ± 2600
  1. a

    The reaction is to slow to measure Km.

  2. b

    The reaction is slow to measure kinetic parameters.

Table 3

Growth phenotypes of bacterial strains when grown on the indicated carbon sources

https://doi.org/10.7554/eLife.03275.009
Organismt4Hypc4Hypt3Hypcis-3-OH-L-prolineL-ProD-glucose
Agrobacterium tumefaciens C58+++++-++++++
Sinorhizobium meliloti 1021+++++-++++++
Labrenzia aggregate IAM12614++++++++++
Pseudomonas aeruginosa PAO1+++++-++++++
Paracoccus denitrificans PD1222++++++++++++++
Rhodobacter sphaeroides 2.4.1++--++++++
Rhodobacter sphaeroides 2.4.1?RSP3519-+--++++++
Bacillus cereus ATCC14579++++++++++++
Roseovarius nubinhibens ISM+++++-++++++
Escherichia coli MG1655----++++++
Streptomyces lividans TK24++++++ND++++++
  1. ‘+++’ represents robust growth (like growth on D-glucose); ++/+ represents slow growth phenotype; ‘--’ represents growth-deficient phenotype; ‘ND’, not determined

Table 4

Transcriptional analysis of PRS members

https://doi.org/10.7554/eLife.03275.010
Organism/Locus Tagt4Hypt3Hyp
Agrobacterium tumefaciens C58
A9CKB412 ± 211 ± 1.5
A9CFV03 ± 1NC
A9CH0164 ± 532 ± 4
Sinorhizobium meliloti 1021
Q92WS15 ± 13 ± 1
Q92WR95.5 ± 1.53.5 ± 1
Labrenzia aggregate IAM12614
A0NXQ722 ± 25 ± 1
A0NXQ912 ± 26 ± 2
Pseudomonas aeruginosa PAO1
Q9I4898 ± 25 ± 1
Q9I47635 ± 37 ± 2
Paracoccus denitrificans PD1222
A1B0W22.0 ± 0.5NC
A1B195NCNC
A1B7P4NCNC
A1BBM54.5 ± 0.5NC
Rhodobacter sphaeroides 2.4.1
Q3IWG210 ± 1NC
Bacillus cereus ATCC14579
Q81HB14 ± 14.5 ± 1
Q81CD722 ± 218 ± 3
Roseovarius nubinhibens ISM
A3SLP212 ± 24+1.5
  1. Fold change in expression for each gene when grown on the indicated carbon source, relative to growth on D-glucose. The identities of the bacterial species and the protein encoded by each gene are indicated. Fold-changes are the averages of five biological replicates with standard deviation (p value < 0.005). NC, no change.

Table 5

Transcriptional analysis of genome neighborhoods

https://doi.org/10.7554/eLife.03275.011
Organism/Locus tagUniProtEnzymeClustert4Hypt3HypL-Pro
Bacillus cereus ATCC 14579
Bc_0905Q81HB1ProRnavy121 ± 1187 ± 10NC
Bc_0906Q81HB0OCD20 ± 314 ± 2NC
Bc_2832Q81CE0ALDH630 ± 39625 ± 5713 ± 2
Bc_2833Q81CD9DHDPS644 ± 61498 ± 376 ± 0.7
Bc_2834Q81CD8ProRhot pink594 ± 27485 ± 298 ± 1
Bc_2835Q81CD7ProRteal408 ± 15567 ± 335 ± 0.5
Bc_2836Q81CD6oxidase623 ± 37633 ± 4210 ± 0.6
Streptomyces lividans TK24
SSPG_01342D6EJL0DAAO81 ± 520 ± 5NC
SSPG_01341D6EJK9oxidase65 ± 96 ± 0.2NC
SSPG_01340D6EJK8oxidase225 ± 2230 ± 33 ± 0.4
SSPG_01339D6EJK7DHDPS136 ± 516 ± 0.2NC
SSPG_01338D6EJK6ProRpalegreen171 ± 823 ± 13 ± 0.2
Agrobacterium tumefaciens C58
Atu_0398A9CKB4ProRorange14 ± 0.416 ± 0.6NC
Atu_3947Q7CTP1DAAONC4 ± 0.2NC
Atu_3948Q7CTP2AlaRNCNCNC
Atu_3949Q7CTP3OCDNCNCNC
Atu_3950Q7CTP4ALDHNCNCNC
Atu_3951A9CFU8LysRNCNCNC
Atu_3952A9CFU9DAAONCNCNC
Atu_3953Q7CFV0ProRblueNCNCNC
Atu_3958Q7CTQ2DAAONCNCNC
Atu_3959Q7CTQ3ALDHNCNCNC
Atu_3960A9CFV4DHDPSNCNCNC
Atu_3961Q7CTQ5GntRNCNCNC
Atu_3985A9CFW8ProCNCNCNC
Atu_4675A9CGZ4DHDPS148 ± 287 ± 7NC
Atu_4676Q7CVK1MLD230 ± 540 ± 7NC
Atu_4678A9CGZ5SBP198 ± 1879 ± 8NC
Atu_4682A9CGZ9DAAO294 ± 1514 ± 3NC
Atu_4684A9CH01ProRlight sky blue116 ± 148 ± 1NC
Atu_4691A9CH042-Hacid_dhNCNCNC
  1. Fold changes in expression for the indicated gene when grown on the indicated carbon source, relative to growth on Dglucose. Fold changes are the averages of three biological replicates with standard deviation. NC, no change.

Table 6

Data Collection and Refinement Statisticsa

https://doi.org/10.7554/eLife.03275.013
UNIPROT / CLUSTER / PROTEINA5VZY6 / 2 / Pput_1285A5VZY6 / 2 / Pput_1285Q1QU06 / 2 / Csal_2705Q8P833 / 2 / XCC_2415B3D6W2 / 2 / BMULJ_04062Q4KGU2 / 2 / PFL_1412Q4KGU2 / 2 / PFL_1412A6WW16 / 3 / Oant_0439B9K4G4 / 3 / Avi_7022B9JQV3 / 9 / Avi_0518
OrganismPseudomonas putida F1Pseudomonas putida F1Chromohalobacter salexigens DSM 3043Xanthomonas campestrisBurkholderia multivoransPseudomonas fluorescens Pf-5Pseudomonas fluorescens Pf-5Ochrobacterium anthropiAgrobacterium vitis S4Agrobacterium vitis S4
PDBID4JBD4JD74JCI4JUU4K7X4J9W4J9X4K8L4K7G4LB0
DIFFRACTION DATA STATISTICS
Space GroupI2P212121P212121P212121I4122P21P212121I222P43212P42212
Unit Cell (Å , °)a=45.2 b=54.2 c=142.7a=64.8 b=96.8 c=109.2a=48.1 b=54.4 c=253.0a=54.9 b=108.8 c=116.2a=114.9 b=114.9 c=173.7a=56.2 b=74.6 c=87.1 β=105.5a=64.8 b=96.8 c=109.2a=77.3 b=78.3 c=114.4a=54.9 b=108.8 c=116.2a=178.0 b=178.0 c=49.7
Resolution (Å)1.3 (1.3-1.32)1.5 (1.5-1.58)1.7 (1.7-1.79)1.75 (1.75-1.84)1.75 (1.75-1.84)1.6 (.6-1.69)1.7 (1.7-1.79)1.9 (1.9-2.0)2.0 (2.0-2.1)1.7 (1.7-1.79)
Completeness (%)99.8 (99.6)99.5 (98.9)97.0 (94.0)99.7 (99.4)100.0 (100.0)99.3 (99.5)99.5 (99.0)99.8 (100.0)100 (100)99.9 (99.9)
Redundancy3.6 (3.5)7.3 (7.1)9.3 (7.8)7.3 (7.1)14.3 (13.5)3.6 (3.5)6.7 (6.0)7.2 (7.3)14.1 (13.2)10.4 (7.9)
Mean(I)/sd(I)7.9 (1.4)18.0 (1.1)17.5 (3.3)18.0 (1.1)14.1 (1.1)6.9 (1.7)11.6 (1.5)6.0 (1.3)11.6 (3.3)18.3 (2.7)
Rsym0.062 (0.735)0.067 (0.707)0.073 (0.644)0.074 (0.725)0.130 (0.699)0.093 (0.434)0.088 (0.531)0.09 (0.594)0.17 (0.836)0.078 (0.745)
REFINEMENT STATISTICS
Resolution (Å)1.3 (1.3-1.31)1.5 (1.5-1.52)1.7 (1.7-1.72)1.75 (1.75-1.77)1.75 (1.75-1.78)1.6 (1.6-1.62)1.7 (1.7-1.72)1.9 (1.9-1.97)2.0 (2.0-2.02)1.7 (1.72-1.70)
Unique reflections827491098887212870700585749074077405276748662887548
Rcryst (%)15.8 (30.4)15.9 (22.6)17.1 (23.7)15.2 (21.5)13.8 (19.7)19.7 (28.8)19.4 (23.5)16.8 (17.6)13.6 (19.5)15.8 (22.9)
Rfree (%, 5% of data)18.4 (31.1)17.5 (25.4)20.5 (26.2)18.4 (26.4)15.6 (18.5)23.2 (33.8)22.5 (27.5)20.7 (21.7)16.6 (22.9)19.2 (27.3)
Residues In Model [Expected]A1-A308 [1-308]A(-5)-A308, D(-3)-D308 [1-308]A(-3)-A169, A171-A309 [1-311]A(-2)-A312, B(-2)-B312 [1-312]A(-3)-A310 [1-311]A1-A310, B1-B310 [1-310]A1-310, B1-310 [1-310]A0-A157, A161-A184, A193-A245, A255-280, A289-A332 [1-343]B5-B342, D(-9)-D342 [1-342]A1-A323, A326-A344, B0-B346 [1-347]
Residues / Waters / Atoms total308 / 453 / 3142626 / 752 / 6225620 / 494 / 5780626 / 596 / 5841314 / 463 / 3223620 / 537 / 5301620 / 630 / 5378305 / 191 / 2824690 / 780 / 6761689 / 701 / 6633
Bfactor Protein/Waters/Ligand17.3 / 31.2 / 21.719.3 / 30.5 / 27.924.8 / 33.6 / -23.9 / 35.2 / 37.315.6 / 34.0 / 30.621.1 / 32.2 / 12.922.9 / 34.0 / 16.331.3 / 37.7 / -24.1 / 37.5 / 15.225.1 / 36.2 / 17.9
LigandCitrateSulfate-Phosphate / UNLPhosphate(PYC) Pyrrole 2-carboxylate(t4Hyp) Trans- 4OH-L-Proline-(PYC) Pyrrole 2-carboxylate(t4Hyp) Trans- 4OH-L-Proline / Acetate
RMSD Bond Lengths (Å) / Angles (°)0.008 / 1.2830.009 / 1.3250.011 / 1.3320.010 / 1.260.009 / 1.2680.006 / 1.0790.006 / 1.0930.011 / 1.3490.011 / 1.3110.010 / 1.320
Ramachandran Favored / Outliers (%)98.7 / 0.096.8 / 0.0098.2 / 0.0099.0 / 0.097.7 / 0.098.7 / 0.098.5 / 0.098.3 / 0.098.0 / 0.398.4 / 0.3
Clashscore b2.32 (99th pctl)3.02 (98th pctl)3.74 (97th pctl)4.14 (97th pctl)3.12 (97th pctl)1.59 (99th pctl)1.82 (99th pctl)6.6 (93rd pctl)2.8 (99th pctl)2.2 (99th pctl)
Overall scoreb1.01 (99th pctl)1.29 (95th pctl)1.16 (99th pctl)1.22 (99th pctl)1.16 (99th pctl)0.97 (100th pctl)0.94 (100th pctl)1.36 (98th pctl)1.08 (100th pctl)1.0 (100th pctl)
  1. a

    Data in parenthesis is for the highest resolution bin

  2. b

    Scores are ranked according to structures of similar resolution as formulated in MOLPROBITY

Table 7

Kinetic constants for the proline ketimine reductases (members of the malate/Llactate dehydrogenase 2 [MLD2] and ornithine cyclodeaminase [OCD] superfamilies) that are in the genome neighborhoods of members of the PRS

https://doi.org/10.7554/eLife.03275.015
ClusterUniProtLocus tagCofactorkcat [s-1]Km [mM]kcat/KM[M-1s-1]
MLD2_PRS_light skyblue (3)Q7CVK1Atu4676NADPH32 ± 10.33 ± 0.0499000
Q9I492PA1252NADPH1.6 ± 0.050.41 ± 0.063900
MLD2_PRS_Red (2)Q4KGT8PFL_1416NADPH20 ± 0.81.1 ± 0.218000
Q0B9S2Bamb_3547NADPH54 ± 139.4 ± 45700
A9ALD3Bmul_4451NADPH33 ± 27.4 ± 14400
MLD2_PRS_indigo (13)Q4KAT3PFL_3547aNADPH--2300b
OCD_PRS_light skyblue (3)A1B196Pden_1185NADPH260 ± 203.1 ± 0.785000
NADH81 ± 2016 ± 65100
A3S939EE36_06353aNADPH6.8 ± 0.71.0 ± 0.36700
A3SU01NAS141_11281aNADPH39 ± 41.2 ± 0.432000
NADH8.2 ± 473 ± 50110
Q16D96RD1_0323aNADPH15 ± 10.27 ± 0.0756000
NADH3.7 ± 0.411 ± 3320
Q5LLV0SPO3821aNADPH130 ± 203.0 ± 0.943000
NADH--840b
Q3IZJ8RSP_0854aNADPH66 ± 40.43 ± 0.09150000
NADH12c--
OCD_PRS_navy (5)Q81HB0BC_0906NADPH15 ± 10.47 ± 0.131000
NADH19 ± 111 ± 21800
Q73CR9BCE_0995NADPH15 ± 11.1 ± 0.313000
NADH2.1 ± 0.37.6 ± 3270
Q6HMS8BT9727_0800NADPH11 ± 13.4 ± 0.93100
NADH2.1 ± 0.418 ± 6120
Q63FA5BCE33L0803NADPH5.8c--
NADH0.87 ± 0.14.9 ± 2180
OCD_PRS_olive (12)Q0B953Bamb_3766NADPH106 ± 41.6 ± 0.264000
NADH41 ± 67.3 ± 35700
Q2T596BTH_II1457aNADPH73 ± 20.39 ± 0.05190000
NADH203 ± 2332 ± 76400
Q3JFG0BURPS1710b_A2543aNADPH7.8 ± 0.50.64 ± 0.112000
NADH6.0 ± 131 ± 13190
A9AKH1Bmul_4263NADPH25 ± 64 ± 26400
OCD_PRS_blue (1)Q485R8CPS_1455NADPH35 ± 0.81.8 ± 0.220000
NADH--170b
A3QH73Shew_2955aNADPH6.7 ± 0.71.6 ± 0.64300
NADH0.37 ± 0.126 ± 1014
  1. a

    Highly homologous to MLD2 or OCD which are in the gene context of proline racemase.

  2. b

    The enzyme didn’t saturate.

  3. c

    KM is too small (< 0.03mM).

Table 8

Strains used in this study

https://doi.org/10.7554/eLife.03275.020
Organism
Agrobacterium tumefaciens C58
Sinorhizobium meliloti 1021
Labrenzia aggregata IAM12614
Pseudomonas aeruginosa PAO1
Paracoccus denitrificans PD1222
Rhodobacter sphaeroides 2.4.1
Rhodobacter sphaeroides 2.4.1?RSP3519
Bacillus cereus ATCC14579
Roseovarius nubinhibens ISM
Escherichia coli MG1655
Streptomyces lividans TK24
Table 9

Oligonucleotide primers used for construction of the RS3519 knock-out in Rhodobacter sphaeroides 2.4.1

https://doi.org/10.7554/eLife.03275.021
OligoSequence (5'–3')
RS3519F.KOCATATGATGCGCGTTCAGGACGTGTATAACG
RS3519R.KOGCTGAGCTCAGAGGACGAGGAAGCCCGCGTCC
Table 10

qRT-PCR primers for transcriptional analysis of individual proline racemase superfamily members

https://doi.org/10.7554/eLife.03275.022
OligoSequence (5'–3')
Atu16s-FGACACGGCCCAAACTCCTAC
Atu16s-RGGGCTTCTTCTCCGACTACC
Atu0398-FTCACCATTGAGAAGGCCAAT
Atu0398-RGGTTGACGAGGTCCTTCAGA
Atu3953-FCAGCTTCAGTGGCATCAGG
Atu3953-RGTGTTGTGCCCAATGATCC
Atu4684-FGAAGAGGCGCATGAGATTG
Atu4684-RCGAAACCCAAAGCCTTGTT
Bc16s-FCTCGTGTCGTGAGATGTTGG
Bc16s-RTGTGTAGCCCAGGTCATAAGG
Bc0905-FCTTCGCTGACGGACAAGTAGA
Bc0905-RTGTACCGCTGTTACGGACAA
Bc2835-FAACAGACCCGTGTCATCCTG
Bc2835-RACTAAGCCAGCCGGTGTATCT
La16s-FTGGTGGGGTAAAGGCCTAC
La16s-RTGGCTGATCATCCTCTCAGAC
La28492-FTGTTGAAGACGAGGCCAAG
La28492-RAAAAGCCGAGCTGTTCGTT
La28502-FCGCGTAATCGACAGCCATA
La28502-RGGCACAGAAATCGAGATGCT
Rs16s-FACACTGGGACTGAGACACGG
Rs16s-RTACACTCGGAATTCCACTCA
Rs3519-FAGGACATCGCCTTCGAACT
Rs3519-RCGATGATGCCGAAATAGTTG
Pa16s-FTCACACTGGAACTGAGACACG
Pa16s-RATCAGGCTTTCGCCCATT
Pa1255-FCCACCCTCTGGGAACAGTC
Pa1255-RTCGTTGAGGACGAAGTTGC
Pa1268-FAACAGTGGCTACCTCGGCA
Pa1268-RTCGCCGACCGGTGTCTCGAT
Rn16s-FATCTGTGTGGGCGCGATT
Rn16s-RGTGAGCGCATTGGTGGTCT
Rn08250-FTATGGCGGCGACAGTTTC
Rn08250-RGACGGCTCGAGCGTAAAC
Pd16s-FGACTGAGACACGGCCCAGA
Pd16s-RTCACCTCTACACTCGGAAT
Pd1045-FTCGGACTACTATGTGCCGATG
Pd1045-RCCTGATCGAGGCCAAAGAC
Pd1184-FGCAATTTCGTGTTGAACGAG
Pd1184-RCATGATGATCCAGCCCATCT
Pd3467-FCTTCGCAGCCCTGTTCAT
Pd3467-RGACCAGCCCTTCCTCGAT
Pd4859-FGGCAAGGTGGACATCGAATA
Pd4859-RCCTCGGGGTAAAGGAAGC
Sm16s-FCGTGGGGAGCAAACAGGATT
Sm16s-RCTAAGGGCGAGGGTTGCGCTC
Sm20268-FCTGGCAAGGTGGACATCAC
Sm20268-RGTAAGGCGCACTTCCTCAA
Sm20270-FCGCCATGTCAATCTCCTGGT
Sm20270-RGGCAGCATCCACGATCACGA
Table 11

qRT-PCR primers for transcriptional analysis of genome neighborhoods

https://doi.org/10.7554/eLife.03275.023
PrimerSequence (5'–3')
Sliv-Sco16srRNA-FCCGTACAATGAGCTGCGATA
Sliv-Sco16srRNA-RGAACTGAGACCGGCTTTTTG
Sliv-Sco6289-FGACCCTGAAGGTCGTCGTC
Sliv-Sco6289-RGGTGACCGTGACGTCCAT
Sliv-Sco6290-FGTCTTCTGCGGCATCGG
Sliv-Sco6290-RAGTCATCGTCGTCCTCCA
Sliv-Sco6291-FGCCGACCTCGACGAAGA
Sliv-Sco6291-RTTGTCGGTTTCACTGCTGTC
Sliv-Sco6292-FCATCGACACCAAGGTGGAC
Sliv-Sco6292-RTGACCCCGACGATGTACC
Sliv-Sco6293-FGACTACGGCGTGCTCTTCAT
Sliv-Sco6293-RCTCGGTGACCTCGACCAT
Bc0905-FCTTCGCTGACGGACAAGTAGA
Bc0905-RTGTACCGCTGTTACGGACAA
Bc0906-FACTACGAACGCAACCACACC
Bc0906-RCGGAACTTGAAGGTCTCCTGT
Bc2832-FTACCAGGCTTTGGTCCTGAA
Bc2832-RATTTGCCGCCAAGCTCTAAC
Bc2833-FGGATGGGTTTCAGTAGCAGGA
Bc2833-RCCTAGTCTTGGATAGCGAGAAGG
Bc2834-FAGGTGCGTATTCGCCAGAAA
Bc2834-RCCTGGCGAACGTACGATAAA
Bc2835-FAACAGACCCGTGTCATCCTG
Bc2835-RACTAAGCCAGCCGGTGTATCT
Bc2836-FCCTTGCATTCTCGCTTCTGT
Bc2836-RAATCTTAGGAGCCCACACACC
Atu3947-FTCCGGCCAAGTATGTGAAAG
Atu3947-RCTATAGCCGTTCGCAGCAAG
Atu3948-FATTTCGCCCGTGATCTGTC
Atu3948-RCGGCATCCACAATAATCCAG
Atu3949-FGCGAACAGGCTGAAGAGATG
Atu3949-RCGGCGGTAATTCCTGTTTG
Atu3950-FGCTGCCGAACATATCAAGGT
Atu3950-RGACCTTCGCGGTTATCTGGT
Atu3951-FTGACGGACTCCAGCCTTATC
Atu3951-RATGTAACATCGGCGTGGTCT
Atu3952-FGATATCGTCAAGGGCGGTTT
Atu3952-RACGCAGAGCCTTCATGTGTT
Atu3953-FCAACGTCGCCAGTTACCTTC
Atu3953-RGGCTGAGATCAACGACATCC
Atu3958-FGGCGGCTGATACACATCTTC
Atu3958-RAAAGTTGGTGCTTCGTCAGG
Atu3959-FCATTCCTGACACGATCCACA
Atu3959-RCAGCATCAGCAAAGGGAAGT
Atu3960-FGAATGTCGTCGCCATCAAG
Atu3960-RTCGTAGAGTGCCACATGCTC
Atu3961-FTTCGGCACTTCTTTCTGGTC
Atu3961-RGCTCGCCTGCAGATAAACA
Atu4675-FTTCCTGTTATCGTCGGCACT
Atu4675-RGCCTTGAAGTGAGCCTTCTG
Atu4676-FACGGCTATCGTGAAGGTCAA
Atu4676-RGAATAGCTCGGGCACATCAC
Atu4682-FTCCTCAGAAAGACCGACACC
Atu4682-RGTGAATGTGCCGCAGGTAA
Atu4684-FCCTCGGCAAACTCAAGGTC
Atu4684-RGCGAAGAGGCAGAAGGAAA
Atu4691-FAAGGGCGATATGGGTCTTTC
Atu4691-RGAGCTCTTCGATGCTGTCGT

Data availability

The following data sets were generated
  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
The following previously published data sets were used
  1. 1
  2. 2
  3. 3
  4. 4

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)