DNA damage shifts circadian clock time via Hausp-dependent Cry1 stabilization
- Scripps Research Institute, United States
Figures
Figure 1 with 2 supplements
Hausp interacts with Cry1.
(A and B) Lysates from 293T cells expressing pcDNA3-2xFLAG with no insert (−), Cry1, or Cry2 after the FLAG tag with (+) or without (−) co-expression of Per2 were used to purify control, Cry1, or …
Figure 1—figure supplement 1
Circadian measurement of Hausp mRNA expression in mouse tissues.
Hausp expression was measured by quantitative RT-PCR in RNA prepared from mouse liver, quadriceps, spleen, and kidneys harvested at the indicated zeitgeber times (ZT, hours after lights on) from …
Figure 1—figure supplement 2
Circadian measurement of Hausp protein expression in mouse tissues.
Hausp, Per2, Cry1, Cry2, Tubulin, and Lamin were measured by IB in whole cell lysates or nuclei prepared from mouse liver or quadriceps harvested at the indicated ZTs. Each lane on the gel …
Figure 2 with 3 supplements
Hausp stabilizes Cry1 via deubiquitination and alters circadian rhythms.
(A) Wild-type or Cry1−/−;Cry2−/− (Cry−/−) MEFs stably expressing a control sequence (−) or shRNA targeting Hausp (#1) were subjected to nuclear and cytoplasmic fractionation. Cry1, Hausp, Lamin, and …
Figure 2—figure supplement 1
Validation of shRNA targeting Hausp.
Hausp expression was measured by quantitative RT-PCR in RNA prepared from MEFs stably expressing the indicated shRNA. Data represent the mean ± s.d. for three samples per cell line measured in …
Figure 2—figure supplement 2
In vitro deubiquitination of Cry1 by recombinant Hausp.
Full-length and ubiquitylated Cry1 were measured by IB following in vitro exposure of purified ubiquitylated Cry1 to the indicated amounts of recombinant USP7 (Hausp) or USP8. Right: quantitation of …
Figure 2—figure supplement 3
Quantitation of in vivo Cry1 ubiquitination.
Quantitation of ubiquitinated Cry1 immunoprecipitated from MEFs expressing shRNA targeting Hausp (blue) or a control sequence (black). Left, western blot from Figure 2C with boxes used for …
Figure 3 with 3 supplements
DNA damage resets the clock via Hausp-dependent stabilization of nuclear Cry1.
(A) Endogenous Hausp, Cry1, Cry2, phospho-P53 (Ser15), P53, Lamin, and Tubulin were detected by IB in Cry1 immunoprecipitates or input samples from nuclear and cytoplasmic fractions of primary MEFs …
Figure 3—figure supplement 1
Effect of DNA damage on Cry1-Hausp interaction in transfected 293T cells.
HAUSP-V5, FLAG-Cry1, and Actin were detected by IB in IPs or whole cell lysates (WCL) from 293T cells transfected with the indicated plasmids (by calcium phosphate method) and treated with …
Figure 3—figure supplement 2
Proteostasis and/or membrane stress increase the Cry1-Hausp interaction.
HAUSP-V5, FLAG-Cry1, and Actin were detected by IB in IPs or whole cell lysates (WCL) from 293T cells transfected with the indicated plasmids (by calcium phosphate CaP, or PEI method) and treated …
Figure 3—figure supplement 3
Circadian time of exposure determines phase shift in response to DNA damage.
Typical results of continuous monitoring of luciferase activity from mouse embryonic fibroblasts expressing Per2::Luciferase treated with 0 (black curves) or 10 Gy (red curves) ionizing radiation 4 …
Figure 4 with 2 supplements
DNA damage induced signaling modulates interactions of Cry1/2, Hausp, and Fbxl3.
Hausp-V5, FLAG-Cry1/2, phospho-P53 (Ser15), Phospho-SQ/TQ, Phospho-Cry1S588 (P-S588), Fbxl3-V5, and Actin were detected by IB in IPs and lysates (WCL) from 293T cells transfected with the indicated …
Figure 4—figure supplement 1
Composition of Cry1- and Cry2-associated protein complexes.
(A and B) Lysates from 293T cells expressing pcDNA3-2xFLAG with no insert, Cry1, or Cry2 were used to purify control, Cry1, or Cry2-containing complexes by immunoprecipitation (IP) of the FLAG tag. …
Figure 4—figure supplement 2
Conserved SQ/TQ motifs present in Cry1 and/or Cry2.
Sequence alignment of mouse and human Cry1 and Cry2 indicating the positions and conservation of several SQ/TQ motifs. (Numbers correspond to the amino acid positions in mouse Cry1.)
Figure 5 with 2 supplements
Cry1/2 deficiency alters transcriptional response to DNA damage.
Expression of the indicated transcripts was measured by quantitative PCR (qPCR) in cDNA from wildtype (black), Cry1−/− (blue), Cry2−/− (red), and Cry1−/−;Cry2−/− (gray) fibroblasts treated with …
Figure 5—figure supplement 1
Transcriptional response to irradiation-induced DNA damage.
Expression of the indicated transcripts was measured by quantitative PCR (qPCR) in cDNA prepared from wild-type (black), Cry1−/− (blue), and Cry2−/− (red) fibroblasts at the indicated times …
Figure 5—figure supplement 2
Circadian pattern of Cry1 and Cry2 binding to selected chromatin sites.
Association of Cry1 (blue) or Cry2 (red) with chromatin at the indicated locations in ChIP sequencing data set published by Koike et al. (2012). Data represent the reported Cry1 or Cry2 signal …
Figure 6
Cry2−/− cells accumulate damaged DNA.
(A) Representative early passage (P3–4) primary wildtype (WT), Cry1−/−, Cry2−/−, and Cry1−/−;Cry2−/− adult ear fibroblasts stained with anti-53BP1 antibody (green) and DAPI (blue). Insets show …
Figure 7
Model depicting a novel mechanism by which the regulation of Cry1 and Cry2 enables coordination of the transcriptional response to genotoxic stress.
In quiescent cells, Cry1 and Cry2 repress transcription of target genes. Upon DNA damage, Cry2 is degraded, relieving repression. As Cry1 accumulates, it replaces Cry2 and returns gene expression to …
Tables
Table 1
Primers used for qPCR
| Cdkn2a (p21): | Fwd: CCAGGCCAAGATGGTGTCTT | Rev: TGAGAAAGGATCAGCCATTGC |
| Mdm2: | Fwd: CTGTGTCTACCGAGGGTGCT | Rev: CGCTCCAACGGACTTTAACA |
| Rrm2b: | Fwd: GACAGCAGAGGAGGTTGACTTG | Rev: AAAACGCTCCACCAAGTTTTCA |
| Puma: | Fwd: GTACGGGCGGCGGAGACGAG | Rev: GCACCTAGTTGGGCTCCATTTCTG |
| Gadd45a: | Fwd: AAGACCGAAAGGATGGACACG | Rev: CAGGCACAGTACCACGTTATC |
| Rad23b: | Fwd: ACCTTCAAGATCGACATCGACC | Rev: ACTTCTGACCTGCTACCGGAA |
| Rad51l3: | Fwd: GGAGCTTTGTGCCCAGTACC | Rev: TCCCCAATGTCCCAATGTCTAT |
| Xrcc1: | Fwd: AGCCAGGACTCGACCCATT | Rev: CCTTCTCCAACTGTAGGACCA |
| p16ink4a: | Fwd: GTGTGCATGACGTGCGGG | Rev: GCAGTTCGAATCTGCACCGTAG |
| Rad51: | Fwd: TCACCAGCGCCGGTCAGAGA | Rev: CCGGCCTAAAGGTGCCCTCG |
Additional files
-
Supplementary file 1
Cry1-associated proteins. Lysates from 293T cells expressing pcDNA3-2xFLAG with no insert (control) or Cry1 after the FLAG tag were used to purify control or Cry1-containing complexes by immunoprecipitation (IP) of the FLAG tag. Components of the resulting complexes were identified by mass spectrometry. The experiment was performed in triplicate and PatternLab for Proteomics (Carvalho et al.) was used to identify statistically enriched partners in Cry1-associated complexes compared to the control. Enrichment (Cry1/control) is the ratio of spectral counts in Cry1 vs control samples for all statistically enriched partners over three experiments.
- https://doi.org/10.7554/eLife.04883.023
-
Supplementary file 2
Cry2-associated proteins. Lysates from 293T cells expressing pcDNA3-2xFLAG with no insert (control) or Cry2 after the FLAG tag were used to purify control or Cry1-containing complexes by immunoprecipitation (IP) of the FLAG tag. Components of the resulting complexes were identified by mass spectrometry. The experiment was performed in triplicate and PatternLab for Proteomics (Carvalho et al.) was used to identify statistically enriched partners in Cry2-associated complexes compared to the control. Enrichment (Cry2/control) is the ratio of spectral counts in Cry2 vs control samples for all statistically enriched partners over three experiments.
- https://doi.org/10.7554/eLife.04883.024
-
Supplementary file 3
Chromatin binding of circadian transcription factors to loci encoding DNA repair proteins. Published data (Koike et al., 2012, Table S2) was searched for the text string ‘repair’ to make a preliminary identification of chromatin regions near genes involved in DNA repair that were found to be associated with each of the seven circadian transcription factors Cry1, Cry2, Per1, Per2, Clock, Npas2, and Bmal1.
- https://doi.org/10.7554/eLife.04883.025
