1. Cancer Biology
  2. Cell Biology

N6-methyladenosine in DNA promotes genome stability

  1. Brooke A Conti  Is a corresponding author
  2. Leo Novikov
  3. Deyan Tong
  4. Qing Xiang
  5. Savon Vigil
  6. Thomas J McLellan
  7. Chuong Nguyen
  8. Nancy De La Cruz
  9. Reshma T Veettil
  10. Prashant Pradhan
  11. Parag Sahasrabudhe
  12. Jason D Arroyo
  13. Lei Shang
  14. Benjamin R Sabari
  15. David J Shields
  16. Mariano Oppikofer  Is a corresponding author
  1. Centers for Therapeutic Innovation, Emerging Sciences and Innovation, Pfizer, United States
  2. Target Sciences, Emerging Sciences and Innovation, Pfizer, United States
  3. Discovery Sciences, Pfizer, United States
  4. Laboratory of Nuclear Organization, Cecil H. and Ida Green Center for Reproductive Biology Sciences, Division of Basic Research, Department of Obstetrics and Gynecology, Department of Molecular Biology, Hamon Center for Regenerative Science and Medicine, University of Texas Southwestern Medical Center, United States
https://doi.org/10.7554/eLife.101626.3
Share this article
Cite this article
  1. Brooke A Conti
  2. Leo Novikov
  3. Deyan Tong
  4. Qing Xiang
  5. Savon Vigil
  6. Thomas J McLellan
  7. Chuong Nguyen
  8. Nancy De La Cruz
  9. Reshma T Veettil
  10. Prashant Pradhan
  11. Parag Sahasrabudhe
  12. Jason D Arroyo
  13. Lei Shang
  14. Benjamin R Sabari
  15. David J Shields
  16. Mariano Oppikofer
(2025)
N6-methyladenosine in DNA promotes genome stability
eLife 13:RP101626.
https://doi.org/10.7554/eLife.101626.3
  2. Download BibTeX
  3. Download .RIS
5 figures, 1 table and 5 additional files

Figures

Figure 1 with 1 supplement
Download asset Open asset
Whole-genome CRISPR screen identifies N6-methyltransferases in repair of floxuridine-induced DNA lesions.

(A) Schematic of whole-genome CRISPR screen in HT-29 cells reported in B. (B) Volcano plot displaying MAGeCK gene level log2(fold change) for each gene in treated and untreated arms versus −log10(p-value). Cut-off displays genes with log2(fold change) >|0.5| and −log10(p-value) >2. Genes whose loss sensitizes cells to floxuridine skew to the left. Non-targeting guides are shown in light gray and fall below cut-off values. Essential genes also performed as expected, dropping out at later time points (data not shown). (C) KEGG pathway analysis for genes that sensitize cells to floxuridine with log2(fold change) >|0.5| and −log10(p-value) >2. Flox, floxuridine; FDR, false discovery rate.

Figure 1—figure supplement 1
Download asset Open asset
Generation of mCherry-tagged UNG KO DLD-1 cells.

(A) Percentage of reads from sequencing of DLD-1 cells after gene editing corresponding to gene transcripts that are unmodified, modified in in-frame, contain a frameshift, or are noncoding. (B) Representative immunoassay using the Simple Western Jess system showing protein expression levels of UNG in two HPRT-targeted and two UNG-targeted clones from A. α-Tubulin represents loading control. (C) Representative immunoblot showing protein expression levels of UNG2-mCherry (UNG) or mCherry empty vector (EV) constructs expressed in UNG KO DLD-1 cells. α-Tubulin represents loading control.

Figure 1—figure supplement 1—source data 1

Source data for panel B.

https://cdn.elifesciences.org/articles/101626/elife-101626-fig1-figsupp1-data1-v1.zip
Figure 2 with 1 supplement
Download asset Open asset
Discovery-based proteomics identifies N6-methyltransferases at sites of UNG2-seeded condensates.

(A) Representative images from DLD-1 UNG KO cells expressing indicated mCherry-tagged cDNAs upon treatment with increasing concentrations of floxuridine at 64 hr post-treatment. (B) Quantification of experiment represented in A for percentage of cells with >5 mCherry foci. Error bars, mean ± SEM; ordinary one-way ANOVA with Dunnett’s multiple comparisons test with a single pooled variance, ***p ≤ 0.001, n = 3 biological replicates. Statistical tests performed within individual groups, EV or UNG2, respectively. (C) PONDR VSL2 plot of disorder for UNG2. (D) Representative schematic of mutant UNG2 cDNA constructs expressed in UNG KO DLD-1 cells in E. IDR-only cDNA lacks amino acids 93-313, ∆IDR cDNA lacks amino acids 1–92, and IDR-C cDNA moved amino acids 1–92 to the C-terminus. (E) Representative images from DLD-1 UNG KO cells expressing indicated mCherry-Cry2-tagged cDNAs without or with stimulation of blue light for 60 s. While ∆IDR and EV images display cytoplasmic foci, these lack the distinct nuclear foci patterning observed for UNG2, IDR, and IDR-C constructs. (F) Schematic of proximity biotinylation of IDR interaction partners in cells. (G) Venn diagrams of factors identified by stable isotope labeling of amino acids in cell culture (SILAC)-based mass spectrometry (MS) with 1 > log2(L/H), reflecting a fourfold enrichment in UNG-IDR/Control, from two biological replicates. n.s., non-statistically significant; Flox, floxuridine; EV, empty vector; IDR, intrinsically disordered region.

Figure 2—source data 1

Source data for panel B.

https://cdn.elifesciences.org/articles/101626/elife-101626-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Download asset Open asset
UNG2 responds to uracil-based DNA damage in a manner partly dependent on its intrinsically disordered region.

(A) Percentage of EdU+ cells in indicated DLD-1 cells. Cells were pulsed with 10 μM EdU prior to fixation and staining with Invitrogen Click-It Alexa Fluor 488 Kit. HPRT indicates WT cells. These cells were targeted with a cutting control targeting to the intronic region of HPRT gene. (B) Representative images from DLD-1 UNG KO cells expressing indicated mCherry-tagged cDNAs upon treatment with increasing concentrations of RTX at 64 hr post-treatment. (C) Quantification of experiment represented in A for percentage of cells with >5 mCherry foci. Error bars, mean ± SEM; ordinary one-way ANOVA with Dunnett’s multiple comparisons test with a single pooled variance, **p ≤ 0.01, n = 3 biological replicates. Statistical tests performed within individual groups, EV or UNG2, respectively. (D) Representative images of mCherry staining in DLD-1 UNG KO cells expressing UNG2 or EV constructs upon treatment with indicated compounds at 64 hr. (E) Quantification of experiment represented in D for percentage of cells with >5 mCherry foci. Error bars, mean ± SEM; ordinary one-way ANOVA with Dunnet’s multiple comparisons test with a single pooled variance, **p ≤ 0.01, n = 3 biological replicates. (F) Representative images of yH2AX staining in DLD-1 UNG KO cells expressing UNG2-mCherry constructs upon treatment with indicated compounds at 64 hr from the same experiment as D, E. (G) Quantification of experiment represented in F for average mean nuclear intensity. Error bars, mean ± SEM; ordinary one-way ANOVA with Tukey’s multiple comparisons test with a single pooled variance, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001, n = 3 biological replicates for all except HU where n = 2 biological replicates. (H) MTS cell proliferation in DLD-1 UNG KO cells expressing indicated mCherry-Cry2-tagged cDNAs upon treatment with floxuridine at increasing concentrations. Error bars, mean ± SEM. n = 4 biological replicates. (I) KEGG pathway analysis for genes that sensitize cells to floxuridine with log2(foldchange) >|0.5| and −log10(p-value) >2. RTX, raltitrexed; Flox, floxuridine; EV, empty vector; IDR, intrinsically disordered region; FDR, false discovery rate.

Figure 2—figure supplement 1—source data 1

Source data for panels A, C, E, G and H.

https://cdn.elifesciences.org/articles/101626/elife-101626-fig2-figsupp1-data1-v1.xlsx
Figure 3 with 1 supplement
Download asset Open asset
METTL3 deposits N6-methyladenosine in DNA in response to agents that increase genomic uracil.

(A) Representative immunoblot images from DLD-1 cells nucleofected with ribonucleoproteins containing Cas9 and indicated guide RNAs (gRNA) as performed for B. α-Tubulin represents loading control. (B) MTS cell viability assay in the presence of floxuridine. Error bars, mean ± SEM, n = 2 biological replicates. (C) Growth curves in DLD-1 cells upon treatment with 15 μM METTL3 inhibitor and indicated drug concentration post-treatment. Error bars, mean ± SEM, n = 3 biological replicates. (D) Representative images from DLD-1 UNG KO upon treatment with floxuridine for 66 hr. Prior to staining with N6-methyladenosine antibody, indicated samples were treated with RNase A or DNase. (E) Quantification of experiment represented in D for a percentage of cells with >5 N6-methyladenosine foci. Error bars, mean ± SEM; repeated measures one-way ANOVA with Dunnet’s multiple comparisons test with a single pooled variance, *p ≤ 0.05, n = 5 biological replicates. (F) Schematic of the experiment shown in G. DLD-1 cells were treated with DMSO, 500 nM floxuridine, or 500 nM raltitrexed for 72 hr. Cells were washed, collected, and DNA was purified and digested with DNA degradase plus enzyme prior to separation and quantification by ultra-performance liquid chromatography–mass spectrometry (UPLC–MS/MS). (G) The ratio of 6mA analyte to dA analyte as detected in DNA of DLD-1 cells upon treatment with 500 nM floxuridine or 500 nM raltitrexed using UPLC–MS/MS. ****p ≤ 0.0001, n = 3 biological replicates. (H) Representative images of 6mA staining in DLD-1 UNG KO cells upon treatment with 500 nM of floxuridine and 30 μM METTL3 inhibitor at 64 hr. (I) Quantification of experiment represented in G for a percentage of cells with >10 6mA foci. Error bars, mean ± SEM; ordinary one-way ANOVA with Dunnett’s multiple comparisons test with a single pooled variance, *p ≤ 0.05, n = 3 biological replicates. HPRT, cutting control targeting intronic region of HPRT gene; Flox, floxuridine; RTX, raltitrexed; METTL3i, METTL3 inhibitor.

Figure 3—source data 1

Source data for panels B, E and I.

https://cdn.elifesciences.org/articles/101626/elife-101626-fig3-data1-v1.zip
Figure 3—source data 2

Source data for panel A.

https://cdn.elifesciences.org/articles/101626/elife-101626-fig3-data2-v1.xlsx
Figure 3—figure supplement 1
Download asset Open asset
N6-methyladenosine foci in response to genomic uracil-inducing agents are not RNA:DNA hybrids.

(A) MTS cell proliferation in SW620 cells upon treatment with 15 μM METTL3 inhibitor and indicated compounds. Error bars, mean ± SEM, n = 3, technical replicates, representative of three biological replicates. Representative of three biological replicates. (B) Representative immunoblot images from DLD-1 cells nucleofected with ribonucleoproteins containing Cas9 and indicated guide RNAs (gRNA) as performed for C. Antibodies used for blotting indicated on the left. α-Tubulin represents loading control. (C) Growth curves in DLD-1 cells upon treatment of floxuridine. Error bars, mean ± SD, n = 3 technical replicates. (D) Representative images of immunofluorescence staining with anti-N6-methyladenosine antibody in DLD-1 cells after fixation and permeabilization but without pre-extraction in the presence or absence of floxuridine. (E) Agarose gel showing 1 μg of RNA extracted from whole cells with or without treatment with RNase A for 1 hr prior to loading on gel. (F) Representative images from DLD-1 cells upon treatment with floxuridine or raltitrexed for 66 hr. Prior to staining with anti-N6-methyladenosine antibody, indicated samples were treated with RNase H. (G) Quantification of experiment represented in F for a percentage of cells with >10 N6-methyladenosine foci. Error bars, mean ± SEM; ordinary one-way ANOVA with Tukey’s multiple comparisons test with a single pooled variance, *p ≤ 0.05, ****p ≤ 0.0001, n = 3 biological replicates for floxuridine treatment and n = 4 biological replicates for DMSO and raltitrexed treatment. (H) Quantification of mean nuclear DAPI staining from experiment in Figure 3D, E. Error bars, mean ± SEM; Krustal–Wallace with Dunn’s multiple comparisons test, **p ≤ 0.01, n = 5 biological replicates. (I) Representative images from DLD-1 cells upon treatment with raltitrexed for 66 hr. Prior to staining with anti-N6-methyladenosine antibody, indicated samples were treated with RNase A or DNase. (J) Quantification of experiment represented in I for percentage of cells with >5 N6-methyladenosine foci. Error bars, mean ± SEM; RM one-way ANOVA with Dunnet’s multiple comparisons test with a single pooled variance, ***p ≤ 0.001, n = 4 biological replicates. (K) Representative images from DLD-1 cells upon treatment with raltitrexed for 66 hr in the presence or absence of METTL3 inhibitor. (L) Quantification of experiment represented in K for percentage of cells with >10 6 mA foci. Error bars, mean ± SEM; ordinary one-way ANOVA with Dunnet’s multiple comparisons test with a single pooled variance, *p ≤ 0.05, ***p ≤ 0.001, n = 4 biological replicates. Flox, floxuridine; RTX, raltitrexed.

Figure 3—figure supplement 1—source data 1

Source data for panels A, G, H.

https://cdn.elifesciences.org/articles/101626/elife-101626-fig3-figsupp1-data1-v1.zip
Figure 3—figure supplement 1—source data 2

Source data for panel B.

https://cdn.elifesciences.org/articles/101626/elife-101626-fig3-figsupp1-data2-v1.xlsx
Figure 4 with 1 supplement
Download asset Open asset
6mA promotes uracil repair upstream of UNG2 in uracil base excision repair.

(A) Representative images of mCherry staining in DLD-1 UNG KO cells expressing UNG2-mCherry cDNAs upon treatment with 500 nM floxuridine and 30 μM METTL3 inhibitor at 64 hr. (B) Quantification of experiment represented in A for percentage of cells with >5 mCherry foci. Error bars, mean ± SEM; ordinary one-way ANOVA with Tukey’s multiple comparisons test with a single pooled variance, *p ≤ 0.05, ***p ≤ 0.001, n = 3 biological replicates. (C) Real-time quantitative PCR from A, B for UNG2 transcript levels normalized to tubulin controls. Error bars, mean ± SEM; Mann–Whitney t-test for the following pairs: DMSO versus METTL3 inhibitor and floxuridine versus floxuridine + METTL3 inhibitor. *p ≤ 0.05, n = 3 biological replicates except for the floxuridine only condition which includes n = 2 biological replicates. (D) Representative images of 6mA staining in DLD-1 UNG KO cells upon treatment with 500 nM floxuridine at 64 hr. HPRT indicates wild-type cells. These cells were targeted with a cutting control targeting the intronic region of HPRT gene. (E) Quantification of experiment represented in D for percentage of cells with >5 6 mA foci. Error bars, mean ± SEM; RM one-way ANOVA with Dunnet’s multiple comparisons test with a single pooled variance, *p ≤ 0.05, n = 5 biological replicates. Flox, floxuridine; METTL3i, METTL3 inhibitor.

Figure 4—source data 1

Source data for panels B, C, and E.

https://cdn.elifesciences.org/articles/101626/elife-101626-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Download asset Open asset
The presence of 6mA does not alter UNG-binding kinetics.

(A) Representative immunoblot of whole-cell lysates from DLD-1 cells in the presence or absence of METTL3 inhibitor blotted with UNG or β-actin antibodies. β-Actin represents loading control. (B) Equilibrium dissociation constants (KD) measured by biolayer interferometry for binding of UNG to indicated dsDNA templates. Mean ± SEM for n = 3 biological replicates displayed in the table. (C) Equilibrium dissociation constants (Kd) measured by biolayer interferometry for binding of UNG to indicated ssDNA templates. Mean ± SEM for n = 2 biological replicates displayed in the table.

Figure 4—figure supplement 1—source data 1

Source data for panel A.

https://cdn.elifesciences.org/articles/101626/elife-101626-fig4-figsupp1-data1-v1.zip
Figure 5 with 1 supplement
Download asset Open asset
6mA promotes genome repair of base damage beyond uracil incorporation.

(A–C) MTS cell viability in SW620 cells upon treatment with METTL3 inhibitor and indicated concentrations of drugs. Error bars, mean ± SEM, n = 3, technical replicates, representative of three biological replicates. (D) Representative images of 6mA staining in DLD-1 UNG KO cells upon treatment with indicated DNA damaging agents at 64 hr. (E) Quantification of experiment represented in D for percentage of cells with >5 6 mA foci. Error bars, mean ± SEM; ordinary one-way ANOVA with Dunnet’s multiple comparisons test with a single pooled variance, **p ≤ 0.01, n = 3 biological replicates for all except for the HU condition which includes n = 2 biological replicates. (F) Schematic of colony formation assay. SW620 cells, maintained in HAT media, were treated with 30 μM of METTL3 inhibitor for 7 days. 0.5 × 104 METTL3 inhibitor-treated cells seeded in the presence of 5 μM 6-thioguanine (TG) and colony formation assay was assessed after 14 days. 0.5 × 102 METTL3 inhibitor-treated cells were seeded for untreated controls. (G) Representative dishes after 14 days of growth in 5 μM TG as described in F. (H) Quantitation of mutation frequency from G. Mutation frequency was calculated by normalizing to the untreated controls. Error bars, mean ± SEM; paired t-test, **p ≤ 0.01, n = 3 biological replicates. HU, hydroxyurea; Gem, gemcitabine; MMC, mitomycin C; METTL3i, METTL3 inhibitor.

Figure 5—source data 1

Source data for panels A–C and E.

https://cdn.elifesciences.org/articles/101626/elife-101626-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Download asset Open asset
6mA foci, but not UNG2 foci, correlate with DNA damage levels.

(A) Representative images of yH2AX staining in DLD-1 cells upon treatment with indicated compounds at 64 hr from the same experiment as Figure 5D, E. (B) Quantification of experiment represented in A for average mean nuclear intensity. Error bars, mean ± SEM; ordinary one-way ANOVA with Tukey’s multiple comparisons test with a single pooled variance, **p ≤ 0.01, ***p ≤ 0.001, n = 3 biological replicates for all except HU where n = 2 biological replicates. (C). Co-staining with anti-mCherry and anti-N6-methyladenosine antibodies in cells treated with indicated drugs. Green arrows indicate cells where both mCherry and 6mA staining are present and white arrows indicate cells where only 6mA staining is present. Flox, floxuridine; RTX, raltitrexed; HU, hydroxyurea; Gem, gemcitabine; MMC, mitomycin C.

Figure 5—figure supplement 1—source data 1

Source data for panel B.

https://cdn.elifesciences.org/articles/101626/elife-101626-fig5-figsupp1-data1-v1.xlsx

Tables

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (Homo sapiens)Human: DLD-1ATCCCatalog # CCL-221, RRID:CVCL_0248
Cell line (Homo sapiens)Human: HT-29ATCCCatalog # HTB-38, RRID:CVCL_0320
Cell line (Homo sapiens)Human: SW620ATCCCatalog # CCL-227, RRID:CVCL_0547
Cell line (Homo sapiens)Human: U2OS 2-6-3Spector LabPMID:15006351
Transfected construct (Homo sapiens)Human: DLD-1 UNG KO Clone E7This paperThis paperPfizer, Inc
Transfected construct (Homo sapiens)Human: DLD-1 UNG KO Clone E7 + pMCS_UNG2_AID_mCherryThis paperThis paperPfizer, Inc
Transfected construct (Homo sapiens)Human: DLD-1 UNG KO Clone E7 + pMCS_AID_mCherryThis paperThis paperPfizer, Inc
Transfected construct (Homo sapiens)Human: DLD-1 UNG KO Clone E7 + pCMV_Cry2_mCherry_EVThis paperThis paperPfizer, Inc
Transfected construct (Homo sapiens)Human: DLD-1 UNG KO Clone E7 + pCMV_Cry2_mCherry_UNG2This paperThis paperPfizer, Inc
Transfected construct (Homo sapiens)Human: DLD-1 UNG KO Clone E7 + pCMV_Cry2_mCherry_UNG2_IDRThis paperThis paperPfizer, Inc
Transfected construct (Homo sapiens)Human: DLD-1 UNG KO Clone E7 + pCMV_Cry2_mCherry_UNG2_DIDRThis paperThis paperPfizer, Inc
Transfected construct (Homo sapiens)Human: DLD-1 UNG KO Clone E7 + pCMV_Cry2_mCherry_UNG2_IDR-CThis paperThis paperPfizer, Inc
Transfected construct (Homo sapiens)Human: DLD-1 UNG KO Clone E7 + pCMV_Cry2_mCherry_UNG2_ DPIPThis paperThis paperPfizer, Inc
Transfected construct (Homo sapiens)Human: DLD-1 UNG KO Clone E7 + pCMV_Cry2_mCherry_UNG2_ DRPAThis paperThis paperPfizer, Inc
Transfected construct (Homo sapiens)Human: HT-29 pLenti7-EF1a-Cas9This paperThis paperPfizer, Inc
Transfected construct (Homo sapiens)Human: U2OS 2-6−3+GFP-LacI-APEX2-UNG2IDRThis paperThis paperPfizer, Inc
Recombinant DNA reagentpCMV-Gag-PolCellBioLabsCatalog # RV-111Sabari Lab
Recombinant DNA reagentpCMV-VSV-GCellBioLabsCatalog # RV-110
Recombinant DNA reagentpLenti-EF1a-Cas9Pfizer#5342
Recombinant DNA reagentCustom sgRNA libraryDeskGenThis paper
Recombinant DNA reagentpMCS-Puro Retroviral VectorCellBio LabsCatalog # RTV-041Pfizer, Inc
Recombinant DNA reagentpMCS_AID_mCherry_Puro Retroviral VectorAzenta Life SciencesN/A – C096 – see Supplementary file 4
Recombinant DNA reagentpMCS_UNG2_AID_mCherry Retroviral VectorAzenta Life SciencesN/A – C096 – see Supplementary file 4
Recombinant DNA reagentpLenti-GIII-CMVApplied Biological Materials16422061
Recombinant DNA reagentpLenti-CMV-Cry2-mCherry-SV40-Puro (EV) Lentiviral VectorApplied Biological MaterialsN/A – C096 – see Supplementary file 4
Recombinant DNA reagentpLenti-CMV-Cry2-mCherry-UNG2-SV40-Puro Lentiviral VectorApplied Biological MaterialsN/A – C096 – see Supplementary file 4
Recombinant DNA reagentpLenti-CMV-Cry2-mCherry-UNG2-IDR-SV40-Puro Lentiviral VectorApplied Biological MaterialsN/A – C096 – see Supplementary file 4
Recombinant DNA reagentpLenti-CMV-Cry2-mCherry-UNG2-DIDR-SV40-Puro Lentiviral VectorApplied Biological MaterialsN/A – C096 – see Supplementary file 4
Recombinant DNA reagentpLenti-CMV-Cry2-mCherry-UNG2-IDR-C-SV40-Puro Lentiviral VectorApplied Biological MaterialsN/A – C096 – see Supplementary file 4
Recombinant DNA reagentpLenti-CMV-Cry2-mCherry-UNG2-DPIP-SV40-Puro Lentiviral VectorApplied Biological MaterialsN/A – C096 – see Supplementary file 4
Recombinant DNA reagentpLenti-CMV-Cry2-mCherry- DRPA-SV40-Puro Lentiviral VectorApplied Biological MaterialsN/A – C096 – see Supplementary file 4
AntibodyAnti-N6-methyladenosine (anti-6mA), rabbit polyclonalSynaptic SystemCatalog # 202 003, RRID:AB_22792141:100 IF
AntibodyAnti-phospho-Histone H2A.X (Ser139). Clone JBW301, mouse monoclonalMillipore05-636; RRID:AB_3098641:1000 IF
AntibodyAnti-mCherry, chicken polyclonalAbcamCatalog # Ab205402, RRID:AB_27227691:500 IF
AntibodyAnti-mCherry, recombinant rabbitAbcamCatalog # Ab213511; RRID:AB_28148911:500 IF
AntibodyAlexa Fluor 488-conjugated Anti-mouse IgG (H+L), goat polyclonalInvitrogenCatalog # A11029, RRID:AB_25340881:1000 IF
AntibodyAlexan Fluor 488-conjugated anti-Chicken IgY (H+L), goat polyclonalInvitrogenCatalog # A32931, AB_27628431:1000 IF
AntibodyAnti-UNG, rabbit polyclonalAbClonalCatalog # A1261 (WB: 1:1000); RRID:AB_27594531:500 WB
AntibodyAnti-METTL3, rabbit polyclonalAbClonalCatalog # 8370 (WB: 1:1000); RRID:AB_27703441:500 WB
AntibodyAnti-Tubulin, Clone DM1A (mouse), rabbit monoclonalMilliporeCatalog # MABT205; RRID:AB_112041671:1000 WB
AntibodyAnti-WTAP, rabbit polyclonalBethylCatalog # A301-435A; RRID:AB_9611371:500 WB
AntibodyIRDye 680RD Goat anti-rabbit, goat polyclonalLicorCatalog # 926-68071; RRID:AB_109561661:10,000 WB
AntibodyIRDye 800CW Donkey anti-mouse, donkey unknown clonalityLicorCatalog # 926-32212, RRID:AB_6218471:10,000 WB
AntibodyIgG, rabbit monoclonalAbcamCatalog # Ab172730, RRID_2687931IP: 5 µg
AntibodyUNG, rabbit polyclonalAbclonalCatalog # A1261; RRID:AB_27594531:500 WB, IP: 5 µg
Sequence-based reagentgRNA_UNG_4, CTTGATGGGCACGAACCGTGIDTN/A
Sequence-based reagentgRNA_HPRT, AATTATGGGGATTACTAGGAIDTN/A; targets intronic region
Sequence-based reagentgRNA_METTL3-ex10-1, CAGTTGGGTTGCACATTGTGIDTN/A
Sequence-based reagentgRNA_UNG-2597, TCCCCTTTGTCAGTGTATAGIDTN/A
Sequence-based reagentgRNA_WTAP_Hs.Cas9.WTAP.1.ABIDTCatalog # 313817305
Sequence-based reagentgRNA_METTL3_ Hs.Cas9.METTL3.1.AAIDTCatalog # 313817302
Sequence-based reagentgRNA_NTC GTAGCGAACGTGTCCGGCGTIDTN/A
Sequence-based reagentdsDNA-U:A, 5′-/5Biosg//iSp9/AAATTGUTATCCGCT Complement: 5′-AGCGGATAACAATTTIDTN/A
Sequence-based reagentdsDNA-U:m6dA, 5′-/5Biosg//iSp9/AAATTGUTATCCGCT Complement: 5′- AGCGGATA/iN6Me-dA/CAATTTIDTN/A
Sequence-based reagentdsDNA-U:A, m6dA:T, 5′-/5Biosg//iSp9/AAATTGUT/iN6Me-dA/TCCGCT Complement: 5′-AGCGGATAACAATTTIDTN/A
Sequence-based reagentssDNA-U: /5Biosg//iSp9/AAATTGUTATCCGCTIDTN/A
Sequence-based reagentssDNA-U_m6dA: /5Biosg//iSp9/AAATTGUT/iN6Me-dA/TCCGCTIDTN/A
Peptide, recombinant proteinRecombinant UNG-Catalytic DomainThis paperThis paperPfizer, Inc
Commercial assay or kitQIAquick PCR Cleanup KitQIAGENCatalog # 28506
Commercial assay or kitPureLink Quick PCR Purification KitInvitrogenCatalog # K310001
Commercial assay or kitGentra Puregene kitQIAGENCatalog # 158845
Commercial assay or kitMTS Assay kitAbcamCatalog # ab197010
Commercial assay or kitQuick-DNA/RNA Miniprep Plus KitZymo ResearchCatalog # D7003
Commercial assay or kitRNeasy Plus University KitQIAGENCatalog # 730404
Commercial assay or kitHigh Capacity RT KitApplied BiosystemsCatalog # 4374966
Chemical compound, drugPhosphate Buffered Saline (PBS)CorningCatalog # 21-040-CV
Chemical compound, drugHeat Inactivated Fetal Bovine Serum (FBS)GibcoCatalog # 16140-071
Chemical compound, drugRPMI-1640CorningCatalog # 10-040-CM
Chemical compound, drugMcCoy’s 5AGibcoCatalog # 16600-108
Chemical compound, drugDMEMGibcoCatalog # 11995073
Chemical compound, drugDMEM (No Phenol Red)GibcoCatalog # A1443001
Chemical compound, drugPenicillin Streptomycin Solution, 100×CorningCatalog # 30-002-CI
Chemical compound, drugPenicillin Streptomycin SolutionGibcoCatalog # 15120-122; used for U2OS 2-6-3
Chemical compound, drugGlutaMaxGibcoCatalog # 35050061
Chemical compound, drug0.25% TrypsinCorningCatalog # 25-053-CI
Chemical compound, drugRecovery Cell Culture Freezing MediumGibcoCatalog # 12648010
Chemical compound, drugHAT SupplementGibcoCatalog # 21060-017
Chemical compound, drugFloxuridineSigma-AldrichCatalog # F0503
Chemical compound, drugRaltitrexedSigma-AldrichCatalog # R9156
Chemical compound, drugGemcitabineSigma-AldrichCatalog # G6423
Chemical compound, drugHydroxyureaUspCatalog # 1332000
Chemical compound, drugMitomycin CStemCell TechnologiesCatalog # 73273
Chemical compound, drugMETTL3 inhibitorMedChem ExpressCatalog # HY-134836/CS-0159584
Chemical compound, drugPuromycinThermo ScientificCatalog # J67236.XF
Chemical compound, drugHygromycin BThermo FisherCatalog # 10687010
Chemical compound, drug6-ThioguanineTocrisCatalog # 4061
Chemical compound, drugLentiviral Packaging Construct MixSigmaCatalog # SHP001
Chemical compound, drugOPTI-MEMGibcoCatalog # 31985-062
Chemical compound, drugPolybrene Transfection ReagentMilliporeCatalog # TR-10030G
Chemical compound, drugPuromycinInvivoGenCatalog # Ant-pr
Chemical compound, drugLipofectamine 3000 Transfection ReagentInvitrogenCatalog # L300075
Chemical compound, drugProtein G DynabeadsInvitrogenCatalog # 10004D
Chemical compound, drugTCEP Bond BreakerThermo FisherCatalog # 77720
Chemical compound, drugHalt Protease and Phosphatase InhibitorThermo FisherCatalog # 78436
Chemical compound, drugBenzonaseSigma-AldrichCatalog # 70664-10KUN
Chemical compound, drugDithiothreitol (DTT)Sigma-AldrichCatalog # D0632-10G
Chemical compound, drugIodoacetamide (IAA)Sigma-AldrichCatalog # I1149-5G
Chemical compound, drugLysyl Endopeptidase (LysC)Fujifilm Wako Chemicals USACatalog # 125-05061
Chemical compound, drugFormic acidFisher ChemicalCatalog # A117-50
Chemical compound, drugSep-Pak C-18WatersCatalog # WAT036925
Chemical compound, drugTrypsinPromegaCatalog # V5111
Chemical compound, drugEasy-Spray 50 cm column packed with 2 mm C-18 ResinThermo FisherCatalog # ES903
Chemical compound, drugDNA Degradase PlusZymo ResearchCatalog # 214843
Chemical compound, drug10× DNA Degrader Reaction BufferZymo ResearchCatalog # E2016-2
Chemical compound, drug2′-deoxyadenosine (dA)SigmaCatalog # D7400
Chemical compound, drugN6-methyl-2-deoxyadenosine (6mA)Thermo FisherCatalog #AAJ64961MD
Chemical compound, drugStable heavy labeled 2′-deoxyadenosineCambridge Isotope Laboratories, IncCNLM-3896-CA-25; internal standard for analyte mass spectrometry
Chemical compound, drugNuPAGE LDS Sample Buffer (4×)InvitrogenCatalog # NP0007
Chemical compound, drugNuPAGE Sample Reducing Agent (10×)InvitrogenCatalog # NP0009
Chemical compound, drugMOPS SDS Running Buffer (20×)InvitrogenCatalog # NP0001
Chemical compound, drugInvitrogen iBlot 2 Transfer Stacks, PVDF, miniInvitrogenCatalog # IB24002
Chemical compound, drugChameleon Duo Prestained Protein ladderLiCorCatalog # 928-60000
Chemical compound, drugTuberculin NeedleBDSKU: 309623
Chemical compound, drugIntercept Blocking BufferLiCorCatalog # 927-70001
Chemical compound, drugPhosphate Buffered Saline-Tween (20×)Boston Bioproducts IncCatalog # IBB-920
Chemical compound, drugFBSGibcoCatalog # 16000-044
Chemical compound, drug1 M HEPESCorningCatalog # 25-060-CI
Chemical compound, drug0.5 M EDTAInvitrogenCatalog # 46-000-CM
Chemical compound, drugNaClSigmaCatalog # S3014-1K
Chemical compound, drugTriton X-100Thermo ScientificCatalog # A16046.AE
Chemical compound, drugSucroseThermoCatalog # 036508.30
Chemical compound, drugMgCl2FlukaCatalog # 63020-1L
Chemical compound, drug37% FormaldehydeThermo ScientificCatalog # BP531-25
Chemical compound, drugDAPIThermo ScientificCatalog # 62248 (use at 1:10,000)
Chemical compound, drugDuplex BufferIDTCatalog # 1072570
Chemical compound, drugElectroporation EnhancerIDTCatalog # 1075916
Chemical compound, drugAlt-R CRISPR Cas9 tracrRNAIDTCatalog # 1073190
Chemical compound, drugAlt-R S.p. Cas9 Nuclease V3IDTCatalog # 1081059
Chemical compound, drugDuplex BufferIDTCatalog # 11-01-03-01
Chemical compound, drugAmaxa SE Cell Line KitLonzaCatalog # V4SC-1096
Chemical compound, drug---Solution BoxIn KitCatalog # PBC1-02250
Chemical compound, drug---SE solutionIn KitCatalog # S-09637
Chemical compound, drug---Supplement SolutionIn KitCatalog # S-09699
Chemical compound, drugTaqMan Gene Expression Master MixThermo FisherCatalog # 4369016
Chemical compound, drugTaqman Assay – GAPDHThermo FisherCatalog # 4331182, Assay ID Hs99999905_m1
Chemical compound, drugTaqman Assay – UNGThermo FisherCatalog # 4331182, Assay ID Hs01037093_m1,
Chemical compound, drugDMEM for SILACThermo FisherCatalog # 88364
Chemical compound, drug13C6 L-Arginine-HClThermo FisherCatalog # 88210
Chemical compound, drug13C6 L-Lysine-2HClThermo FisherCatalog # 88209
chemical compound, drugBiotin-phenolLGC GENOMICS LLCCatalog # 41994-02-9
Chemical compound, drugDoxycyclineSigma-AldrichCatalog # D9891-1G
Chemical compound, drugH2O2Sigma-AldrichCatalog # H1009
Chemical compound, drugSodium ascorbateSigma-AldrichCatalog # A7631
Chemical compound, drugTroloxSigma-AldrichCatalog # 238813
Chemical compound, drugSodium azideSigma-AldrichCatalog # S2002
Chemical compound, drugPhosphate-buffered saline (PBS)GibcoCatalog # 10010049
Chemical compound, drugcOmplete protease inhibitor cocktailSigmaCatalog # 11873580001
Chemical compound, drugMethanolSigmaCatalog # 1793307
Chemical compound, drugCrystal VioletAqua SolutionsCatalog # C8126
Software, algorithmModel-based Analysis of Genome-wide CRISPR-Cas9 Knockout (MAGecK)Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout (MAGecK)MLE, RRID:SCR_025016
Software, algorithmImageJImageJ1.47v, RRID:SCR_003070
Software, algorithmPRISMGraph Pad SoftwareVersion 9, RRID:SCR_002798
Software, algorithmSciex OS: AutopeakSciex2.2.0
Software, algorithmCellProfilerCellProfilerThis paper
Software, algorithmMaxQuantMaxQuant1.6.17.0, RRID:SCR_014485
Other, equipmentCX7 CellNightSightThermo FisherImmunofluorescenceMicroscope for immunofluorescence
Other, equipmentUltraView Spinning DiskPerkinElmerCry2 Imaging, RRID:SCR_020405Microscope for Cry2 imaging
Other, equipmentIncucyteSartoriusCell Viability – Growth, RRID:SCR_019874Incubator for cell viability assays
Other, equipmentOdyssey CX7Li-corImmunoblottingImager for western blots
Other, equipmentIllumina Next-SeqIIluminaWhole Genome ScreenSequencer for Whole Genome Screen
Other, equipmentIllumina Mi-SeqIlluminaWhole Genome ScreenSequencer for Whole Genome Screen
Other, equipment4D NucleofectorLonzaKO line generation, RRID:SCR_023155Nucleofector for generating CRISPR Kos
Other, equipmentEnvision 2104 Plate ReaderPerkinElmerCell Viability – MTSPlate Reader for MTS assay
Other, equipmentnanoACQUITY UPLC SystemWatersCoimmunoprecipitation LC–MS/MSEquipment for LC–MS/MS
Other, equipmentOrbitrap Fusion Lumos Tribrid Mass SpectrometerThermo FisherCoimmunoprecipitation LC–MS/MSEquipment for LC–MS/MS
Other, equipmentACQUITY UPLC M Class SystemWatersUPLC–MS/MSEquipment for UPLC–MS/MS
Equipment for LC–MS/MS
Other, equipmentTriple QuadTM 7500 SystemSciexUPLC–MS/MSEquipment for UPLC–MS/MS
Equipment for LC–MS/MS
Other, equipmentColumn: nanoEase m/z peptide BEH c18, 300A, 1.7 µm 300 µm × 100 mmWatersUPLC–MS/MS, PN186009264Equipment for UPLC–MS/MS
Equipment for LC–MS/MS
Other, GEOGSE282260GEOGSE282260

Additional files

Supplementary file 1

CRISPR screen MAgeCK results, related to Figure 1.

https://cdn.elifesciences.org/articles/101626/elife-101626-supp1-v1.xlsx
Supplementary file 2

Liquid chromatograph–mass spectrometry (LC–MS/MS) analysis of coimmunoprecipitation using UNG antibody.

https://cdn.elifesciences.org/articles/101626/elife-101626-supp2-v1.xlsx
Supplementary file 3

Stable isotope labeling by amino acids (SILAC) liquid chromatograph–mass spectrometry (LC–MS/MS) analysis of IDR-seeded condensates, related to Figure 3H.

https://cdn.elifesciences.org/articles/101626/elife-101626-supp3-v1.xlsx
Supplementary file 4

Supplemental method information and vector sequences.

https://cdn.elifesciences.org/articles/101626/elife-101626-supp4-v1.pdf
MDAR checklist
https://cdn.elifesciences.org/articles/101626/elife-101626-mdarchecklist1-v1.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Brooke A Conti
  2. Leo Novikov
  3. Deyan Tong
  4. Qing Xiang
  5. Savon Vigil
  6. Thomas J McLellan
  7. Chuong Nguyen
  8. Nancy De La Cruz
  9. Reshma T Veettil
  10. Prashant Pradhan
  11. Parag Sahasrabudhe
  12. Jason D Arroyo
  13. Lei Shang
  14. Benjamin R Sabari
  15. David J Shields
  16. Mariano Oppikofer
(2025)
N6-methyladenosine in DNA promotes genome stability
eLife 13:RP101626.
https://doi.org/10.7554/eLife.101626.3