1. Plant Biology
Download icon

Prioritizing plant defence over growth through WRKY regulation facilitates infestation by non-target herbivores

  1. Ran Li
  2. Jin Zhang
  3. Jiancai Li
  4. Guoxin Zhou
  5. Qi Wang
  6. Wenbo Bian
  7. Matthias Erb  Is a corresponding author
  8. Yonggen Lou  Is a corresponding author
  1. Zhejiang University, China
  2. University of Bern, Switzerland
Research Article
  • Cited 50
  • Views 2,823
  • Annotations
Cite this article as: eLife 2015;4:e04805 doi: 10.7554/eLife.04805


Plants generally respond to herbivore attack by increasing resistance and decreasing growth. This prioritization is achieved through the regulation of phytohormonal signaling networks. However, it remains unknown how this prioritization affects resistance against non-target herbivores. In this study, we identify WRKY70 as a specific herbivore-induced, mitogen-activated protein kinase-regulated rice transcription factor that physically interacts with W-box motifs and prioritizes defence over growth by positively regulating jasmonic acid (JA) and negatively regulating gibberellin (GA) biosynthesis upon attack by the chewing herbivore Chilo suppressalis. WRKY70-dependent JA biosynthesis is required for proteinase inhibitor activation and resistance against C. suppressalis. In contrast, WRKY70 induction increases plant susceptibility against the rice brown planthopper Nilaparvata lugens. Experiments with GA-deficient rice lines identify WRKY70-dependent GA signaling as the causal factor in N. lugens susceptibility. Our study shows that prioritizing defence over growth leads to a significant resistance trade-off with important implications for the evolution and agricultural exploitation of plant immunity.


eLife digest

Many different animals feed on plants, including almost half of all known insect species. Some herbivores—like caterpillars for example—feed by chewing. Others, such as aphids and planthoppers, use syringe-like mouthparts to pierce plants and then feed on the fluids within.

To minimize the damage caused by these herbivores, plants activate specific defenses upon attack, including proteins that can inhibit the insect's digestive enzymes. The inhibitors are effective against chewing herbivores but seem to have little or no effect on some insects that feed by the ‘pierce-and-suck’ method.

Investing in defense requires energy, and so plants attacked by herbivores actively slow their growth to meet this demand. Plants achieve this trade-off by changing the levels of different plant hormones. These hormones can control the expression of thousands of genes and have widespread effects throughout the plant. However, little is known about how prioritizing defense overgrowth in response to an attack by one herbivore affects the plant's ability to defend itself against other herbivores.

Transcription factors are proteins that control which genes inside a cell are active or inactive. Li et al. searched for a transcription factor in rice plants that was specifically triggered in response to an attack by the caterpillars of a moth called the rice striped stem borer. This search identified a protein called WRKY70 as a transcription factor that prioritizes defense overgrowth. WRKY70 achieves this by increasing the levels of a defensive plant hormone (called jasmonic acid) while reducing the levels of a growth hormone (called gibberellin). Further experiments show that the increase in jasmonic acid production is required to activate the enzyme inhibitors and for resistance against these caterpillars.

Li et al. then found that increased WRKY70 activity makes rice plants more susceptible to attack by a second herbivore, a piercing-sucking insect called the rice brown planthopper. Further experiments revealed that this is due to the reduced levels of gibberillin. These findings show that while prioritizing defense overgrowth is effective against some insect herbivores, it comes with a cost as it makes the plants more susceptible to attack by other herbivores. This trade-off has important implications for both the evolution of plant immunity, and efforts to exploit plant immunity to help protect crops from herbivore attack.



Plants have developed effective defensive systems to minimize herbivore damage. They can specifically perceive attackers and respond to them by activating defence-related signaling pathways, including mitogen-activated protein kinase (MAPK) cascades and hormone signaling, leading to the induction of numerous defence-related genes and defence compounds as well as plant resistance (Wu and Baldwin, 2010; Bonaventure et al., 2011; Erb et al., 2012). Jasmonic acid (JA)-, salicylic acid (SA)-, and ethylene (ET)-mediated signaling play a central role in induced resistance to herbivores (Lu et al., 2011; Qi et al., 2011).

The induction of defences commonly co-occurs with a reduction of plant growth (Heinrich et al., 2013; Attaran et al., 2014; Huot et al., 2014). Through silencing defence-related genes, a direct negative link between defence and growth was demonstrated (Zavala and Baldwin, 2006; Zhang et al., 2008; Meldau et al., 2012; Yang et al., 2012), suggesting that plants actively prioritize defence over growth. Defence prioritization and the associated growth trade-offs are regulated by crosstalk between plant hormones (Schwachtje et al., 2006; Stanton et al., 2013; Huot et al., 2014). DELLA proteins for instance, which typically suppress gibberellin (GA) signaling, can physically interact with the JA pathway repressor JAZ proteins, thereby resulting in mutual suppression (Hou et al., 2010; Yang et al., 2012). Furthermore, SA has been reported to inhibit the expression of TIR1/ABF F-box genes, thereby leading to stabilization of AUX/IAA repressor proteins and decreasing auxin signaling (Wang et al., 2007). Conversely, auxin signaling can reduce SA biosynthesis and thereby render plants more susceptible to pathogens (Robert–Seilaniantz et al., 2011). Compared to the impact of defence-related hormones, little is known about the impact of growth-related hormones on herbivore resistance and potential resistance trade-offs that may emanate from prioritizing defence over growth through hormonal regulation (Yang et al., 2012).

Transcription factors (TFs) play a potentially important role in herbivore-induced plant reconfiguration and defence prioritization, as they regulate the expression of responses up and downstream of hormonal signaling pathways and thereby influence early and late signaling (Reymond et al., 2004; Dombrecht et al., 2007; Skibbe et al., 2008; Kaur et al., 2010; Lu et al., 2011; Zhou et al., 2011; Schweizer et al., 2013). The best-studied TFs involved in plant–insect interactions are MYCs, WRKYs, MYBs, and ERFs. AtMYC2 in Arabidopsis thaliana, for example, was reported to act downstream of JA and to regulate JA-dependent herbivore resistance (Dombrecht et al., 2007). Moreover, MYC2, MYC3, and MYC4 were shown to regulate the production of toxic glucosinolates via a direct transcriptional activation of glucosinolate biosynthesis genes (Schweizer et al., 2013). In Nicotiana attenuata, a R2R3-type MYB TF (NaMYB8) was found to modulate the accumulation of phenylpropanoid–polyamine conjugates, which are essential for defence against herbivores (Kaur et al., 2010). In rice, an EAR-motif-containing ERF TF (OsERF3) functions as an early component upstream of MAPK signaling and modulates JA, SA, ET, and H2O2 levels as well as plant resistance to rice herbivores (Lu et al., 2011). Also, several WRKYs, such as rice OsWRKY89, wheat TaWRKY53, Arabidopsis AtWRKY72, and tomato SIWRKY70 and SIWRKY72, have been directly associated with defence against herbivores (Wang et al., 2007; Bhattarai et al., 2010; Van Eck et al., 2010; Atamian et al., 2012). NaWRKY3 and NaWRKY6 in N. attenuata have been shown to modulate elicited JA and JA-Ile/-Leu levels and thus mediate herbivory-induced defence responses (Skibbe et al., 2008). Identifying and manipulating TFs that are involved in defence prioritization would make it possible to assess the biological impact of herbivore-induced growth suppression. Yet, to date, such an approach has not been taken. Consequently, our understanding of the consequences of defence prioritization for plant resistance has remained limited.

To dissect the signaling network that underlies growth defence trade-offs in rice, we identified OsWRKY70, an herbivory-induced Group I-type WRKY TF from rice, and elucidated its role in herbivore-induced defence prioritization. Through the use of in vivo and in vitro protein assays, molecular characterization and the creation of transgenic OsWRKY70 silenced and overexpressing plants combined with insect bioassays and a variety of phytohormone analyses, we evaluate the resistance benefits and trade-offs of defence prioritization against different herbivores and thereby reveal a new cost of defence prioritization.


OsWRKY70 is an herbivory-induced, nucleus-localized, auto-regulated W-box transcriptional activator

Using suppressive subtractive hybridization (SSH), we screened rice plants for herbivory-induced TFs. Using this technique, we identified a clone that showed similarity to a WRKY gene. The full-length cDNA of the cloned OsWRKY, including an open reading frame (ORF) of 1719 bp, was obtained by reverse transcription PCR (Figure 1—figure supplement 1). Blast analysis showed that the sequence was 100% identical to the previously identified OsWRKY70 (TIGR ID Os05g39720). OsWRKY70 has two WRKY domains and belongs to group I (Rushton et al., 2010). Phylogenetic analysis of group I-type WRKYs from different species revealed that OsWRKY70 has two homologs in rice, OsWRKY24 and OsWRKY53, which share 53% and 51% amino acid sequence identity (Figure 1—figure supplement 2). Quantitative real-time PCR analysis revealed low constitutive expression of OsWRKY70. Mechanical wounding and infestation by the rice striped stem borer (SSB) Chilo suppressalis resulted in a rapid increase in transcript levels (Figure 1A,B). Infestation by the rice brown planthopper (BPH) Nilaparvata lugens only slightly increased the transcription levels of (Figure 1C). JA or SA treatment did not induce OsWRKY70 (Figure 1D), suggesting that OsWRKY70 is an early regulator of plant responses to herbivores.

Figure 1 with 2 supplements see all
Expression of OsWRKY70 in rice after different treatments.

Mean transcript levels (+SE, n = 3–4) of OsWRKY70 in rice plants that were treated with either rice striped stem borer (SSB) (A), mechanically wounded (B), rice brown planthopper (BPH) (C), jasmonic acid (JA), salicylic acid (SA), or a buffer (50 mM phosphate buffer, pH = 8.0) (Buffer) (D). Controls correspond to non-manipulated plants. Transcript levels were analyzed by QRT-PCR. Asterisks indicate significant differences in transcript levels between treatments and controls (*, p < 0.05; **, p < 0.01; Student's t-test).


To clarify the subcellular localization of OsWRKY70, we constructed an OsWRKY70:GFP fusion gene, driven by a CaMV 35S promoter, and transiently expressed the construct in Nicotiana benthamiana leaves. Fluorescence analysis showed that OsWRKY70 is exclusively localized in the nucleus (Figure 2—figure supplement 1A). To determine the DNA-binding activity of OsWRKY70, a His-tagged protein was produced in Escherichia coli, and its W-box binding ability was examined by electrophoretic mobility shift assays (EMSAs) as described (Chujo et al., 2007). In the presence of the oligonucleotide probe BS65 containing two W-box sequences and a WRKY70 recombinant protein, specific protein-DNA complexes with reduced migration were present in the EMSA assays (Figure 2—figure supplement 1C). The DNA-binding specificity was confirmed in a competition experiment using a 250-fold excess of the unlabeled probe BS65 as a competitor, for which no binding complexes were detected. When the W-box in BS65 was mutated from TTGACC to TCCTAC (mBS65), the binding complexes also disappeared. These results indicated that the recombinant OsWRKY70 protein specifically binds to the conserved W-box in the synthesized probe. To investigate whether OsWRKY70 has transcriptional activation activity, we fused the full-length OsWRKY70 ORF in-frame to the GAL4 DNA-binding domain of the pGBKT7 vector and transformed it into yeast. The yeast transformed with pGBKT7 or pGBKT7-OsWRKY70 was plated on SD medium (−Trp) containing X-α-gal. After 12 hr at 30°C, the pGBKT7-OsWRKY70 transformant yeast colonies turned blue. In contrast, the pGBKT7 empty transformant yeast colonies remained white (Figure 2—figure supplement 1B). OsWRKY70 is therefore likely functioning as a transcriptional activator in the yeast system. We found that the promoter region of WRKY70 contains four W-boxes, three reverse W-boxes (AGTCAA at −82 to −77, AGTCAA at −56 to −51, and GGTCAA at −49 to −44), and one forward W-box (TTGACC at −62 to −57), upstream of the transcription start site (Figure 2—figure supplement 2A). To investigate if WRKY70 regulates its own expression, we first performed an EMSA assay by using the minimal promoter region of WRKY70 (86 bp upstream of transcription start site) as a probe. WRKY70-His can bind to this fragment, while adding 250-fold unlabeled probe resulted in no WRKY70-DNA complex (Figure 2—figure supplement 2B). Using WRKY70 promoter:GUS as a reporter and 35S: WRKY70-GFP, 35S:GFP as effectors expressed transiently in N. benthamiana, we found that WRKY70-GFP significantly increased the GUS activities compared to GFP alone, suggesting that WRKY70 can self-activate its transcription (Figure 2—figure supplement 2C).

OsWRKY70 physically interacts with and is regulated by OsMPK3 and OsMPK6

MAPK proteins can specifically recognize the D domain found in some group I-type WRKYs and specifically phosphorylate the Ser residues of Group I SP clusters (Ishihama et al., 2011; Mao et al., 2011). The D domain is a cluster of basic residues upstream of the LxL motif ([K/R]1–2-x2–6-[L/I]-x-[L/I]) and has been reported in some WRKYs to play an important role in determining the selectivity of interacting MAPKs and phosphorylation patterns (Ishihama et al., 2011). OsWRKY70 has four SP clusters in the N-terminal region (Figure 1—figure supplement 1) but has no D domains. We hypothesized that the D domain-deficient OsWRKY70 may nevertheless interact with the MAPKs, OsMPK3 and OsMPK6, the homologs of AtMPK3 and AtMPK6 in Arabidopsis and WIPK and SIPK in Nicotiana tabacum, respectively, all of which are involved in plant defence responses (Wu et al., 2007; Lu et al., 2011). We used a GST pull-down assay to analyse the interaction between OsWRKY70 and OsMPK3 or OsMPK6 in vitro. OsWRKY70-His was pulled down strongly by GST-MPK3 and mildly by GST-MPK6, suggesting that OsWRKY70 can interact with both OsMPK3 and OsMPK6, with the OsWRKY70–OsMPK3 interaction being more efficient than the OsWRKY70–OsMPK6 interaction in vitro (Figure 2B). In vivo, we used a bimolecular fluorescence complementation (BiFC) assay to confirm the interaction. Fluorescence was observed when nYFP-OsWRKY70 was co-injected with OsMPK3-cYFP or OsMPK6-cYFP, and the signals were in the nuclear compartment according to 4,6-diamidino-2-phenylindole (DAPI) staining. No fluorescence was observed when nYFP-OsWRKY70 was co-expressed with unfused cYFP (Figure 2C). Taken together, these results strongly suggest that OsMPK3 and OsMPK6 physically interact with OsWRKY70. In a next step, we investigated if OsWRKY70 is phosphorylated by OsMPK3 or OsMPK6. We used OsMKK4DD, a constitutively active form of OsMKK4, to activate recombinant OsMPK3 and OsMPK6 and then exposed them to OsWRKY70. The result showed that OsWRKY70 can be phosphorylated by both OsMPK3 and OsMPK6 (Figure 2D). Moreover, an EMSA assay revealed that phosphorylation did not alter the W-box-binding activity of OsWRKY70 (Figure 2E). We also investigated if phosphorylation enhances the transactivation activity of OsWRKY70 using N. benthamiana as a transient expression system (Li et al., 2014). As the constitutive expression of OsMKK4DD induces HR-like cell death in tobacco plants, we used an estradiol-inducible system of OsMKK4DD (Ishihama et al., 2011). Given that OsWRKY70 can auto-activate its promoter (Figure 2—figure supplement 2C), we used WRKY70 promoter:GUS as a reporter and 35S:WRKY70-GFP, 35S:OsMPK3-YFP, 35S:OsMPK6-YFP as effectors (Figure 2F). GUS activity was higher in OsMKK4DD-MPK3-OsWRKY70 or OsMKK4DD-MPK6-OsWRKY70 co-expressed leaves than leaves expressing OsWRKY70 alone (Figure 2E). These results show that phosphorylation of OsWRKY70 can increase transactivation activity, but not W-box binding activity, of OsWRKY70.

Figure 2 with 2 supplements see all
Interactions between OsWRKY70 and OsMPK3/6.

(A) Mean transcript levels (+SE, n = 5) of OsWRKY70 in transgenic lines with silencing of OsMPK3 (irMPK3 lines, irMPK3-53, and irMPK3-183) or OsMPK6 (irMPK6 lines, irMPK6-1, and irMPK6-2) after infested by SSB for 1 hr. (B) In vitro interaction assays between OsWRKY70 and OsMPK3 or OsMPK6. GST, GST-MPK3, and GST-MPK6 purified proteins were incubated with WRKY70-His as indicated. WRKY70-His input and pulled-down fractions were analyzed by immunoblotting using anti-WRKY70 antibody (top). Input proteins were monitored by Coomassie blue staining (bottom). This experiment was repeated 3 times with similar results. (C) In vivo bimolecular fluorescence complementation interaction assays between OsWRKY70 and OsMPK3 or OsMPK6. Fluorescence was observed from complementation of the N-terminal part of the YFP fused with OsWRKY70 (nYFP-OsWRKY70) with OsMPK3 or OsMPK6 fused with the C-terminal part of the YFP (OsMPK3-cYFP or OsMPK6-cYFP) and co-localized with DAPI stains in the nuclear compartment of tobacco leaf cells. No fluorescence was observed when nYFP-OsWRKY70 was co-expressed with unfused cYFP. Scale bar, 50 μm. (D) In vitro phosphorylation of OsWRKY70 by OsMPK3/6. The phosphorylated form of OsWRKY70 (P-WRKY70) was detected by using Phos-tag Biotin BTL-104 (top). Input proteins, including OsWRKY70-His (WRKY70), GST-OsPMK3 (MPK3), GST-OsPMK6 (MPK6), and His-OsMKK4DD (MKK4DD) were monitored by Coomassie blue staining. (E) Assays for W-box binding activity of OsWRKY70. GST-OsMPK3 or GST-OsMPK6 was activated by a constitutively active form of OsMKK4, His-OsMKK4DD. BS65 containing two W-boxes was used as the probe. (F) Assays for transactivation activity of OsWRKY70. Leaves of N. benthamiana were agroinfiltrated with the indicated constructs. 24 hr later, leaves were injected with 10 mM 17-β-estradiol and were incubated for 12 hr. Total protein was extracted and GUS activities were subsequently quantified. Eight plants were used for each treatment. Letters indicate significant differences among different lines (A) or treatments (F) (p < 0.05, Duncan's multiple range test).


To determine whether the two MAPKs regulate OsWRKY70, we measured transcript levels of OsWRKY70 in MAPK-silenced rice plants and vice versa. OsWRKY70 transcript levels were significantly decreased in OsMPK3 (Wang et al., 2013) and OsMPK6 silenced lines (Figure 3A) after infestation with SSB for 1 hr (Figure 2A). Another group I-type WRKY TF, OsWRKY24, which has both SP clusters and a D domain, was down-regulated in OsMPK6 silenced plants, but not in OsMPK3 silenced lines (Figure 3B). In WRKY70 silenced lines (see below) on the other hand, OsMPK3 and OsMPK6 transcripts were the same as in wild-type (WT) plants (Figure 3C,D). These results show that the transcript levels of OsWRKY70 is regulated by OsMPK3 and OsMPK6, but not vice versa.

Transcript levels of OsMPK6, OsWRKY24, OsMPK3, and OsMPK6 in different transgenic lines.

(A) Mean expression levels (+SE, n = 6) of OsMPK6 in OsMPK6 silenced lines (irMPK6-1 and irMPK6-2). Samples used for QRT-PCR were from plant stems that were infested by SSB for 1 hr. (B) Mean transcript levels (+SE, n = 5) of OsWRKY24 in irMPK3 (irMPK3-53, irMPK3-183) and irMPK6 lines after infestation by SSB for 1 hr. (C, D) Mean transcript levels (+SE, n = 5) of OsMPK3 (C) and OsMPK6 (D) in irWRKY70 lines after infestation by SSB for 1 hr. Letters indicate significant differences among different lines (p < 0.05, Duncan's multiple range test).


OsWRKY70 prioritizes defence over growth by regulating phytohormonal signaling

To determine the role of OsWRKY70 in herbivore-induced defence responses, we constructed OsWRKY70 overexpression and knockdown lines using Agrobacterium tumefaciens mediated transformation. Through GUS staining and hygromycin resistance selection, we obtained two homozygous, single-insertion OsWRKY70-silenced lines (irWRKY70-7 and irWRKY70-8) and two overexpression lines (oeWRKY70-8 and oeWRKY70-17; Figure 4—figure supplement 1A). OsWRKY70 overexpression resulted in dwarfed plants (Figure 4B), suggesting that OsWRKY70 is a negative growth regulator. To reduce phenotypic effects (see below), we also created hemizygous overexpressing lines (hemi-oeWRKY70-8 and hemi-oeWRKY70-17) whose phenotype was weaker but still visible in both nutrient solution and soil (Figure 4A,B). SSB-induced transcript levels of OsWRKY70 in irWRKY70-7 and irWRKY70-8 were suppressed by more than 80% compared to WT plants at 1 hr after SSB feeding. Conversely, OsWRKY70 transcript levels were increased about 14-fold in hemi-oeWRKY70-8 and hemi-oeWRKY70-17 plants (Figure 4—figure supplement 1B). Transcriptional profiling of the OsWRKY70-homologous genes OsWRKY24 and OsWRKY53 confirmed that gene targeting was specific for OsWRKY70 (Figure 4—figure supplement 1C,D). In soil, the hemi-oeWRKY70 lines displayed dark green leaves and delayed flowering, similar to known GA-deficient mutants (Sakamoto et al., 2004). Plant height was reduced by 29% and 27%, and root length by 49% and 30%, respectively (Figure 4D,E). In contrast, the irWRKY70 lines grew similar to WT plants (Figure 4A,B), except for a slight increase in root length. To test whether OsWRKY70 acts as a negative regulator of GA biosynthesis, we profiled GA levels in the different lines using HPLC/MS–MS. The experiment revealed that GA1, GA7, GA19, GA20, GA24, and GA53 levels were significantly lower in hemi-oeWRKY70 lines (hemi-oeWRKY70-8 and hemi-oeWRKY70-17) than in WT plants (Figure 4G). Moreover, the growth phenotype of the oeWRKY70 seedlings was successfully restored to WT levels when they were grown on 1/2 MS plates with GA3 at a concentration of 0.01 μM (Figure 4C). Consistently, the GA biosynthesis gene GA 20 oxidase (GA20ox7) was significantly down-regulated in the hemi-oeWRKY70-8 lines (Figure 4F). These results suggest that OsWRKY70 regulates plant growth through GA biosynthesis.

Figure 4 with 2 supplements see all
Altering OsWRKY70 expression affects GA levels and plant growth.

(A, B) Growth phenotypes of OsWRKY70 transgene lines (irWRKY70 lines, irWRKY70-7 and irWRKY70-8, and oeWRKY70 and hemi-oeWRKY70 lines, oeWRKY70-8, hemi-oeWRKY70-8 and hemi-oeWRKY70-17) and wild-type (WT) plants at tillering stage (A) and heading stage (B). (C) 10-day-old seedlings of WT and hemi-oeWRKY70-8 lines whose seeds were surface sterilized and placed on 1/2 Murashige and Skoog agar medium containing GA3 (minimum purity > 99%, Sigma, St Louis, MO) at various concentrations. This experiment was repeated 3 times with similar results. (D, E) Root length (D) and plant height (E) of transgenic lines with silencing (irWRKY70) or overexpressing (hemizygous lines, hemi-oeWRKY70 lines) of OsWRKY70 and WT plants at tillering stage. (F) Mean transcript levels (+SE, n = 5) of OsGA20ox7 in hemi-oeWRKY70-8, hemi-oeWRKY70-17, and WT plant. (G) Mean levels (+SE, n = 3) of gibberellins (GAs), including GA1, GA3, GA7, GA19, GA20, GA24, and GA53, in hemi-oeWRKY70-8, hemi-oeWRKY70-17, and WT plants. Letters indicate significant differences among different lines (p < 0.05, Duncan's multiple range test).


To understand how OsWRKY70 influences defence signaling in rice, we examined SSB-elicited JA, ET, and SA levels and the expression of biosynthesis genes in OsWRKY70 transgenic lines and compared them to WT plants. JA levels in the irWRKY70 lines were significantly decreased compared with WT plants upon SSB attack, while they were increased in the overexpressing lines (Figure 5A). In accordance with this data OsWRKY70 positively regulated SSB-induced transcript levels of the JA-biosynthesis genes OsHI-LOX (Zhou et al., 2009) and OsAOS2 (Mei et al., 2006) (Figure 5B,C). The accumulation of ethylene was similar in the irWRKY70 lines and WT plants, but the levels were significantly elevated in hemi-oeWRKY70 lines after SSB infestation (Figure 5D). Consistent with this result, transcript levels of the ethylene biosynthesis gene OsACS2 were similar in irWRKY70 and WT plants when infested by SSB, but were much higher in the induced hemi-oeWRKY70 lines (Figure 5E). WT plants and irWRKY70 lines had nearly identical constitutive and SSB-induced SA levels, whereas the SA levels in the hemi-oeWRKY70 lines were significantly lower than in WT plants (Figure 5F). Isochorismate synthase (ICS) is a key enzyme in plant SA biosynthesis (Wu and Baldwin, 2010). We examined the OsICS1 gene (Du et al., 2009) in rice after SSB infestation and found that the OsICS1 transcriptional level was significantly decreased in the hemi-oeWRKY70 lines compared with WT plants (Figure 5G). Taken together, these experiments demonstrate that OsWRKY70 positively regulates SSB-induced JA- and ET levels but negatively regulates SA levels. To explore the notion that OsWRKY70 may be an upstream regulator of the JA and ET pathways, we investigated the expression of OsWRKY70 in transgenic plants with impaired JA and ET signaling. We used an antisense OsHI-LOX line (as-lox), which produces 50% less JA upon SSB infestation than WT plants (Zhou et al., 2009), and an antisense-ACS2 line (as-acs), which produces significantly less SSB-elicited ET than WT plants (Lu et al., 2011). The experiments revealed that the levels of constitutive and SSB-induced OsWRKY70 transcripts in as-lox and as-acs plants were the same as those in WT plants over the first 60 min of infestation (Figure 6A,B), suggesting that OsWRKY70 functions upstream of JA and ET signaling. To fully demonstrate that OsWRKY70 acts upstream of JA and ET, additional experiments with null-mutants would be required.

Figure 5 with 1 supplement see all
OsWRKY70 mediates SSB-elicited JA, SA, and ET accumulation.

Mean levels (+SE, n = 5–10) of JA (A), ET (D), and SA (F), and mean expression levels (+SE, n = 5) of OsHI-LOX (B), OsAOS2 (C), OsACS2 (E), and OsICS1 (G) in irWRKY70, hemi-oeWRKY70, and WT plants that were individually infested by a third-instar SSB larva. Asterisks indicate significant differences in irWRKY70, hemi-oeWRKY70 compared with WT plants (*, p < 0.05; **, p < 0.01; Duncan's multiple range test).

Levels of OsWRKY70 transcripts in WT plants and transgenic lines with impaired JA (as-lox) and ethylene (as-acs) biosynthesis.

Mean transcript levels (+SE, n = 5) of OsWRKY70 in transgenic lines with impaired JA (A, as-lox) and ethylene (B, as-acs) biosynthesis and WT plants after they were infested by SSB.


OsWRKY70-dependent defence prioritization increases resistance to a chewing herbivore through JA-dependent defense activation

Trypsin protease inhibitors (TrypPIs) are important direct defence proteins against SSB in rice and their activity is regulated by JA- and ET (Zhou et al., 2009; Li et al., 2012). Thus, we investigated the influence of OsWRKY70 on TrypPI activity and SSB performance. TrypPI activity was suppressed in the irWRKY70 lines and enhanced in the hemi-oeWRKY70 lines compared with WT plants (Figure 7A). As expected, SSB caterpillars gained more mass on irWRKY70-7 and irWRKY70-8 plants and less mass on the overexpressing lines compared to those fed on WT plants (Figure 7B). IrWRKY70 lines were more severely damaged by SSB than the WT plants, whereas the hemi-oeWRKY70 lines were less damaged (Figure 7C,D). To determine whether the impaired SSB resistance and defences in the irWRKY70 lines is due to lower JA levels, we complemented irWRKY70 plants with JA and examined SSB-induced TrypPI production and SSB performance. JA treatment attenuated the difference in TrypPI levels between WT plants and the irWRKY70 lines (Figure 7E). Moreover, SSB larvae fed on JA-treated irWRKY70 lines gained a similar amount of weight to those fed on equally treated WT plants (Figure 7F). The complete restoration of plant resistance to SSB and elicited accumulation of TrypPIs in irWRKY70 by exogenous JA application suggests that OsWRKY70 mediates rice-resistance to SSB through JA signaling.

OsWRKY70 positively regulates resistance in rice to SSB.

(A) Mean Trypsin protease inhibitor (TrypPI) activities (+SE, n = 6) in irWRKY70, hemi-oeWRKY70, and WT plants that were individually infested by a third-instar SSB larva for 3 days. (B) Mean larval mass (+SE, n = 50) of SSB that fed on irWRKY70, hemi-oeWRKY70, and WT plants for 14 days. (C, D) Damaged phenotypes of irWRKY70 (C), hemi-oeWRKY70 (D), and WT plants that were individually infested by a third-instar SSB larva for 8 days (n = 10). This experiment was repeated twice with similar results. (E) Mean activities (+SE, n = 6) of TrypPIs in irWRKY70 and WT plants that were individually treated either 100 μg JA in 20 μl of lanolin paste (JA) or with 20 μl of pure lanolin (insert) for 24 hr, followed by SSB feeding for 3 days; (F) Mean larval mass (+SE, n = 50) of SSB 12 days after fed on irWRKY70 and WT plants that were individually treated either 100 μg JA in 20 μl of lanolin paste (JA) or with 20 μl of pure lanolin (insert) for 24 hr. Letters indicate significant differences among different lines (p < 0.05, Duncan's multiple range test).


OsWRKY70 dependent, GA-mediated growth suppression increases susceptibility to a non-target herbivore

Based on the above results, we investigated whether OsWRKY70 regulation influences plant resistance to a non-target herbivore (i.e., a secondary attacker that does not strongly activate OsWRKY70): the piercing sucking rice BPH N. lugens. When irWRKY70 lines and WT plants were exposed to a BPH colony, adult females preferred feeding on the WT rather than the irWRKY70 lines (Figure 8A,B). Similarly, BPH adult females laid more eggs on WT plants than irWRKY70 (Figure 8A,B, inserts). In accordance with these findings, BPH adult females were found more often on hemi-oeWRKY70 lines than on WT plants and laid more eggs on the former than on the latter (Figure 8C,D). Moreover, BPH nymphs fed on the irWRKY70 lines had lower survival rates than those fed on WT plants; in contrast, BPH nymphs fed on the hemi-oeWRKY70 lines had higher survival rates (Figure 8E,F), showing that OsWRKY70 negatively regulates rice BPH resistance. Based on the signaling profiles showing that OsWRKY70 negatively regulates GAs, we hypothesized that the down regulation of GAs may be responsible for the enhanced susceptibility to BPH. We therefore conducted a series of experiments to explore the influence of OsWRKY70 dependent GA on BPH. First, we used a GA-deficient mutant, sd-1 (Spielmeyer et al., 2002), and a GA-excessive mutant, eui (Zhu et al., 2006), to test the importance of GA for BPH resistance. The BPH female adults preferred feeding and ovipositing on sd-1 rather than the WT (ZH11) (Figure 9A), whereas the eui lines repelled BPH feeding compared with WT plants and did not affect BPH oviposition (Figure 9B). The BPH nymph mortality was significant higher on the eui mutant compared with WT plants, but the sd-1 mutant did not influence BPH nymph performance (Figure 9C). Second, we complemented the hemi-oeWRKY70 lines with GA3 at a concentration of 1 μM. This treatment restored BPH resistance to WT levels: BPH female adults feeding and ovipositing showed no preference between the WT and GA3-treated hemi-oeWRKY70 lines (Figure 9D,E), and the BPH nymph survival rate was the same on GA3-treated hemi-oeWRKY70 and WT plants (Figure 9F). Taken together, these results strongly suggest that OsWRKY70 negatively regulates BPH resistance through GA signaling.

OsWRKY70 negatively regulates resistance of rice to BPH.

(AD) Mean number of female BPH adults per plant (+SE, n = 8) on pairs of plants (WT vs irWRKY70-7, irWRKY70-8, hemi-oeWRKY70-8, and hemi-oeWRKY70-17, respectively), 1–48 hr after pairs were exposed. Inserts: mean percentage (+SE, n = 8) of BPH eggs per plant on pairs of plants as started above, 48 hr after the release of BPH. (E, F) Mean survival rate (+SE, n = 10) of BPH nymphs that fed on irWRKY70, hemi-oeWRKY70, or WT plants 1–12 days after the start of feeding. Asterisks indicate significant differences in irWRKY70, hemi-oeWRKY70 compared with WT plants (*, p < 0.05; **, p < 0.01; Student's t-test [A-D] or Duncan's multiple range test [E, F]).

The GA-signaling pathway positively regulates rice resistance to BPH.

(A, B) Mean number of adult female BPH per plant (+SE, n = 8) on pairs of plants (WT (ZH11) vs sd-1 and eui, respectively), 1–48 hr after pairs were exposed. Inserts: mean percentage (+SE, n = 8) of BPH eggs per plant on pairs of plants as started above, 48 hr after the release of BPH. (C) Mean survival rate (+SE, n = 10) of BPH nymphs that fed on sd-1, eui lines, or WT (ZH11) plants 1–12 days after the start of feeding. (D, E) Mean number of female BPH adults per plant (+SE, n = 8) on pairs of plants, a WT plant that was grown in a nutrient solution without GA3 vs a hemi-oeWRKY70-8 (D) or hemi-oeWRKY70-17 (E) plant that was grown in a nutrient solution with GA3 at a concentration of 1 μM for 24 hr, 1–48 hr after pairs were exposed. Inserts: mean percentage (+SE, n = 8) of BPH eggs per plant on pairs of plants as started above, 48 hr after the release of BPH. (F) Mean survival rate (+SE, n = 10) of BPH nymphs that fed on WT plants that were grown in a nutrient solution without GA3 or hemi-oeWRKY70 lines (hemi-oeWRKY70-8 and hemi-oeWRKY70-17) that had been grown in a nutrient solution with GA3 at a concentration of 1 μM for 24 hr, 1–12 days after the start of feeding. Asterisks indicate significant differences in mutants compared with WT plants (*, p < 0.05; **, p < 0.01; Student's t-test [A, B, D, E] or Duncan's multiple range test [C]).



Our experiments demonstrate that prioritizing defence over growth in response to a chewing herbivore is linked to a trade-off with resistance against a piercing-sucking herbivore via a WRKY TF. This indirect additional cost of defence may lead to the evolution of divergent, herbivore-community dependent plant resistance strategies in nature and may significantly constrain efforts to breed herbivore-resistant plants. It has been well documented that there are trade-offs between plant growth and defence (Zavala and Baldwin, 2006; Zhang et al., 2008; Meldau et al., 2012; Yang et al., 2012). Resource availability, competition, plant ontogeny, and herbivory can influence the allocation of resources to growth and defence (Stamp, 2003; Boege and Marquis, 2005). In nature, defence prioritization is complicated by the fact that plants are often attacked simultaneously by multiple herbivore species, which have different sensitivities to various defence strategies, leading to resistance trade-offs (Stam et al., 2014). For example, leaf-chewing caterpillars were found to perform better on Arabidopsis plants that are attacked by phloem-sucking aphids and vice versa (Soler et al., 2012). Given that herbivory is an important driving force for the evolution of plant defence (Agrawal et al., 2012; Züst et al., 2012), understanding growth/defence and resistance trade-offs is important to predict and understand selection patterns in nature. Our study reveals that growth/defence and resistance trade-offs can emanate from the same mechanistic basis. From a plant's perspective, this suggests that reducing growth to support defence is even more costly than previously anticipated. From an agricultural point of view, this result indicates that it may be problematic to breed resistant varieties that rely on induced defence, as these plants may suffer from both a depression in growth and increased susceptibility to non-target herbivores.

The discovery and manipulation of a TF that directly regulates defence prioritization allows us to draw a detailed picture of the mechanisms that underlie defence prioritization in rice. OsWRKY70 is rapidly induced following mechanical wounding and SSB feeding, but not following attack by a piercing sucking herbivore. Despite a lacking D-domain, OsWRKY70 interacts with and is regulated by two MAP-kinases, OsMPK3 and OsMPK6 (Figure 2). It has been well documented that Group I-type WRKY TFs can be phosphorylated by MAPKs and that the SP clusters are the phosphorylating sites (Mao et al., 2011; Ishihama and Yoshioka, 2012). We found that both OsMPK3 and OsMPK6 phosphorylate OsWRKY70, which in turn increased the transactivation activity of OsWRKY70 (Figure 2). Moreover, OsWRKY70 can auto-regulate itself (Figure 2—figure supplement 2). Given that autoregulation and cross-regulation are common features of WRKY action (Ishihama and Yoshioka, 2012), OsWRKY70 transcript levels are likely reduced in OsMPK3 and 6 silenced lines because of the reduction in phosphorylated WRKY70 and other WRKYs, which decreases WRKY activity and thereby reduce OsWRKY70 transcript levels. Phytohormones on the other hand do not regulate OsWRKY70. Combined with its capacity to bind to W-box sequences and to act as transcriptional activator, this places OsWRKY70 at the interface between early recognition and signaling and hormonal regulation (Rushton et al., 2010; Wu and Baldwin, 2010; Erb et al., 2012). Indeed, silencing and over-expression of OsWRKY70 demonstrates its central role in regulating defence and growth through JA, ET, SA, and GA signaling, which enables OsWRKY70 to reduce plant growth and increases defence upon herbivore attack. In other plant systems, WRKYs have also been reported to play important roles in the regulation of transcriptional reprogramming associated with plant growth, development, and stress responses at different levels, including upstream and downstream of protein kinases and hormones (Rushton et al., 2010; Ishihama et al., 2011; Mao et al., 2011; Zheng et al., 2013). NaWRKY3 and NaWRKY6, the homologs of OsWRKY70 in N. attenuata, for instance, have been reported to function downstream of NaSIPK and NaWIPK and upstream of JA biosynthesis (Skibbe et al., 2008). In Arabidopsis, AtWRKY33, the homolog of OsWRKY70 is phosphorylated by AtMPK3/MPK6 and can affect ET synthesis by directly binding promoter region of ACS2 and ACS6 genes (Li et al., 2012). Another rice WRKY, OsWRKY24 has been reported to repress GA signaling in rice aleurone cells (Zhang et al., 2009).

OsWRKY70 may regulate phytohormone signaling via two, not mutually exclusive routes. First, it may directly bind to genes that are involved in hormone biosynthesis and signaling. Consistent with this hypothesis, OsWRKY70 positively modulated the transcript levels of the JA- and ET-synthesis genes OsHI-LOX, OsAOS2, and OsACS2, and negatively regulated the transcripts of the SA- and GA-biosynthesis genes OsICS1 and OsGA20ox7 (Figures 4F, 5B,C,E,G). The existence of W-box or W-box like motifs in the promoters of these genes (Figure 5—figure supplement 1) provides additional indirect evidence for their interaction with OsWRKY70. Second, OsWRKY may regulate growth and defence through indirect hormonal cross-talk. It has been reported that the JA-signaling pathway is connected to the GA-signaling pathway through COI1-JAZ1-DELLA-PIF complexes, resulting in mutual suppression. The activation of JA signaling inhibits GA-mediated plant growth, whereas the activation of the GA pathway inhibits JA-mediated plant defence (Yang et al., 2012). Moreover, JA was found to inhibit GA biosynthesis via an unknown mechanism (Yang et al., 2012; Heinrich et al., 2013), and the GA-GID1-DELLA complex was found to positively regulate the production of SA (Navarro et al., 2008). Thus, the observed phytohormone levels and associated phenotypes in the transgenic OsWRKY70 lines might be at least in part due to antagonistic and synergistic phytohormone crosstalk. It has also been reported that the absence of JA signaling enhances the sensitivity of plants to GAs (Yang et al., 2012). In our experiments, the promotion of JA signaling in oeWRKY70 lines did not decrease the sensitivity of plants to GA3 (Figure 4—figure supplement 2). Moreover, the dwarf phenotype of oeWRKY70 lines was completely restored by exogenous GA3 at low concentrations of 0.01 μM (Figure 4C). This suggests that the dwarf phenotype of oeWRKY70 lines is directly related to the low level of GAs and that the sensitivity of plants to GAs may be influenced by other OsWRKY70-mediated factors other than JA. Interestingly, irWRKY70 lines showed similar growth phenotypes to WT plants, indicating that GA levels are unlikely to be altered in irWRKY70 lines. This suggests an involvement of other factors, such as the homologs of OsWRKY70, OsWRKY24, and OsWRKY53, in the biosynthesis of GAs. Overall, the combination of direct regulation and indirect phytohormone crosstalk may explain how a single TF can act as a node in multiple signaling processes and integrate growth and defence responses.

Our experiments do not only connect OsWRKY70 with phytohormone signaling, but also illustrate how hormonal signaling affects resistance responses against different herbivores. In rice, it is well documented that TrypPIs are an effective JA-dependent defence against chewing herbivores, including SSB (Zhou et al., 2009; Lu et al., 2011). Here, we found that OsWRKY70 positively mediated the production of elicited JA and TrypPIs (Figures 5A, 7A), which subsequently modulated resistance in rice to SSB (Figure 7B–D). Moreover, JA complementation of irWRKY70 lines, which had lower herbivore-elicited JA levels, completely restored TrypPI activity and SSB resistance compared to equally treated WT plants (Figure 7E,F). These data suggest that OsWRKY70-mediated resistance in rice to SSB is mainly due to its effect on the JA-signaling pathway. On the other hand, little is known so far about the role of GA in herbivore resistance against piercing-sucking insects. We found that GA3 application restored BPH resistance in hemi-oeWRKY70 mutants (Figure 9D–F). Moreover, the GA-deficient mutant sd-1 improved the performance of BPH, whereas the GA-excessive mutant eui decreased BPH performance (Figure 9A–C). These data demonstrate that the GA-signaling pathway plays an important role in modulating resistance in rice to BPH in addition to its regulation of plant growth. GA-modulated BPH resistance in rice may occur via two mechanisms. One is that GA directly regulates the BPH defence response. It has been reported that GA can positively modulate the pathogen-related PBZ1 gene (Tanaka et al., 2006) and cell modification (Yang et al., 2008). The rigidity of the cell wall is important for resistance to BPH phloem-feeding. Moreover, GA can directly elicit the plant growth, which may enhance the tolerance of rice to BPH. Another possibility is that GA indirectly regulates BPH resistance by eliciting SA and ROS pathways, both of which have been reported to be involved in resistance of rice to BPH (Zhou et al., 2009; Lu et al., 2011), via GA-GID1-DELLA complex (Navarro et al., 2008; Alonso-Ramírez et al., 2009). Thus far, several other elements of the rice defense signaling cascade, including JA (Zhou et al., 2009), OsERF3 (Lu et al., 2011), and ethylene (Lu et al., 2014) have also been shown to have similar divergent effects on SSB and BPH, suggesting distinct resistance strategies of rice plants against these two herbivores. The main reason for the divergent signaling, response and resistance to the two herbivores might be their different feeding habits. Resistance mechanisms against phloem-feeders are well documented to differ substantially from mechanisms against chewing herbivores (Bostock, 2005).

In summary, our experiments provide evidence for a key role of OsWRKY70 in defence prioritization and illustrate that reducing growth via GA signaling opens the door to secondary infection by non-target herbivores. When attacked by a chewing herbivore such as SSB, rice plants will recognize signals derived from the herbivore and activate OsMPK3 and OsMPK6. The activated OsMPK3 and OsMPK6 then elicit OsWRKY70, which subsequently activates the JA- and ET-signaling pathways, resulting in the production of defence compounds such as TrypPIs and an increase in plant resistance. Simultaneously, the activation of OsWRKY70 decreases the production of GAs, which inhibits plant growth and thus prioritizes defence overgrowth and leads to increased susceptibility to BPH. Through these results, our study illustrates that the transcriptional modulation of hormonal networks allows plants to mount an appropriate defence program. At the same time, however, prioritizing defence over growth leads to significant resistance trade-offs, which may constrain plant resistance breeding and favor the evolution of herbivore-specific responses in plants.

Materials and methods

Plant growth and insects

Request a detailed protocol

The following rice genotypes were used in the present study: (i) Xiushui 11 WT plants and the corresponding transgenic lines irWRKY70, hemi-oeWRKY70 (see below), as-lox (Zhou et al., 2009), as-acs (Lu et al., 2011), irMPK3 (Wang et al., 2013), irMPK6 (Figure 4A) and (ii) Zhonghua 11 (ZH11) WT plants and the corresponding GA mutants sd-1 (Spielmeyer et al., 2002) and eui (Zhu et al., 2006). Pre-germinated seeds were cultured in plastic bottles (diameter 8 cm, height 10 cm) in a greenhouse (28 ± 2°C, 14L: 10D). 10-day-old seedlings were transferred to 50 L hydroponic boxes with a rice nutrient solution (Yoshida et al., 1976). After 30–35 days, seedlings were transferred to individual 500 ml hydroponic plastic pots. Plants were used for experiments 4–5 days after transplantation. A colony of SSB was originally obtained from rice fields in Hangzhou, China and maintained on TN1 rice seedlings using the method described previously (Zhou et al., 2009). For BPH, we used a lab population that has been reared on TN1 rice seedlings for more than 20 generations.

Isolation of OsWRKY70 cDNA

Request a detailed protocol

The full-length cDNA of OsWRKY70 was obtained by RT-PCR from total RNA isolated from WT plants infested by SSB larvae for 24 hr. The primers were designed based on the sequence of the rice OsWRKY70 (TIGR ID Os05g39720) gene (Supplementary file 1A), which showed high homology with the partial sequence of the OsWRKY70 transcript that was cloned by SSH. The PCR-amplified fragments were cloned into the pMD 19-T vector (TaKaRa, China) (pOsWRKY70) and sequenced.

Generation and characterization of transgenic plants

Request a detailed protocol

The full-length cDNA and a 443 bp fragment (Figure 1—figure supplement 1) of OsWRKY70 were cloned into the pCAMBIA1301 and pCAMBIA1301-RNAi vectors, respectively, yielding an over-expression (oeWRKY70) and an inverted-repeat orientation (irWRKY70) vector. Both the oeWRKY70 and irWRKY70 vectors were inserted into the rice variety Xiushui 11 using A. tumefaciens-mediated transformation. Homozygous T2 plants were selected using GUS staining or hygromycin resistance screening (Zhou et al., 2009). For most experiments, two irWRKY70 T2 homozygous lines, irWRKY70-7 and irWRKY70-8, each harboring a single insertion were used. However, oeWRKY70 homozygous lines were severe dwarfing and nearly no seeds, thus we used two hemizygous lines, hemi-oeWRKY70-8 and hemi-oeWRKY70-17, each also harboring a single insertion to perform the experiments.

Plant treatments

Mechanical wounding

Request a detailed protocol

Plants (one per pot) were individually damaged using a needle on the lower part of the stems (about 2 cm long), with 200 holes (W). Control plants (Control) were not pierced.

SSB treatment

Request a detailed protocol

Plants (one per pot) were individually infested using a third-instar SSB larva that had been starved for 2 hr. Control plants (Control) were left herbivore-free.

BPH treatment

Request a detailed protocol

Plants (one per pot) were individually infested with 15 female BPH adults that were confined in a glass cage (diameter 4 cm, height 8 cm, with 48 small holes, diameter 0.8 mm). Plants with an empty cage were used as controls (non-infested).

JA and SA treatment

Request a detailed protocol

The method for JA and SA treatment was the same as described previously (Zhou et al., 2009). Plants were individually sprayed with 2 ml of JA (100 μg/ml) or SA (70 μg/ml) in 50 mM sodium phosphate buffer. Control plants were sprayed with 2 ml of the buffer (Buffer). For JA complementation experiment, irWRKY70 line stems were individually treated with 100 μg of JA in 20 μl of lanolin paste. Controls (Lanolin) were similarly treated with 20 μl of pure lanolin.

GA3 treatment

Request a detailed protocol

For hemi-oeWRKY70 line growth complementation experiment, plants grown in one-half Murashige–Skoog (MS) medium with 0.4% phytogel supplemented with GA3 (minimum purity > 99%, Sigma, St Louis, MO) at various concentrations (see details in Figure 4). The growth phenotype was observed 10 days later. For BPH resistance complementation experiments, individual rice seedlings were grown in a nutrient solution (pH 4.8) with GA3 at a concentration of 1 μM (Li et al., 2011). Plants grown in nutrient solution without GA3 were used as controls.

Expression and purification of recombinant protein

Request a detailed protocol

The full-length ORF of OsWRKY70 was PCR-amplified and cloned into the pET-32a vector (Novagen, Madison, WI). The full-length ORF of OsMKK4 was PCR-amplified and cloned into the pET-28b vector (Novagen), and the two phosphorylation sites (T and S) of OsMKK4 were mutant to D (OsMKK4DD) by Q5 Site-Directed Mutagenesis Kit (NEB). The full-length ORFs of OsMPK3 and OsMPK6 were PCR-amplified and cloned into the pGEX-4T-3 vector (GE Healthcare). All of primers used for PCR amplification for these genes are listed in Supplementary file 1A. The constructs were transformed into E. coli BL21 (DE3) (Transgene, China). Expression was induced by adding 0.4 (for OsWRKY70 and OsMKK4DD) or 0.2 (for OsMPK3 or 6) mM isopropyl-β-thiogalactopyranoside (IPTG) for 20 hr at 20°C (for OsWRKY70 and OsMKK4DD) or for 4 hr at 23°C (for OsMPK3 and 6). Cells were collected and the recombinant protein was purified using His or GST Trap (GE healthcare, UK) according to the manufacturer's instructions.

Yeast one hybrid assay

Request a detailed protocol

The full-length ORF of OsWRKY70 was PCR-amplified and cloned into the GAL4 DNA-binding domain of the pGBKT7 vector (Clontech, Palo Alto, CA). The vector construct was transformed into yeast Y187 (Clontech) according to the manufacturer's instructions. Transformants were selected on SD (−Trp) plates at 30°C until colonies appeared. The colonies were identified by PCR and transferred into SD (−Trp) liquid medium. The transformant yeast with pGBKT7 or pGBKT7-OsWRKY70 was plated on SD (−Trp) containing X-α-gal at 30°C for 12 hr until the pGBKT7-OsWRKY70 transformants developed a blue color.

Subcellular localization of OsWRKY70

Request a detailed protocol

The full-length ORF without a stop codon of OsWRKY70 was cloned into the pEGFP vector (Clontech) to fuse it with GFP. The fusion gene, OsWRKY70:GFP, was inserted into pCAMBIA1301, yielding a transformation vector. This vector was used for transient transformation of N. benthamiana leaves as described previously (Li et al., 2014). Fluorescence was analyzed by confocal microscopy.

BiFC assays

Request a detailed protocol

Full-length ORFs of OsMPK3, OsMPK6, and OsWRKY70 without stop codons were cloned into serial pGreen-pSAT1 vectors containing either amino- or carboxyl terminal EYFP fragments and introduced into Agrobacterium as described previously (Hou et al., 2010). 3-week-old N. benthamiana leaves were agroinfiltrated with agrobacterial cells containing the indicated constructs. 2 days after incubation, fluorescence and DAPI staining were analyzed by confocal microscopy.

In vitro pull-down assay

Request a detailed protocol

Pull-down assay was performed as described previously (Ishihama et al., 2011); 5 μg of GST-tagged OsMPK3 and OsMPK6 and 2 μg His6-tagged OsWRKY70 were used. The samples were analyzed by SDS-PAGE. After electrophoresis, the gels were stained with Coomassie Brilliant Blue or subjected to immunoblot analysis using anti-WRKY70 antibody. Antibody with specificity to OsWRKY70 was generated by immunizing rabbits with the peptide CVYYASRAKDEPRDD-keyhole limpet hemocyanin-conjugate, and purified by the GenScript Company (Nanjing, China).

Transactivation activity assay

Request a detailed protocol

The full-length ORFs of OsMPK3, OsMPK6, and OsMKK4DD without stop codons were cloned into pBA-YFP, pBA-YFP, and 6myc-pBA, respectively. 1.8-kb promoter region of OsWRKY70 was PCR-amplified (primers were listed in Supplementary file 1A) and cloned into pCAMBIA1391. All constructs were introduced into AGL1 Agrobacterium. Leaves of N. benthamiana were agroinfiltrated with the indicated constructs (see details in Figure 2E and Figure 2—figure supplement 2C) at a ratio of 1:1:1:1. At 24 hr after agroinfiltration, leaves were injected with 10 mM 17-β-estradiol and were incubated for 12 hr. 2 days after infiltration, leaves were harvested and frozen in liquid nitrogen. Each treatment was repeated 8 times. GUS quantitative assay was performed as described (Xin et al., 2012).

Electrophoretic mobility shift assay (EMSA)

Request a detailed protocol

The probes used in EMSA were BS65 (5ʹ-ATCGTTGACCGAGTTGACTTT-3ʹ) with two W-boxes, P70 (GCCAGTCAAACCTCGAGGGAGCTTTGACCAGTCAACGGTCAAACGTTCAAAGGTCTATATAATGATCACCGGAGGCGTCGTCGTTG) and the W-box mutant mBS65 (5ʹ-ATCGTCCTACGAGTCCTATTT-3ʹ) (Chujo et al., 2007), all of which were labeled by Biotin. EMSA was performed using a LightShift Chemiluminescent EMSA Kit (Thermo, Rockford, IL) according to the manufacturer's instructions. Competition experiments were performed using unlabeled BS65 as a competitor in a 250-fold molar excess.

In vitro phosphorylation assay

Request a detailed protocol

GST-MPK3 (1 μg) or GST-MPK6 (1 μg) with or without His-MKK4DD (1 μg) was incubated in a kinase reaction buffer (50 mM Tris–HCl, pH 7.5, 1 mM Dithiothreitol (DTT), 10 mM MgCl2, 10 mM MnCl2, 50 μM ATP) at 30°C for 30 min. After this, recombinant His-WRKY70 (1 μg) was added and the mixture was incubated again at 30°C for 30 min. The reactions were stopped by adding SDS-loading buffer and heated for at 95°C for 5 min. The products were analyzed by SDS-PAGE. Phosphorylated proteins were detected by using Phos-tag Biotin BTL-104 (Wako, Japan) according to the manufacturer's instruction.

QRT-PCR analysis

Request a detailed protocol

Five independent biological samples were used. Total RNA was isolated using the SV Total RNA Isolation System (Promega, Madison, WI). One μg of each total RNA sample was reverse transcribed using the PrimeScript RT-PCR Kit (TaKaRa). qRT-PCR was performed on a CFX96 Real-Time system (Bio-RAD, Richmond, CA) using a Premix Ex Taq Kit (TaKaRa). The primers and probe sequences used for mRNA detection of target genes by qRT-PCR are shown in Supplementary file 1B. A rice actin gene, OsActin (TIGR ID: Os03g50885), was used as an internal standard to normalize cDNA concentrations.

SA, JA, and ET analysis

Request a detailed protocol

Plants (one per pot) were randomly assigned to SSB and control treatments. Two irWRKY70 lines (irWRKY70-7 and irWRKY70-8), two hemi-oeWRKY70 lines (hemi-oeWRKY70-8 and hemi-oeWRKY70-17), and one WT line were used. The stems were harvested at 0, 1.5, and 3 hr after SSB treatment, and JA and SA levels were analyzed by GC–MS using labeled internal standards as described previously (Lu et al., 2011). Three plants were covered with a sealed glass cylinder (diameter 4 cm, height 50 cm) and ethylene production was determined at 12 and 24 hr after the start of the experiment using the method described previously (Lu et al., 2006). Each treatment at each time interval was replicated 10 times.

Quantification of endogenous GAs

Request a detailed protocol

10-day-old seedlings (3 g) of hemi-oeWRKY70-8, hemi-oeWRKY70-17, and WT were frozen in liquid nitrogen, ground to fine powder, and extracted with 15 ml of 80% (vol/vol) methanol at 48°C for 12 hr. Different [2H2] labeled GAs were added to plant samples before grinding as internal standards. The extraction and analysis were performed as described previously (Chen et al., 2011). Each line was replicated 3 times.

TrypPI analysis

Request a detailed protocol

Plant stems (0.2–0.3 g per sample) were harvested at different time after different treatment (see details in Figure 7). The TrypPI activity was measured using a radial diffusion assay as described previously (Van Dam et al., 2001). Each treatment was replicated 5 times.

Herbivore resistance experiments

SSB performance assay

Request a detailed protocol

Three freshly hatched SSB larvae were allowed to feed on transgenic (irWRKY70 and hemi-OeWRKY70 lines) and WT plants. In complementation experiments, irWRKY70 lines (irWRKY70-7 and irWRKY70-8) and WT plants were randomly assigned to JA and Buffer treatments and then the freshly hatched SSB larvae were placed on these plants 24 hr after treatment. 30 plants were used for each line or treatment. Larval mass (to an accuracy of 0.1 mg) was measured 14 days after the start of the experiment. To detect the differences in plant tolerance to SSB attack between transgenic lines and WT plants, one second-instar larva of SSB was placed on individual plant. The damage levels of each plant were recorded and photographed every day.

BPH performance assay

Request a detailed protocol

To investigate the colonization and oviposition behavior of BPH, the basal stem of two plants (a mutant plant vs a WT plant) in one pot were confined with glass cylinders into which 15 gravid BPH females were introduced. The number of BPH on each plant at different time points and BPH eggs 48 hr post infestation were counted on each plant. To detect the survival rates of BPH nymphs on each line, the basal stem of each plant was confined with a glass cylinder, into which 15 BPH neonates were released. The number of surviving BPH on each plant was recorded until 12 days after the release of the herbivores. In GA3 complementation experiments, hemi-oeWRKY70 lines (hemi-oeWRKY70-8 and/or hemi-oeWRKY70-17) and WT plants were used and these plants were randomly assigned to GA3 and corresponding control treatments; the colonization and oviposition preferences of BPH female adults for pairs of plants and the survival rate of BPH nymphs on some treatments were determined (see details in Figure 9). The experiments for each treatment were replicated 8 times.

Data analysis

Request a detailed protocol

Differences in plant height, root length, herbivore performance, expression levels of genes and JA, SA, GA, ethylene, and H2O2 levels on different treatments, lines, or treatment times were determined by analysis of variance (ANOVA) (Student's t-tests for comparing two treatments). All tests were carried out with Statistica (Statistica, SAS Institute Inc., http://www.sas.com/).

Accession numbers

Request a detailed protocol

Sequence data from this article can be found in the Rice Annotation Project Database (RAP-DB) under the following accession numbers: Os05g39720 (OsWRKY70), Os05g27730 (OsWRKY53), Os01g61080 (OsWRKY24), Os03g17700 (OsMPK3), Os06g06090 (OsMPK6), Os02g54600 (OsMKK4), Os08g44590 (OsGA20OX7), Os08g39840 (OsHI-LOX), Os03g12500 (OsAOS2), Os09g19734 (OsICS1), Os04g48850 (OsACS2).


  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
    Laboratory manual for physiological studies of rice
    1. S Yoshida
    2. DA Forno
    3. J Cock
    Manila: The International Rice Research Institute.
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63

Decision letter

  1. Joerg Bohlmann
    Reviewing Editor; University of British Columbia, Canada

eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.

[Editors’ note: this article was originally rejected after discussions between the reviewers, but the authors were invited to resubmit after an appeal against the decision.]

Thank you for choosing to send your work entitled “Prioritizing plant defence over growth facilitates infestation by non-target herbivores” for consideration at eLife. Your full submission has been evaluated by Deputy Editor Detlef Weigel, a member of our Board of Reviewing Editors, and two peer reviewers. The decision was reached after discussions between the reviewers. Based on our discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.

The agreement was that the work is interesting, but does not represent a sufficiently major advance, as the molecular mechanisms underlying some of your key observations remain unclear. For example, it would have been important to demonstrate what the consequences of the observed physical interaction of OsWRKY70 with MAPK3/6 are. One would expect that, similar to what has been found for the Arabidopsis orthologue AtWRKY33, this interaction results in enhanced phosphorylation. But if this were the case, what would be the consequence of this phosphorlyation event: enhanced binding of OsWRKY33 to the W-box, degradation of OsWRKY70, or some other effect.

Reviewer #1:

This manuscript focuses on the function of the rice gene OsWRK70 in regulating plant defense and growth. OsWRK70 is a homolog of the Arabidopsis AtWRKY33 and Nicotiana attenuata NaWRKY3 and NaWRKY6 genes, which have previously been shown to function early in plant defense. The methodology seems correct and the conclusions do not go beyond what is shown by the data.

Specific comments:

1) In the current study, the authors present a number of findings: (1) OsWRK70 expression is increased by SSB feeding, but not jasmonate, salicylate, or ethylene; (2) OsWRK70 is localized to the nucleus, where it activates gene expression by binding to W-box motifs and physically interacts with OsMPK3 and OsMPK6, which are also required for up-regulating OsWRK70 transcription; (3) several approaches show that OsWRK70 positively regulates plant defense via JA and negatively regulates plant growth via GA; (4) high levels of OsWRK70 limit SSB growth but improve BPH growth. These findings are consistent with functions that have been reported previously for the corresponding Arabidopsis thaliana (AtWRKY33) and Nicotiana attenuata (NaWRKY3 and NaWRKY6) genes, as well as with earlier publications showing negative interactions between jasmonate and gibberellin signaling. Prior to the current manuscript, no publication has put these findings together in such a specific manner to illustrate a tradeoff in plant defense and growth based on a single transcription factor. Nevertheless, the manuscript as a whole seems more incremental than ground-breaking.

2) The section on regulation of OsWRK70 by OsMPK3 and OsMPK6 has some missing links. Although binding to OsWRK70 is demonstrated, the authors do not show that OsWRK70 is phosphorylated. I had expected some sort of demonstration that OsMPK3 and/or OsMPK6 modify OsWRK70 activity. However, the main phenotype that is demonstrated is reduced OsWRK70 transcription in lines with expression-silenced OsMPK3 and OsMPK6. Does this mean that OsWRK70 up-regulates its own transcription after binding to OsMPK3 and OsMPK6? Does the OsWRK70 have a W-box motif? Or do the authors have some other explanation for the transcriptional up-regulation.

3) Based on the authors' results, there seems to be a positive interaction between GA-mediated BPH defense and growth, i.e. stronger defense equals more growth and vice versa. This seems to run counter to the overall hypothesis of a trade-off between plant defense and growth. I realize that this is a bit peripheral to the main theme of the manuscript, but perhaps the authors can comment on this in the Discussion. Why is the rice BPH interaction so different from the rice-SSB interaction?

Reviewer #2:

The paper reports on the role of a rice transcription factor, OsWRKY70, in modulating resistance/susceptibility towards the chewing herbivore C. suppressalis (rice striped stem borer SSB) and the rice brown plant hopper N. lugens (BPH). The presented data imply that OsWRKY70, which is induced upon SSB challenge but not by BPH, positively regulates JA/ET levels, and functions upstream of JA and ET signaling. Using two independent RNAi knock-down and OsWRKY70 overexpressor (OE) lines each, the authors show that OsWRKY70 positively regulates resistance to SSB but negatively affects resistance to BPH. The authors demonstrate that OsWRKY70 physically interacts with OsMPK3 and OsMPK6, and that silencing of these MAP kinases results in decreased levels of OsWRKY70 transcript. OsWRKY70-mediated SSB resistance very likely occurs via increased JA-dependent trypsin protease inhibitor activities. OsWRKY70 also appears to be a negative regulator of GA biosynthesis since OsWRKY70 OE lines show significantly lower GA levels when compared to wildtype plants. The negative regulation of BPH resistance by OsWRKY70 appears to be through GA signaling.

Overall the paper contains interesting results and the experiments in most cases appear to be properly performed and documented. However there are several issues that need to be addressed. My major concern however, is that several key aspects of the paper rely mainly on data obtained by gross overexpression of the OsWRKY70 transcription factor. These plants (even the hemizygous lines used in the study) show strong pleiotropic affects. Thus, how valid some of uncovered molecular mechanisms are under normal physiological conditions remains an open question.

Specific points:

1) As a general comment I feel that the authors should replace the abbreviations often used in the different figures to make it easier for the reader to follow the story. For example: In Figure 2A and Figure 3 the silencing lines for MPK6 are designated as irMPK6-1 and irMPK6-2 but similar lines for MPK3 are designated P3i-53 and P3i-183. Suggestion: replace this by irMPK3-53 and irMPK3-183.

The OsWRKY70 silencing lines are designated ir7 and ir8, whereas the hemizygous OsWRKY70 overexpressor lines are designated hemi-oe8 and hemi-oe17 in various figures. I would suggest obvious names such as irWRLY70-7, irWRKY70-8, oeWRKY70-8, and oeWRKY70-17.

2) Figure 2B. The pull-down data concerning interaction of OsWRKY70 with OsMPK6 is not convincing. Considering that the GST-MPK6 protein is larger than the GST-MPK3 protein on the Coomassie stained gel, I do not find the weak band detected by the anti-WRKY70 antibody for GST-MPK6 on the western blot to be convincing particularly as it appears to be of the same size as the GST-MPK3 band. This needs improvement.

3) Figure 2—figure supplement 1C. The gel is of very poor quality and needs to be improved. Detection of the shifted band is very weak and is also still somewhat observed when the mutated probe (OsWRKY70 + mBS65) is used. Moreover, the EMSA experiments are not described in Materials and methods.

4) I do not feel that the transcriptional profiling data actually adds much to the paper. These experiments were performed using the OsWRKY70 overexpressor plants not infested with the herbivore. Thus, only a few genes were identified whose expression was solely dependent on OsWRKY70. It is not clear to me why SSB-induced WT plants, and OsWRKY70 overexpressor plants induced by SSB were not included. Indeed, nearly none of the genes further analyzed (Figure 4—figure supplement 1, Figure 5) in later parts of the paper (OsHI-LOX, OsAOS2, OsACS2, OsWRKY24, OsWRKY53) were detected (see Table 1 and 2). Are any of the identified differentially expressed genes depicted in Figure 4—figure supplement 2 altered in their expression upon SSB infestation?

5) Were GA levels in the RNAi lines tested? Are GA levels higher than WT in such plants?

6) Figure 5—figure supplement 1: Not all W-box elements highlighted are true functional elements. The W-box is not merely defined by the core TGAC sequence shown.

7) There is substantial variation for the WT values in the experiments depicted in Figure 8E and F. For example in Figure 8E BPH survival rates on WT decline from 100% to 60% within 12 days in this set of experiments (that include the overexpressors), but only decline from 100% to 85% in the experiments shown in Figure 8F (that include the RNAi lines). Why is this? Are these types of experiments highly variable and if so, how confident can one be about such results?


Author response

Based on your comments, we decided to perform a series of additional experiments to elucidate the molecular mechanisms of WRK70 regulation in rice. Our new results show that two map kinases can phosphorylate WRKY70 and thereby enhance its transactivation activity independently of W‐box autoregulation.

These new experiments allow us to directly address the main criticism of the paper. We furthermore believe that all other comments by the reviewers could easily be addressed and resolved.

The agreement was that the work is interesting, but does not represent a sufficiently major advance, as the molecular mechanisms underlying some of your key observations remain unclear. For example, it would have been important to demonstrate what the consequences of the observed physical interaction of OsWRKY70 with MAPK3/6 are. One would expect that, similar to what has been found for the Arabidopsis orthologue AtWRKY33, this interaction results in enhanced phosphorylation. But if this were the case, what would be the consequence of this phosphorlyation event: enhanced binding of OsWRKY33 to the W-box, degradation of OsWRKY70, or some other effect.

We agree with the editors that demonstrating the consequences of OsWRKY70 and MAPK3/6 binding would be interesting. We have now done these experiments and found that MPK3/6 can phosphorylate OsWRKY70 and thereby enhance the transactivation activity of OsWRKY70, but not the binding activity of OsWRKY70 to its own W‐box. We have added these results in Figure 2 D, E and F.

Reviewer #1:

This manuscript focuses on the function of the rice gene OsWRK70 in regulating plant defense and growth. OsWRK70 is a homolog of the Arabidopsis AtWRKY33 and Nicotiana attenuata NaWRKY3 and NaWRKY6 genes, which have previously been shown to function early in plant defense. The methodology seems correct and the conclusions do not go beyond what is shown by the data.

Specific comments:

1) In the current study, the authors present a number of findings: (1) OsWRK70 expression is increased by SSB feeding, but not jasmonate, salicylate, or ethylene; (2) OsWRK70 is localized to the nucleus, where it activates gene expression by binding to W-box motifs and physically interacts with OsMPK3 and OsMPK6, which are also required for up-regulating OsWRK70 transcription; (3) several approaches show that OsWRK70 positively regulates plant defense via JA and negatively regulates plant growth via GA; (4) high levels of OsWRK70 limit SSB growth but improve BPH growth. These findings are consistent with functions that have been reported previously for the corresponding Arabidopsis thaliana (AtWRKY33) and Nicotiana attenuata (NaWRKY3 and NaWRKY6) genes, as well as with earlier publications showing negative interactions between jasmonate and gibberellin signaling. Prior to the current manuscript, no publication has put these findings together in such a specific manner to illustrate a tradeoff in plant defense and growth based on a single transcription factor. Nevertheless, the manuscript as a whole seems more incremental than ground-breaking.

We agree with the reviewer that there is overlap between the function of OsWRKY70, NaWRKY3 and NaWRKY6 of Nicotiana attenuata and AtWRKY33 of Arabidopsis thaliana. Also, negative interactions between jasmonate and gibberellin signaling via COI1-JAZ1-DELLA-PIF complexes have been documented. The strength of our paper is the combination of mechanistic depth with biological relevance. On a mechanistic level, we show for the first time that a WRKY transcription factor directly regulates GA-JA crosstalk. On a biological level, we demonstrate that this regulation is responsible for growth defense trade-offs. Furthermore, we demonstrate that prioritizing defense over growth against one herbivore also leads to an additional cost by reducing resistance against another herbivore. In our opinion, this is not an incremental finding, but a new mechanism for defense trade-offs in plants which has important implications for the evolution and agricultural exploitation of induced resistance.

2) The section on regulation of OsWRK70 by OsMPK3 and OsMPK6 has some missing links. Although binding to OsWRK70 is demonstrated, the authors do not show that OsWRK70 is phosphorylated. I had expected some sort of demonstration that OsMPK3 and/or OsMPK6 modify OsWRK70 activity. However, the main phenotype that is demonstrated is reduced OsWRK70 transcription in lines with expression-silenced OsMPK3 and OsMPK6. Does this mean that OsWRK70 up-regulates its own transcription after binding to OsMPK3 and OsMPK6? Does the OsWRK70 have a W-box motif? Or do the authors have some other explanation for the transcriptional up-regulation.

We appreciate this comment. It has been well documented that Group I-type WRKY TFs can be phosphorylated by MAPKs and that the SP clusters are the phosphorylating sites (Ishihama et al., 2012; Mao et al., 2011). Like N. benthamiana NbWRKY8, Arabiodpsis AtWRKY33 and rice OsWRKY53, OsWRKY70 also has SP clusters (Figure 1—figure supplement 1). Here, we observed that OsWRKY70 is phosphorylated by OsMAPK3 and OsMAPK6 via their physical interactions, and this phosphorylation enhances the thansactivation activity of OsWRKY70 (Figure 2). Moreover, OsWRKY70 contains W-boxes in its promoter region and OsWRKY70 can auto-regulate its expression by binding its own promoter (Figure 2—figure supplement 2). Therefore, OsWRKY70 transcript levels are likely reduced in OsMAPK3 and 6 silenced lines because of the reduction in phosphorylated WRKY70 and other WRKYs, which decreases WRKY activity and thereby reduces OsWRKY70 transcript levels.

3) Based on the authors' results, there seems to be a positive interaction between GA-mediated BPH defense and growth, i.e. stronger defense equals more growth and vice versa. This seems to run counter to the overall hypothesis of a trade-off between plant defense and growth. I realize that this is a bit peripheral to the main theme of the manuscript, but perhaps the authors can comment on this in the Discussion. Why is the rice BPH interaction so different from the rice-SSB interaction?

We thank the reviewer for this valuable idea. This aspect may be related to the different feeding modes of the two herbivores. We now discuss this aspect at the end of the Discussion section.

Reviewer #2:

[…] Overall the paper contains interesting results and the experiments in most cases appear to be properly performed and documented. However there are several issues that need to be addressed. My major concern however, is that several key aspects of the paper rely mainly on data obtained by gross overexpression of the OsWRKY70 transcription factor. These plants (even the hemizygous lines used in the study) show strong pleiotropic affects. Thus, how valid some of uncovered molecular mechanisms are under normal physiological conditions remains an open question.

We agree with the reviewer that growth-defense trade-offs can be challenging to investigate because of potential secondary effects of the growth phenotypes, especially when it comes to herbivore resistance effects. To overcome this problem, we used three different strategies. First, we used hemizygous OsWRKY70 overexpressing lines, which show a much weaker growth phenotype. Second, we created both OsWRKY70 overexpressing and silenced lines. The silenced lines did not show any growth phenotype and therefore do not suffer from any growth-related limitations. Third, we have performed hormonal complementation assays to demonstrate the causal relation between OsWRKY70 dependent signaling and herbivore resistance. Together, we are confident that the reported mechanisms and effects of OsWRKY are robust and valid.

Specific points:

1) As a general comment I feel that the authors should replace the abbreviations often used in the different figures to make it easier for the reader to follow the story. For example: In Figure 2A and Figure 3 the silencing lines for MPK6 are designated as irMPK6-1 and irMPK6-2 but similar lines for MPK3 are designated P3i-53 and P3i-183. Suggestion: replace this by irMPK3-53 and irMPK3-183. The OsWRKY70 silencing lines are designated ir7 and ir8, whereas the hemizygous OsWRKY70 overexpressor lines are designated hemi-oe8 and hemi-oe17 in various figures. I would suggest obvious names such as irWRLY70-7, irWRKY70-8, oeWRKY70-8, and oeWRKY70-17.

We thank the reviewer for this valuable suggestion. We have changed the names of the mutants as the reviewer suggested.

2) Figure 2B. The pull-down data concerning interaction of OsWRKY70 with OsMPK6 is not convincing. Considering that the GST-MPK6 protein is larger than the GST-MPK3 protein on the Coomassie stained gel, I do not find the weak band detected by the anti-WRKY70 antibody for GST-MPK6 on the western blot to be convincing particularly as it appears to be of the same size as the GST-MPK3 band. This needs improvement.

We used GST proteins (GST-MPK3 or GST-MPK6) to pull down the HIS-OsWRKY70 protein; after that, the protein complexes were boiled in SDS-loading buffer and then were fractionated by SDS-PAGE. The anti-WRKY70 antibody was used to investigate if there is the HIS-WRKY70 protein in the protein complexes. If there is, this means that the GST proteins can bind to the HIS-WRKY70. Thus, the western blot bands showed in Figure 2B are all the HIS-OsWRKY70 protein; they should have the same size. We therefore think that the conclusions of this experiment are valid.

3) Figure 2figure supplement 1C. The gel is of very poor quality and needs to be improved. Detection of the shifted band is very weak and is also still somewhat observed when the mutated probe (OsWRKY70 + mBS65) is used. Moreover, the EMSA experiments are not described in Materials and methods.

We thank the reviewer for this comment. We have redone the experiment and replaced the gel picture. We have added the method of EMSA in the Materials and methods section.

4) I do not feel that the transcriptional profiling data actually adds much to the paper. These experiments were performed using the OsWRKY70 overexpressor plants not infested with the herbivore. Thus, only a few genes were identified whose expression was solely dependent on OsWRKY70. It is not clear to me why SSB-induced WT plants, and OsWRKY70 overexpressor plants induced by SSB were not included. Indeed, nearly none of the genes further analyzed (Figure 4figure supplement 1, Figure 5) in later parts of the paper (OsHI-LOX, OsAOS2, OsACS2, OsWRKY24, OsWRKY53) were detected (see Table 1 and 2). Are any of the identified differentially expressed genes depicted in Figure 4—figure supplement 2 altered in their expression upon SSB infestation?

We thank the reviewer for this question. Since overexpression of OsWRKY70 resulted in a strong growth phenotype, we first wanted to know what happened in plants when OsWRKY70 was constitutively overexpressed- We then used the main patterns of this profiling to investigate specific effects of OsWRKY70 in more detail, including, for instance, GA signaling. Thus, the data is important to understand the motivation for many of the follow-up experiments. It would indeed be interesting in the SSB-induced regulation of some of the potential OsWRKY70 regulated genes. However, this experiment is beyond the scope of the current study.

5) Were GA levels in the RNAi lines tested? Are GA levels higher than WT in such plants?

We did not check the GA levels in RNAi lines, We did not check the GA levels in RNAi lines. Since GAs are correlated to plant growth and the RNAi lines showed similar growth phenotypes to WT plants, it is unlikely that GA levels were altered in these lines. This suggests an involvement of other factors, such as the homologs of OsWRKY70, OsWRKY24 and OsWRKY53, in the biosynthesis of GAs. This aspect is discussed in the revised version of the paper.

6) Figure 5figure supplement 1: Not all W-box elements highlighted are true functional elements. The W-box is not merely defined by the core TGAC sequence shown.

We thank the reviewer for this valuable suggestion. We have improved the description in the figure legends.

7) There is substantial variation for the WT values in the experiments depicted in Figure 8E and F. For example in Figure 8E BPH survival rates on WT decline from 100% to 60% within 12 days in this set of experiments (that include the overexpressors), but only decline from 100% to 85% in the experiments shown in Figure 8F (that include the RNAi lines). Why is this? Are these types of experiments highly variable and if so, how confident can one be about such results?


Article and author information

Author details

  1. Ran Li

    State Key Laboratory of Rice Biology, Institute of Insect Sciences, Zhejiang University, Hangzhou, China
    RL, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents
    Competing interests
    The authors declare that no competing interests exist.
  2. Jin Zhang

    State Key Laboratory of Rice Biology, Institute of Insect Sciences, Zhejiang University, Hangzhou, China
    JZ, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents
    Competing interests
    The authors declare that no competing interests exist.
  3. Jiancai Li

    State Key Laboratory of Rice Biology, Institute of Insect Sciences, Zhejiang University, Hangzhou, China
    JL, Acquisition of data, Drafting or revising the article, Contributed unpublished essential data or reagents
    Competing interests
    The authors declare that no competing interests exist.
  4. Guoxin Zhou

    State Key Laboratory of Rice Biology, Institute of Insect Sciences, Zhejiang University, Hangzhou, China
    GZ, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
  5. Qi Wang

    State Key Laboratory of Rice Biology, Institute of Insect Sciences, Zhejiang University, Hangzhou, China
    QW, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
  6. Wenbo Bian

    State Key Laboratory of Rice Biology, Institute of Insect Sciences, Zhejiang University, Hangzhou, China
    WB, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
  7. Matthias Erb

    Institute of Plant Sciences, University of Bern, Bern, Switzerland
    ME, Conception and design, Analysis and interpretation of data, Drafting or revising the article
    For correspondence
    Competing interests
    The authors declare that no competing interests exist.
  8. Yonggen Lou

    State Key Laboratory of Rice Biology, Institute of Insect Sciences, Zhejiang University, Hangzhou, China
    YL, Conception and design, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents
    For correspondence
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3262-6134


Ministry of Science and Technology of the People's Republic of China (National Basic Research Program of China (2010CB126200))

  • Yonggen Lou

National Natural Science Foundation of China (31330065)

  • Yonggen Lou

Earmarked Fund for China Agriculture Research System (CARS-01-21)

  • Yonggen Lou

European Commission (EC) (FP7-PEOPLE-2013-CIG- 629134)

  • Matthias Erb

Schweizerische Nationalfonds zur Förderung der Wissenschaftlichen Forschung (155781)

  • Matthias Erb

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank Tongfang Zhang and Ziyi Tang for their invaluable assistance with the experiments. The study was jointly sponsored by the National Basic Research Program of China (2010CB126200), the National Natural Science Foundation of China (31330065), and the earmarked fund for China Agriculture Research System (CARS-01-21). The work of ME is supported by the Swiss National Science Foundation (Grant Nr. 155781) and the European Commission (FP7-PEOPLE-2013-CIG- 629134).

Reviewing Editor

  1. Joerg Bohlmann, University of British Columbia, Canada

Publication history

  1. Received: September 17, 2014
  2. Accepted: June 16, 2015
  3. Accepted Manuscript published: June 17, 2015 (version 1)
  4. Version of Record published: July 6, 2015 (version 2)


© 2015, Li et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 2,823
    Page views
  • 814
  • 50

Article citation count generated by polling the highest count across the following sources: Scopus, Crossref, PubMed Central.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)