Metagenomic chromosome conformation capture (meta3C) unveils the diversity of chromosome organization in microorganisms
- Institut Pasteur, France
- Centre national de la recherche scientifique, UMR 3525, France
- Max Planck Institute for Dynamics and Self-Organization, Germany
- Laboratoire de physique théorique de la matière condensée, Université Pierre et Marie Curie, France
Figures
Figure 1 with 3 supplements
meta3C experiment on a controlled mix of bacterial species.
(A) Schematic representation of the principle of a meta3C experiment. For a single species, one can (i) generate a genome-wide contact map but also (ii) use the genomic contact data to reorder the …
Figure 1—figure supplement 1
Numbers of intra-specific and inter-specific (chimeric) pairs of reads from the meta3C experiment performed on the bacterial mix.
https://doi.org/10.7554/eLife.03318.004
Figure 1—figure supplement 2
Analysis of the organization of the F’ plasmid in the E. coli strain used in this study.
(A) Frequencies of interaction between the F’ plasmid and the three bacterial genomes. (B) Contact frequencies between the F’ plasmid and the E. coli genome, normalized by the read coverage to take …
Figure 1—figure supplement 3
Pearson correlation matrix of the meta3C bacterial experiment.
https://doi.org/10.7554/eLife.03318.006
Figure 2 with 4 supplements
meta3C experiment on a controlled mix of yeasts species.
(A) meta3C contact map of the mix of eleven species. (B) 2D projection of the 3D reconstruction of the entire meta3C contact matrix. Each genome occupies an isolated position in space (the 2D …
Figure 2—figure supplement 1
Number of intra-specific and inter-specific (chimeric) pairs of reads in the meta3C contact map.
Mitochondrial genomes behaved as separate entities.
Figure 2—figure supplement 2
Contact matrices of the genomes of Y. lipolytica, K. thermotolerans, N. castellii, C. lusitaniae, S. bayanus, C. glabrata, C. albicans, K. lactis, L. kluyveri, and D. hansenii.
https://doi.org/10.7554/eLife.03318.015
Figure 2—figure supplement 3
Scaffolding using GRAAL of N. castellii meta3C contigs.
(A) Comparison between the scaffolds generated by GRAAL and the reference sequences of the N. castellii chromosomes: y-axis: coordinates along the new scaffolds. x-axis: coordinates along the …
Figure 2—figure supplement 4
Scaffolding using GRAAL of S. bayanus meta3C contigs.
(A) Contact map obtained from a draft genome assembly of S. bayanus. (B) Contact map and corresponding 3D structure of the S. bayanus de novo meta3C assembly combined with GRAAL processing. Blue …
Figure 3 with 1 supplement
meta3C analysis of a complex environmental sample.
(A) meta3C contact map of the largest 11 communities of contigs in the matrix before (bottom left) and after (upper right) clustering. Each square corresponds to a community grouping contigs that …
Figure 3—figure supplement 1
MG-RAST analysis of the 11 largest meta3C communities.
The similarity between the sequences present in these communities and those of known species was to annotate them. (A) Homogeneity regarding class-level annotations; (B) homogeneity regarding …
Figure 4
Flowchart representing the computational analysis steps of a meta3C experiment.
First, the reads from the sequenced meta3C library are assembled into contigs. The meta3C contact information between the contigs is then used to generate a network of the contacts of all contigs …
Videos
Animation 1
3D reconstruction of the bacterial meta3C contact matrix.
https://doi.org/10.7554/eLife.03318.007
Animation 2
3D reconstruction of the E. coli genome with a plasmid F’ carrying a 140 kb segmental duplication.
The contacts made by the duplicated region are taken into account. Because of the frequent contacts of one copy of this region with the chromosome and the other copy with the plasmid and of the …
Animation 3
3D reconstruction of the E. coli genome with a plasmid F’.
The contacts made by the 140 kb duplication are not taken into account, so the position of the plasmid depends only on its contacts with the rest of the genome.
Animation 4
3D reconstruction of the B. subtilis genome.
https://doi.org/10.7554/eLife.03318.010
Animation 5
3D reconstruction of the V. cholerae genome.
https://doi.org/10.7554/eLife.03318.011
Animation 6
3D reconstruction of the V. cholerae genome.
The color scale now represents the read coverage along the genome, hence displaying the differential replication timing of the two chromosomes, from early (over-covered) replicated regions (in blue) …
Animation 7
3D reconstruction of the 11 yeasts meta3C contact matrix.
https://doi.org/10.7554/eLife.03318.018
Animation 8
3D reconstruction of the Y. lipolytica genome.
https://doi.org/10.7554/eLife.03318.019
Animation 9
3D reconstruction of the N. castellii genome.
https://doi.org/10.7554/eLife.03318.020
Animation 10
3D reconstruction of the N. castellii genome after meta3C de novo assembly and GRAAL scaffolding.
https://doi.org/10.7554/eLife.03318.021
Animation 11
3D reconstruction of the S. bayanus genome after meta3C de novo assembly and GRAAL scaffolding.
https://doi.org/10.7554/eLife.03318.022
Animation 12
3D reconstruction of a genome closely related to A. veronii.
Blue and black beads: Ter and Ori regions, according to the reference genome of A. veronii.
Tables
Table 1
List of the custom-made Illumina adapters used in this study
| Oligos | Sequence | Library |
|---|---|---|
| MM70 | GTANNNNNNAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG | Mix of 11 yeasts |
| MM71 | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNTACT | |
| MM76 | CAGNNNNNNAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG | Mix of 3 bacteria |
| MM77 | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNCTGT | |
| MM70 | GTANNNNNNAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG | River sediment |
| MM71 | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNTACT |
Table 2
List of the oligonucleotides used to PCR amplify probes for the Southern blot of the PFGE (Figure 1—figure supplement 2)
| Oligos | Sequence | Coordinates | Probe |
|---|---|---|---|
| Meta1 | CATCCCGTGAGAAATAATGGTCG | 2,256,273 (MG1655) | Genomic probe |
| Meta2 | TGTGCATCCCGTCACAAATTC | 2,257,545 (MG1655) | |
| Meta3 | TTGAGCTTATCAAAGTCGTCGGAG | 323,607 (MG1655) | Duplication probe |
| Meta4 | TGATGTGAACTAACGCAGGAAC | 324,796 (MG1655) | |
| Meta5 | TTTACCTCTGATACTGGCTCTGG | 79,024 (plasmid F) | Plasmid F probe |
| Meta6 | ACGTGGCATATTCATGCAGAC | 80,159 (plasmid F) |
