GATA6 regulates WNT and BMP programs to pattern precardiac mesoderm during the earliest stages of human cardiogenesis
Figures
GATA6 loss-of-function inhibits cardiomyocyte (CM) and cardiac progenitor cell (CPC) development.
(A) Schematic for in vitro CM-directed differentiation cytokine-based protocol (used throughout the study except for Figure 1—figure supplement 2B–E). Color gradients represent relative developmental stages (white: pluripotent; gray: mesoderm; yellow: cardiac mesoderm; pink: CPCs; and red: CMs). (B) Representative flow cytometry plots for cTnT+ CMs at day 14 of cardiac differentiation for GATA6+/+, GATA6+/-, and GATA6-/- hESCs. (C) %cTnT+ CMs quantified by flow cytometry between days 13 and 16 (dots indicate independent biological replicates). Significance indicated as ****p<0.0001 by two-way ANOVA with Tukey’s multiple-comparison test by genotype. There was no significant difference between clones of the same genotype when two-way ANOVA and Tukey’s multiple-comparison test were performed for all six sample groups. (D) Day 6 RT-qPCR for the CPC markers indicated normalized to GATA6+/+ (n = 6). (E) Day 6 RT-qPCR for heart field markers normalized to GATA6+/+ (n = 6). Data represents the mean ± SEM, significance indicated as *p<0.05, **p<0.01, ***p<0.001, ns indicates not significant as determined by one-way ANOVA and Tukey’s multiple-comparison test. The labels w4, w2 (wildtype), m2, m5 (heterozygous), and m11, m14 (homozygous) refer to the isogenic wildtype and mutant hESC clones (see Figure 1—figure supplement 1B).
-
Figure 1—source data 1
cTnT flow cytometry in panel C.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig1-data1-v1.xlsx
-
Figure 1—source data 2
RT-qPCR in panels D and E.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig1-data2-v1.xlsx
CRISPR gene editing and characterization of mutant GATA6 human embryonic stem cell (hESC) and induced pluripotent stem cell (iPSC) lines.
(A) GATA6 CRISPR targeting scheme using H1 iCas9 hESCs is described in Shi et al., 2017. Two CRISPR gRNAs were used targeting the C-terminal zinc finger domain (GATA6-Cr1 and Cr2 gRNA target sequence in green, red indicates the PAM). (B) Table describing H1-GATA6-hESC clonal lines, genotype designation, and gRNA used in gene editing. Predicted protein describes mutant alleles according to the Human Genome Variation Society (HGVS) guidelines, fs indicates frameshift mutation. (C) Western blots from GATA6+/+, GATA6+/-, and GATA6-/- protein lysates at day 2 or 5 of cardiac differentiation probed for GATA6 with β-actin used as a loading control. (D) Immunofluorescence for the sarcomere marker α-actinin and co-stained with DAPI on day 23 lactate-purified cardiomyocytes (CMs). (E) Schematic for CRISPR-based correction of the GATA6 c.1071delG iPSC mutant allele to WT sequence (GATA6corr/+). A pair of gRNAs flanking the G deletion site were used for targeting with Nickase-Cas9 and a WT repair template to allow for homology-directed repair (HDR) of the mutant allele. A single base substitution of G to A (indicated by brown) was used in the WT repair template to induce a silent mutation in the gRNA 2 recognition sequence to prevent additional Cas9 activity after HDR. (F) Table describing the GATA6 iPSC clonal lines. The GATA6 c.1071delG mutant allele is indicated as the protein V358Cfs (according to HGVS guidelines). (G) Immunofluorescence for the pluripotency markers NANOG or SOX2 on GATA6corr/+ or GATA61071delG/+ iPSC colonies. (H) Flow cytometry quantification for %cTnT+ CMs following cardiac directed differentiation for days 13–16 of GATA6corr/+ or GATA61071delG/+ iPSCs. Data represents the mean ± SEM, dots represent independent biological replicates. Significance defined as **p<0.01 using the two-tailed Student’s t-test. (I) Immunofluorescence for cTnT and co-stained with DAPI on day 23 lactate-purified iPSC-CMs. (J) Representative karyogram for GATA6corr/+ iPSCs. (K) Western blots from GATA6corr/+ or GATA61071delG/+ protein lysates at day 5 of cardiac differentiation probed for GATA6 with β-actin used as a loading control.
-
Figure 1—figure supplement 1—source data 1
Western blots in panels C and K.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig1-figsupp1-data1-v1.pdf
-
Figure 1—figure supplement 1—source data 2
cTnT flow cytometry in panel H.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig1-figsupp1-data2-v1.xlsx
-
Figure 1—figure supplement 1—source data 3
Original unmarked western blot images in panel K.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig1-figsupp1-data3-v1.zip
Cardiac progenitor cell (CPC) marker gene transcriptional analysis of GATA6 WT or mutant human embryonic stem cells (hESCs).
(A) RT-qPCR time course for CPC markers (and GATA6) in differentiating GATA6+/+, GATA6+/-, and GATA6-/- hESCs (normalized to day 2 WT gene expression levels). (B) Schematic for in vitro cardiomyocyte (CM)-directed differentiation CHIR protocol. (C) Principal component analysis (PCA) for comparisons of day 5 bulk RNA-seq from GATA6+/+, GATA6+/-, and GATA6-/- hESCs using the CHIR protocol (n = 2). (D) Gene ontology (GO) analysis for biological process (BP) using differentially expressed genes (DEGs) from day 5 RNA-seq comparing GATA6-/- to WT. (E) Heatmap for cardiac development related genes from day 5 RNA-seq. Color gradient indicates relative gene expression level. (F) RT-qPCR time course for ALDH1A2 transcript levels in differentiating GATA6+/+, GATA6+/-, and GATA6-/- hESCs using the cytokine-based protocol.
-
Figure 1—figure supplement 2—source data 1
RT-qPCR in panels A and F.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig1-figsupp2-data1-v1.xlsx
GATA6 is required for cardiac mesoderm development.
(A) Western blot time course using protein lysates from GATA6+/+ human embryonic stem cells (hESCs) probed for GATA6 with β-actin used as a loading control. (B) Flow cytometry quantification for % KDR and PDGFRα double-positive (%K+P+) cells from days 3–5 of cardiac differentiation of GATA6+/+, GATA6+/-, or GATA6-/- hESCs (n ≥ 4). Asterisks indicate statistical significance comparing GATA6-/- and WT on day 4 or 5 of cardiac differentiation. (C) Day 5 flow cytometry quantification for %K+P+ cells (n = 7). (D) Representative flow cytometry plots for day 5 %K+P+ cells. (E) Day 5 flow cytometry quantification (n = 7) for %KDR+ (left) or PDGFRα+ (right). (F) Representative flow cytometry plots for day 2 %BRACHYURY+ cells (red) overlaid IgG stained controls (blue). (G) Quantification for day 2 or day 3 %BRACHYURY+ cells (n = 4). (H) RT-qPCR for day 2 T, EOMES, MESP1, and MESP2 expression levels normalized to GATA6+/+ samples (n = 6). Data represents the mean ± SEM, with significance indicated as **p<0.01, ****p<0.0001, and ns indicating not significant by two-way ANOVA (B, G) or one-way ANOVA (C, E, H) with Tukey’s multiple-comparison test. The labels w4, w2 (wildtype), m2, m5 (heterozygous), and m11, m14 (homozygous) refer to the isogenic wildtype and mutant hESC clones (see Figure 1—figure supplement 1B).
-
Figure 2—source data 1
Western blots in panel A.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig2-data1-v1.pdf
-
Figure 2—source data 2
Flow cytometry in panels B, C, E and G.
First tab includes KP flow cytometry in panels B, C and E. Second tab includes BRACHYURY flow cytometry in panel G.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig2-data2-v1.xlsx
-
Figure 2—source data 3
RT-qPCR in panel H.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig2-data3-v1.xlsx
KDR and PDGFRα cardiac mesoderm analysis at day 4.
(A) Representative flow cytometry plots at day 4 of cardiac differentiation analyzing the % KDR and PDGFRα double-positive cells (%K+P+) from GATA6+/+, GATA6+/-, or GATA6-/- hESCs. (B) Quantification of day 4 flow cytometry data for %K+P+ double-positive, %KDR+ single positive, or %PDGFRα+ single-positive cells (n = 6). Data represent the mean ± SEM, with statistical significance indicated as *p<0.05 and ns indicating not significant by one-way repeated measures ANOVA with Holm–Šídák’s multiple-comparison test.
-
Figure 2—figure supplement 1—source data 1
KP flow cytometry in panel B.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig2-figsupp1-data1-v1.xlsx
Transcriptome analysis at early mesoderm patterning stages.
(A) Gene ontology (GO) analysis for biological process (BP) from decreased differentially expressed genes (dDEGs) identified comparing GATA6-/- to WT samples from day 2 RNA-seq data (left). Heatmap for genes related to BMP signaling from day 2 RNA-seq shown on the right. Color gradient on heatmap indicates relative gene expression levels. (B) GO analysis (BP) of increased DEGs identified comparing GATA6+/- to WT samples from day 2 RNA-seq (left). Heatmap for genes related to negative regulation of canonical WNT pathway from day 2 RNA-seq shown on the right. (C) Volcano plot for day 2 GATA6-/- sample RNA-seq gene expression data relative to WT controls. Dots represent genes, red indicates p-adj<0.05 and black indicates p-adj>0.05. (D) Gene set enrichment analysis (GSEA) (BP) of GATA6-/- cells relative to WT controls from day 3 RNA-seq data. NES indicates normalized enrichment score. (E) Heatmap for BMP signaling genes from day 3 RNA-seq data. (F) Western blots using protein lysates from GATA6+/+, GATA6+/- or GATA6-/- cells at day 2 of cardiac differentiation probed with antibodies recognizing phospho-SMAD1/5/9, phospho-SMAD2/3, total SMAD2/3, non-phospho-β-catenin, and total β-catenin with β-actin used as a loading control. (G) GSEA analysis of day 2 or 3 RNA-seq gene expression data (GATA6-/- relative to WT) using the day 2 lateral mesoderm (relative to human embryonic stem cell [hESC], left) and day 3 cardiac mesoderm (relative to day 2 lateral mesoderm, right) during hESC cardiac differentiation datasets from Koh et al., 2016. FDR indicates false discovery rate. (H) Heatmaps from RNA-seq day 2 (left) or 3 (right) data using core enrichment genes identified in (G) for lateral mesoderm (relative to hESCs) and cardiac mesoderm (relative to lateral mesoderm). (I) Heatmap showing enriched paraxial mesoderm gene expression in the mutant cells.
-
Figure 3—source data 1
Western blots in panel F.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig3-data1-v1.pdf
-
Figure 3—source data 2
Original unmarked western blot images in panel F.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig3-data2-v1.zip
RNA-seq analysis following cardiac differentiation at day 2 or 3.
(A) Number of differentially expressed genes (DEGs) identified when comparing GATA6+/- and GATA6-/- samples to GATA6+/+ controls from day 2 and 3 RNA-seq data. (B) Principal component analysis (PCA) for GATA6+/+, GATA6+/-, and GATA6-/- profiles from day 2 or 3 RNA-seq. Data is representative of at least two independent biological replicates per sample. (C) Day 2 and 3 GO (BP) analysis using dDEGs identified comparing GATA6+/- to WT samples. (D) Heatmaps for OFT septum morphogenesis and cardiac development related genes from day 3 RNA-seq. Color gradient indicates relative gene expression levels. (E) Venn diagram comparisons of dDEGs (relative to WT) identified by day 2 or 3 RNA-seq of GATA6+/- and GATA6-/- samples. (F) Volcano plots for day 2 or 3 GATA6+/- sample RNA-seq gene expression data relative to WT. Dots represent genes, red indicates p-adj<0.05, and black indicates p-adj>0.05. (G) Heatmaps for WNT and BMP related genes from day 2 RNA-seq. (H) Gene set enrichment analysis (GSEA) analysis of day 2 RNA-seq gene expression data (GATA6-/- relative to WT) using the GATA6, EOMES, and SMAD2/3 co-binding during hESC-DE differentiation dataset from Chia et al., 2019 and EOMES ME direct activation dataset from Tosic et al., 2019. NES indicates normalized enrichment score; FDR indicates false discovery rate.
GATA6 CUT&RUN analysis during early mesoderm patterning.
(A) Genomic distribution for significant GATA6 binding peaks identified by GATA6 CUT&RUN at day 2 of cardiac differentiation (n = 3). (B) Transcription factor motif enrichment at GATA6 bound loci. (C) Gene ontology (GO) (biological process [BP]) analysis of the gene list associated with significant GATA6 binding peaks. (D) Venn diagram comparisons for day 2 GATA6 CUT&RUN identified genes (green), day 2 decreased differentially expressed genes (dDEGs) (blue), and day 3 dDEGs (yellow) identified by RNA-seq (GATA6-/- relative to WT). (E) Human genome browser representations of GATA6 CUT&RUN data (blue tracks) aligned to select genes that are dDEGs identified by day 2 or 3 RNA-seq (GATA6-/- relative to WT). Orange rectangles represent approximate location for distal enhancer-like signatures (dELS) via the ENCODE Project. Asterisks indicate significant GATA6 binding peaks (p<0.003 relative to IgG controls). (F) Genes from the WNT and BMP signaling pathways that are significantly downregulated in the mutant cells compared to wildtype. Genes in red were found by CUT&RUN to have GATA6 binding peaks in associated putative enhancers and are therefore likely to be direct targets. (G) Venn diagram comparisons for day 2 GATA6 CUT&RUN identified genes (green), day 2 dDEGs (blue, GATA6-/- relative to WT), and EOMES-CHIP-seq identified genes at day 2 of hESC-DE differentiation from Teo et al., 2011 (yellow). Inlayed heatmap indicates GATA6+/+, GATA6+/- and GATA6-/- RNA-seq gene expression data at day 2 of cardiac differentiation for the 32 triple-overlap genes.
GATA6 CUT&RUN peaks overlap with previously published EOMES CHIP-seq peaks.
Human genome browser representations of GATA6 CUT&RUN data at day 2 of cardiac differentiation (blue tracks) and EOMES CHIP-seq identified genes at day 2 of hESC-DE differentiation from Teo et al., 2011 (red tracks). Orange rectangles represent approximate location for distal enhancer-like signatures (dELS) via the ENCODE Project (indicated by black arrows). Asterisks indicate significant GATA6 binding peaks (p<0.003 relative to IgG controls) and significant EOMES binding peaks as defined by Teo et al., 2011.
GATA6 interactome analysis during precardiac to cardiac mesoderm patterning stages.
(A) Venn diagrams showing unique proteins identified by RIME analysis performed on GATA6+/+ hESCs at day 2 or 4 of cardiac differentiation. Numbers in white text indicate enriched proteins identified by GATA6-RIME. G6 indicates GATA6, R indicates replicate (n = 2). (B) Enriched proteins identified by GATA6 RIME (spectral count >5, unique peptides >1). (C) Venn diagram comparing day 2 (blue) and 4 (yellow) GATA6-RIME-enriched proteins. (D) Gene ontology (GO) (biological process [BP]) analysis for GATA6-RIME-enriched proteins on day 2 or 4. (E) Western blots for GATA6, EOMES, and SMARCC1 performed on GATA6-immunoprecipitated (G6-IP) whole-cell protein lysates from GATA6+/+ and GATA6-/- cells isolated at day 2 of cardiac differentiation. Input indicates whole-cell protein lysate controls.
-
Figure 5—source data 1
Western blots (GATA6-IP) in panel E.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig5-data1-v1.pdf
-
Figure 5—source data 2
Original unmarked western blot images in panel E.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig5-data2-v1.zip
Extended GATA6-RIME analysis.
(A) Graph depicts GATA6-RIME-enriched proteins (spectral count) identified at day 2 of cardiac differentiation and their corresponding day 2 RNA-seq gene expression level significance (p-adj, GATA6-/- relative to WT). Dots indicate genes, black indicates p-adj>0.05, red indicates decreased expression level (p-adj<0.05), green indicates increased expression level (p-adj<0.5). (B) Venn diagram comparisons for GATA6-RIME-enriched proteins from day 2 (D2 G6) and 4 (D4 G6) of cardiac differentiation from the present study with day 4 GATA6-RIME (DE: D4 G6) or day 2 EOMES-RIME (DE: D2 EOMES) enriched proteins reported during hESC-DE differentiation from Heslop et al., 2021; Heslop et al., 2022. (C) Proteins identified in the Venn diagram comparisons of RIME data described in (B).
Early manipulation of the WNT and BMP pathways partially rescues the cardiomyocyte (CM) defects in GATA6 loss-of-function human embryonic stem cells (hESCs).
(A) Schematic for treatment with DOX (days 1–4), CHIR (3 μM, days 0–2), and/or reduced BMP4 (5 ng/mL, days 0–2, indicated as ‘LB’) during CM directed differentiation using the cytokine-based protocol. (B) Day 5 flow cytometry quantification for %K+P+ double-positive cells, %KDR+ single-positive cells, or %PDGFRα+ single-positive cells in WT or GATA6-/- hESCs transduced with iLGR5 or empty vector (EV) (n = 5). Significance indicated by *p<0.05 according to one-way ANOVA and Tukey’s post hoc analysis. (C) %cTnT+ CMs from days 13–18 of cardiac differentiation quantified by flow cytometry in WT or GATA6-/- cells treated with CHIR LB or vehicle (DMSO) with normal BMP4 concentration treated control (n ≥ 6). (D) Flow cytometry at day 5 of cardiac differentiation to quantify %K+P+ double-positive, %KDR+ single-positive, or %PDGFRα+ single-positive cells comparing WT or GATA6-/- hESCs treated with CHIR LB with GATA6+/+ and GATA6-/- hESCs controls treated with vehicle and normal BMP4 concentration (n ≥ 8). (E) %cTnT+ CMs from days 13–18 of cardiac differentiation quantified by flow cytometry in GATA6+/- or WT hESCs treated with CHIR (3 μM) or DMSO (n ≥ 7). Data represents the mean ± SEM, significance indicated by **p<0.01, ***p<0.001, ****p<0.0001 by two-tailed Student’s t-test (C) and two-way ANOVA (D, E) with Tukey’s multiple-comparison test.
-
Figure 6—source data 1
Flow cytometry in panels B-E.
First tab includes KP flow cytometry in panels B and D. Second tab includes cTnT flow cytometry in panels C and E.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig6-data1-v1.xlsx
Extended data for iLGR5 and early CHIR treatment.
(A) RT-qPCR time course for relative LGR5 expression in differentiating GATA6+/+, GATA6+/-, and GATA6-/- human embryonic stem cells (hESCs) normalized to day 2 WT gene expression level (on left). Day 2 RT-qPCR quantification for relative LGR5 expression level normalized to WT (on right, n = 6). (B) Day 4 RT-qPCR for relative LGR5 expression level (normalized to WT) in iLGR5 or EV transduced GATA6-/- hESCs treated with or without varying concentrations of DOX (30, 125, and 250 indicate ng/mL concentrations of DOX). (C) %cTnT+ CMs from days 13–17 of cardiac differentiation quantified by flow cytometry in GATA6-/- cells treated with CHIR (3 μM) or vehicle (n≥8). (D) Flow cytometry quantification for %K+P+ double-positive cells at day 5 of cardiac differentiation from GATA6-/- hESCs treated with CHIR and vehicle-treated GATA6+/+ or GATA6-/- hESCs controls (n ≥ 3). Data represents the mean ± SEM, significance indicated by *p<0.05, **p<0.01, ***p<0.001, by two-tailed Student’s t-test (C) or one-way ANOVA with Tukey’s multiple-comparisons test (A, D).
-
Figure 6—figure supplement 1—source data 1
RT-qPCR in panels A and B.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig6-figsupp1-data1-v1.xlsx
-
Figure 6—figure supplement 1—source data 2
cTnT and KP flow cytometry in panels C and D.
- https://cdn.elifesciences.org/articles/100797/elife-100797-fig6-figsupp1-data2-v1.xlsx
Videos
Inclusion of CHIR (3 μM) from days 0–2 in differentiating GATA6-/- human embryonic stem cells (hESCs) yielded by day 13 small clusters of beating cardiomyocytes (CMs).
Shown is a representative cluster at day 16, ×10 magnification.
Decreasing the BMP4 concentration (5 ng/mL) combined with CHIR treatment yielded small clusters of beating cardiomyocytes (CMs) from GATA6-/- cells more consistently than increasing the BMP4 concentration or treatment with CHIR on its own.
Shown is a representative cluster at day 18, ×40 magnification.
Tables
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | GATA6 | GenBank | GATA binding protein 6 | |
| Gene (H. sapiens) | LRG5 | GenBank | Leucine-rich repeat containing G protein-coupled receptor 5 | |
| Strain, strain background (Escherichia coli) | One Shot TOP10 | Thermo Fisher | C404006 | Chemically competent cells |
| Cell line (H. sapiens) | H1 (NIH:0043) | WiCell | WA01 | Human embryonic stem cells |
| Cell line (H. sapiens) | Dermal fibroblast (normal, adult) | PCGC study patient | This study | Used to generate iPSC line |
| Cell line (H. sapiens) | iPSC line | Mutant GATA6 allelle c1071 delG | This study | See Data availability |
| Cell line (H. sapiens) | iPSC line | Allele reverted to wildtype | This study | See Data availability |
| Cell line (H. sapiens) | 293T | ATCC | CRL-11268 | |
| Biological sample (Mus musculus) | CF1 mouse embryonic fibroblasts | Thermo Fisher | A34180 | Primary cells |
| Transfected construct | pSpCas9n(BB)-2A-Puro (PX462) V2.0 | Addgene | 62987 | CRISPR vector for Nickase-Cas9 |
| Transfected construct (human) | CS-TRE-PRE-Ubc-tTA-I2G | Addgene | Derived from 198058 | Lentiviral vector for inducible expression of LGR5 |
| Antibody | Anti-human GATA6 (rabbit monoclonal) | Cell Signaling Technology | 5851 | WB (1:1000) RIME: 15 ug |
| Antibody | Anti-IgG control (rabbit monoclonal) | Cell Signaling Technology | 2729 | WB (1:1000) RIME: 15 ug |
| Antibody | See Supplementary file 2 for a full list of antibodies | |||
| Sequence-based reagent | gRNAs | Integrated DNA Technologies | See Supplementary file 2 for a full list of guide RNAs | |
| Sequence-based reagent | qPCR primers | Integrated DNA Technologies | See Supplementary file 2 for a full list of qPCR primers | |
| Sequence-based reagent | Donor sequence to correct mutant allele | Integrated DNA Technologies | GGCGCCACTGACGCCTGCCTGGCCCGCCGGACCCTTCGAGACCCCGGTGCTGCACAGCCTACAGAGCCGCGCCGGAGCCCCGCTCCCGGTG | See Supplementary file 2 |
| Peptide, recombinant protein | bFGF | R&D Systems | 233-FB-025 | |
| Peptide, recombinant protein | Activin A | R&D Systems | 338-AC-050 | |
| Peptide, recombinant protein | BMP4 | R&D Systems | 314BP-050 | |
| Peptide, recombinant protein | VEGF | R&D Systems | 293-VE-050 | |
| Commercial assay or kit | CytoTune-iPS 2.0 Sendai Reprogramming Kit | Invitrogen | A16517 | For generating iPSC lines |
| Commercial assay or kit | T7 endonuclease I assay | New England Biolabs | M0302S | For indel detection |
| Commercial assay or kit | QuickExtract DNA Extraction Solution | Biosearch Technologies | QE09050 | DNA purification |
| Commercial assay or kit | SuperScript VILO cDNA Synthesis Kit | Invitrogen | 11754250 | cDNA generation |
| Commercial assay or kit | LightCycler 480 SYBR Green Master mix | Roche | 04887-352-001 | qPCR assays |
| Commercial assay or kit | Pierce Crosslink Magnetic IP/Co-IP Kit | Thermo Fisher | 88805 | Co-IP assays |
| Commercial assay or kit | TruSeq RNA Library Prep Kit v2 | Illumina | RS-122-2001 | Sequencing libraries |
| Commercial assay or kit | TruSeq Stranded mRNA Library Prep Kit | Illumina | 20020594 | Sequencing libraries |
| Commercial assay or kit | NEBNext Ultra II DNA Library Prep Kit | New England Biolabs | E7645 | CUT&RUN libraries |
| Commercial assay or kit | NEBNext Multiplex Oligos for Illumina | New England Biolabs | E6440 | CUT&RUN libraries |
| Commercial assay or kit | CUTANA ChIC/CUT&RUN Kit | Epicypher | 14-1048 | CUT&RUN |
| Commercial assay or kit | LookOut Mycoplasma PCR Detection Kit | Stem Cell Technologies | 1000276 | |
| Commercial assay or kit | Pierce BCA Protein Assay Kit | Thermo Fisher | 23225 | |
| Commercial assay or kit | Pierce ECL Western Blotting Substrate | Thermo Fisher | 32106 | |
| Chemical compound, drug | Y-27632 | Selleckchem | S1049 | ROCK inhibitor |
| Chemical compound, drug | Puromycin | Sigma-Aldrich | P8833 | Selection |
| Chemical compound, drug | XAV-939 | Sigma-Aldrich | X3004 | Tankyrase inhibitor |
| Chemical compound, drug | CHIR99021 | Stem Cell Technologies | 72054 | GSK-3 inhibitor |
| Chemical compound, drug | IWP2 | Tocris | 3533 | Porcupine inhibitor |
| Software, algorithm | ImageStudio | LI-COR | V5.2 | |
| Software, algorithm | Photoshop | Adobe | V25.9.1 | |
| Software, algorithm | bcl2fastq | Illumina | V2.19 | |
| Software, algorithm | STAR | Github | V2.5.2 | |
| Software, algorithm | Cufflinks | Github | V2.1.1 | |
| Software, algorithm | HTSeq-count | Github | V0.11.2 | |
| Software, algorithm | GSEA | Broad Institute | V4.2.3 | |
| Software, algorithm | Gene Ontology | Database for Annotation, Visualization, and Integrated Discovery | David.ncifcrf.gov | |
| Software, algorithm | SRplot | bioinformatics.com.cn/srplot | ||
| Software, algorithm | Prism | GraphPad | v.10.2.3 | |
| Other | Matrigel | Corning | BD354277 | Reagent |
| Other | StemFlex Medium | Thermo Fisher | A3349401 | Medium |
| Other | mTESR Plus Medium | Stem Cell Technologies | 1000276 | Medium |
| Other | mTESR1 medium | Stem Cell Technologies | 85850 | Medium |
| Other | Accutase Cell Detachment Solution | Selleckchem | S1049 | Reagent |
| Other | DMEM/F12 medium | VWR | 16777-255 | Medium |
| Other | KnockOut serum replacement medium | Thermo Fisher | 10828010 | Medium |
| Other | RPMI 1640 medium | Thermo Fisher | 2240089 | Medium |
| Other | B27 | Thermo Fisher | 17504044 | Medium additive |
| Other | B27-insulin | Thermo Fisher | A1895601 | Medium additive |
| Other | Sodium l-lactate | Sigma-Aldrich | L7022 | Medium additive |
| Other | Human albumin | Sigma-Aldrich | A9731 | Medium additive |
| Other | 1-Thioglycerol | Sigma-Aldrich | M6145 | Medium additive |
| Other | GlutaMAX | Thermo Fisher | 35050061 | Medium additive |
| Other | Transferrin | Roche | 10652202001 | Medium additive |
| Other | Trypsin/EDTA | VWR | 45000-664 | Reagent |
| Other | TrypLE Express Enzyme | Thermo Fisher | 12605010 | Reagent |
| Other | Saponin | Sigma-Aldrich | S7900-25G | Reagent |
| Other | RIPA Lysis Buffer | Thermo Fisher | 89900 | Reagent |
| Other | Protease/Phosphatase Inhibitor Cocktail | Cell Signaling Technology | 5872S | Reagent |
| Other | Lenti-X concentrator | Takara | 631231 | Assay kit |
| Other | Formaldehyde | Electron Microscopy Services | 15710 | Chemical |
Additional files
-
Supplementary file 1
GATA6-RIME-enriched proteins at day 2 or day 4 of cardiac differentiation.
- https://cdn.elifesciences.org/articles/100797/elife-100797-supp1-v1.docx
-
Supplementary file 2
Cell lines, primer sequences, and antibodies used in this study.
- https://cdn.elifesciences.org/articles/100797/elife-100797-supp2-v1.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/100797/elife-100797-mdarchecklist1-v1.pdf