TPR is required for cytoplasmic chromatin fragment formation during senescence
- MRC Human Genetics Unit, Institute of Genetics and Cancer, University of Edinburgh, United Kingdom
- Centre for Regenerative Medicine, Institute for Regeneration and Repair, University of Edinburgh, United Kingdom
- Institute of Biomedicine and Biotechnology of Cantabria (CSIC-Universidad de Cantabria), Spain
- Institute of Human Genetics, UMR9002, CNRS – Université de Montpellier, France
Figures
Figure 1 with 1 supplement
Senescence-specific accessible chromatin sites dependent on TPR are near senescence-associated secretory phenotype (SASP) genes and are enriched in binding sites for SASP-related transcription factors.
(A) Model of the nuclear pore showing the location of TPR in the nuclear basket and heterochromatin exclusion at the pore. (B) Schematic of experimental protocol for senescence induction in IMR90 …
Figure 1—figure supplement 1
TPR-dependent senescence-specific accessible chromatin peaks are enriched in H3K27ac and associated with genes relevant to inflammation.
Related to Figure 1. (A) Volcano plot of differential accessibility analysis of day 8 (d8) ATAC-seq peaks in RAS siCTRL vs STOP siCTRL. The horizontal dashed line indicates an adjusted p-value (FDR) …
Figure 2 with 1 supplement
Prolonged loss of TPR during senescence blocks NF-κB activation.
(A) TPR and NF-κB immunostaining in control (STOP) and oncogene-induced senescence (OIS) (RAS) cells after 4-hydroxytamoxifen (4-OHT) and siRNA (control and TPR) treatment for 8 days. Scale bar: 10 …
-
Figure 2—source data 1
Quantification of NF-κB nucleocytoplasmic ratios and statistical analysis for data in Figure 2B and F, and for biological replicates in Figure 2—figure supplement 1A and D.
Median NF-κB nucleocytoplasmic ratios (n/c) and number of cells analysed for day 8 (d8) STOP or RAS cells subject to knockdown with control (CTRL) or TPR siRNAs, and for experiments where these cells were treated with conditioned media (CM) from either STOP or RAS cells. Kruskal-Wallis testing was used to determine statistical significance for each replicate (p-value in parentheses) followed by Dunn’s post hoc testing. p-values after Benjamini and Hochberg correction.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig2-data1-v3.docx
-
Figure 2—source data 2
Uncropped and labelled gels for Figure 2.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig2-data2-v3.pdf
-
Figure 2—source data 3
Raw unedited gels for Figure 2.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig2-data3-v3.zip
Figure 2—figure supplement 1
TPR depletion blocks NF-κB activation during senescence.
Related to Figure 2. (A) Quantification of NF-κB nucleocytoplasmic ratios by immunofluorescence in STOP and RAS cells after 4-hydroxytamoxifen (4-OHT) and siRNA treatment for 8 days. Kruskal-Wallis …
-
Figure 2—figure supplement 1—source data 1
Uncropped and labelled gels for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig2-figsupp1-data1-v3.zip
-
Figure 2—figure supplement 1—source data 2
Raw unedited gels for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig2-figsupp1-data2-v3.zip
Figure 3 with 2 supplements
Decreased NF-κB activation upon TPR knockdown precedes the senescence-associated secretory phenotype (SASP).
(A) Schematic showing positive feedback loop in SASP signalling. Secreted IL-1α and IL-1β bind IL-1R1 at the cell membrane, leading to increased NF-κB activation and increased IL-1α and IL-1β …
-
Figure 3—source data 1
Quantification of NF-κB nucleocytoplasmic ratios, nuclear intensity, and statistical analysis for data in Figure 3C and D and for biological replicates in Figure 3—figure supplement 1A and B.
Median NF-κB nucleocytoplasmic ratios (n/c) and number of cells analysed for day 3 (d3) and d5 STOP or RAS cells subject to knockdown with control (CTRL) or TPR siRNAs. Kruskal-Wallis testing was used to determine statistical significance (p-value in parentheses) followed by Dunn’s post hoc testing. p-Values after Benjamini and Hochberg correction. NA: Kruskal-Wallis test showed no significant differences so it is not appropriate to carry out pairwise testing.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig3-data1-v3.docx
-
Figure 3—source data 2
Uncropped and labelled gels for Figure 3.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig3-data2-v3.zip
-
Figure 3—source data 3
Raw unedited gels for Figure 3.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig3-data3-v3.zip
Figure 3—figure supplement 1
Decreased NF-κB activation upon TPR knockdown at days 3 and 5.
Related to Figure 3. (A and B) Quantification of (A) nucleocytoplasmic ratios of NF-κB or (B) nuclear NF-κB intensity from a biological replicate of the experiment shown in Figure 3B–D. (n) …
-
Figure 3—figure supplement 1—source data 1
Uncropped and labelled gels for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig3-figsupp1-data1-v3.zip
-
Figure 3—figure supplement 1—source data 2
Raw unedited gels for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig3-figsupp1-data2-v3.zip
Figure 3—figure supplement 2
TPR knockdown does not affect chromatin accessibility at day 3 (d3).
(A) Heatmap showing ATAC-seq signal in control (STOP) and oncogene-induced senescence (OIS) (RAS) cells 3 days after 4-hydroxytamoxifen (4-OHT) treatment and transfected with either CTRL or TPR …
Figure 4 with 1 supplement
Decreased STING expression and TBK1 activation upon TPR knockdown during early stages of oncogene-induced senescence (OIS).
(A) Volcano plot of differential expression analysis of RNA isolated from RAS cells at day 3 (d3) of OIS and treated with siTPR vs siCTRL. Genes showing a significant change in expression in RAS, …
-
Figure 4—source data 1
Statistical analysis for STING1 qPCR data in Figure 4B and for cGAMP ELISA data in Figure 4D.
One-way ANOVA was used to determine statistical significance followed by Šídák’s multiple comparisons test.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig4-data1-v3.docx
-
Figure 4—source data 2
Uncropped and labelled gels for Figure 4.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig4-data2-v3.zip
Figure 4—figure supplement 1
Decreased abundance of mRNAs for intronless genes and for STING1 in RAS cells upon TPR knockdown at day 3 (d3).
Related to Figure 4. (A) Volcano plots of differential expression analysis of d3 STOP (top) and RAS (bottom) cells treated with TPR vs CTRL siRNAs with intronless genes coloured pink. Horizontal …
-
Figure 4—figure supplement 1—source data 1
Uncropped and labelled gels for Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig4-figsupp1-data1-v3.zip
Figure 5
TPR and HMGA1 are required for the induction of cytoplasmic chromatin fragments (CCFs) during the early phase of oncogene-induced senescence (OIS).
(A) Mean percentage of cells containing CCFs in STOP and RAS cells at day 3 (d3) or d5 of OIS and treated with either control (siCTRL) or TPR siRNAs. Data points are for three biological replicates. …
-
Figure 5—source data 1
Statistical analysis for cytoplasmic chromatin fragments (CCF) and senescence-associated heterochromatic foci (SAHF) data in Figure 5A, G, and H.
Data were fitted to a generalised linear model before carrying out pairwise comparisons between samples. 500 cells were assessed per sample for each replicate of each experiment.
- https://cdn.elifesciences.org/articles/101702/elife-101702-fig5-data1-v3.docx
Author response image 1
Author response image 2
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | IMR90 STOP cells | Acosta et al., 2013 | Generated in the J-C Acosta lab | |
| Cell line (Homo sapiens) | IMR90 RAS cells | Acosta et al., 2013 | Generated in the J-C Acosta lab | |
| Antibody | anti-β-actin−HRP (mouse monoclonal) | Sigma-Aldrich | A3854 | WB (1:80000) |
| Antibody | anti-GAPDH (mouse monoclonal) | Abcam | ab125247, RRID:AB 11129118 | WB (1:5000) |
| Antibody | anti-phospho-Histone H2AX (Ser139) (mouse monoclonal) | Merck | 05–636 | IF (1:1000) |
| Antibody | anti-H3K27me2/me3 (mouse monoclonal) | Active Motif | #39536 RRID:AB_2793247 | IF (1:1000) |
| Antibody | anti-H3K9me3 (rabbit polyclonal) | Abcam | ab8898 RRID:AB_306848 | IF (1:2000) |
| Antibody | anti-IKKα (rabbit polyclonal) | Cell Signaling Technology | #2682 RRID:AB_331626 | WB (1:1000) |
| Antibody | anti phospho-IKKα/β (Ser176/180) (rabbit monoclonal) | Cell Signaling Technology | #2697 RRID:AB_2079382 | WB (1:1000) |
| Antibody | anti-NF-κB p65 (mouse monoclonal) | Santa Cruz | sc-8008 RRID:AB_628017 | WB (1:1000), IF (1:100) |
| Antibody | anti-NF-κB p65 (rabbit recombinant monoclonal) | Cell Signaling Technology | #8242 RRID:AB_10859369 | IF (1:500) |
| Antibody | anti-phospho- NF-κB p65 (Ser536) (rabbit recombinant monoclonal) | Cell Signaling Technology | #3033 RRID:AB_331284 | WB (1:500) |
| Antibody | anti-POM121 (rabbit polyclonal) | Genetex | GTX102128 RRID:AB_10732546 | IF (1:500) |
| Antibody | anti-STING (rabbit monoclonal) | Cell Signaling Technology | #13647 RRID:AB_2732796 | WB (1:2000) |
| Antibody | anti-phosphoTBK1 (Ser172) (rabbit monoclonal) | Cell Signaling Technology | #5483 RRID:AB_10693472 | WB (1:1000) |
| Antibody | anti-TPR (rabbit polyclonal) | Abcam | ab84516 | IF (1:500) |
| Antibody | anti-vinculin (rabbit polyclonal) | Abcam | ab91459 RRID:AB_2050446 | WB (1:5000) |
| Antibody | anti-rabbit IgG (H+L) secondary, Alexa Fluor 488 (goat polyclonal) | Invitrogen | A11034 | IF (1:1000) |
| Antibody | anti-mouse IgG (H+L) secondary, Alexa Fluor 568 (donkey polyclonal) | Invitrogen | A10037 | IF (1:1000) |
| Antibody | anti-rabbit IgG, HRP-linked (goat polyclonal) | Cell Signaling Technology | #7074 RRID:AB_2099233 | WB (1:2000) |
| Antibody | anti-mouse IgG, HRP-linked (horse polyclonal) | Cell Signaling Technology | #7076 RRID:AB_330924 | WB (1:2000) |
| Sequence-based reagent | siCTRL | Dharmacon | D-001810-10-59 | ON-TARGETplus siRNA pool |
| Sequence-based reagent | siTPR | Dharmacon | L-010548–00 | ON-TARGETplus siRNA pool |
| Sequence-based reagent | siHMGA1 | Dharmacon | L-004597–00 | ON-TARGETplus siRNA pool |
| Sequence-based reagent | STING1_Fwd | Dou et al., 2017 | RT-qPCR primer | ATATCTGCGGCTGATCCTGC |
| Sequence-based reagent | STING1_Rev | Dou et al., 2017 | RT-qPCR primer | TTGTAAGTTCGAATCCGGGC |
| Sequence-based reagent | GAPDH_Fwd | Dou et al., 2017 | RT-qPCR primer | CAGCCTCAAGATCATCAGCA |
| Sequence-based reagent | GAPDH_Rev | Dou et al., 2017 | RT-qPCR primer | TGTGGTCATGAGTCCTTCCA |
| Commercial assay or kit | Pierce BCA protein analysis kit | Thermo Fisher | 23225 | Methods: Immunoblotting |
| Commercial assay or kit | SuperSignal West Femto maximum sensitivity substrate kit | Thermo Fisher | 10095983 | Methods: Immunoblotting |
| Commercial assay or kit | 2’3’-cGAMP ELISA kit | Cayman Chemical | 501700 | Methods: 2’3’-cGAMP ELISA |
| Commercial assay or kit | RNeasy mini kit | Qiagen | 74104 | Methods: RT-qPCR and RNA seq library preparation |
| Commercial assay or kit | NEBNext Ultra II Directional RNA library prep kit | New England Biolabs | E7760 | Methods: RNA seq library preparation |
| Commercial assay or kit | NEBNext Poly(A) mRNA Magnetic Isolation Module | New England Biolabs | E7490 | Methods: RNA seq library preparation |
| Chemical compound, drug | 4-hydroxytamoxifen | Sigma | H7904 | |
| Other | H3K27ac ChIP-seq | Parry et al., 2018 | NCBI GEO: GSE103590 | See Figure 1—figure supplement 1 |
| Other | ATAC-seq | This paper | NCBI GEO: GSE264390 | See Methods |
| Other | RNA-seq | This paper | NCBI GEO: GSE264387 | See Methods |
| Software, algorithm | CellProfiler | Stirling et al., 2021 | RRID:SCR_007358 | |
| Software, algorithm | Micromanager | https://micromanager.org | Version 1.4 | |
| Software, algorithm | FastQC | RRID:SCR_014583 | ||
| Software, algorithm | cutadapt | Martin, 2011 | RRID:SCR_011841 | |
| Software, algorithm | bowtie2 | Langmead and Salzberg, 2012 | RRID:SCR_016368 | |
| Software, algorithm | MACS2 | Zhang et al., 2008; https://pypi.org/project/MACS2/ | ||
| Software, algorithm | HOMER | Heinz et al., 2010 | RRID:SCR_010881 | |
| Software, algorithm | edgeR | Robinson et al., 2010 | RRID:SCR_012802 | |
| Software, algorithm | limma | Ritchie et al., 2015 | RRID:SCR_010943 | |
| Software, algorithm | deepTools | Ramírez et al., 2016 | RRID:SCR_016366 | |
| Software, algorithm | GREAT | McLean et al., 2010 | RRID:SCR_005807 | |
| Software, algorithm | HISAT2 | Kim et al., 2019 | RRID:SCR_015530 | |
| Software, algorithm | GATK | Van der Auwera and O’Connor, 2020 | RRID:SCR_015530 | |
| Software, algorithm | subread | Liao et al., 2014 | RRID:SCR_009803 | |
| Software, algorithm | DeSeq2 | Love et al., 2014 | RRID:SCR_015687 | |
| Software, algorithm | clusterProfiler | Wu et al., 2021 | RRID:SCR_016884 | |
| Software, algorithm | ggplot2 | Wickham, 2016 | RRID:SCR_014601 | |
| Software, algorithm | TEtranscripts | Jin et al., 2015 | RRID:SCR_023208 |
Additional files
-
Supplementary file 1
Supplementary file 1a, b, and c are tables summarising data in the manuscript.
(a) Table summarising day 8 ATAC-seq changes in peak accessibility. Number of ATAC-peaks with significant changes generated from comparisons between samples using the limma package with an adjusted p-value cut-off of 0.05. Peaks significantly upregulated in RAS siCTRL compared to STOP siCTRL (SEN+) were further divided into TPR-dependent (SEN+TPR+) and TPR-independent (SEN+TPR-) as shown. (b) Table indicating the proximity of senescence-associated secretory phenotype (SASP) gene promoters to TPR-dependent, senescence-dependent ATAC-seq peaks. Distance (in bp) between TPR+SEN+ ATAC-seq peaks from the transcription start site (TSS) of genes involved in positive regulation of the inflammatory response, cytokine activity, and cytokine receptors. (c) Table summarising day 3 ATAC-seq changes in peak accessibility. Number of peaks with significant changes generated from comparisons between samples using the limma package with an adjusted p-value cut-off of 0.05.
- https://cdn.elifesciences.org/articles/101702/elife-101702-supp1-v3.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/101702/elife-101702-mdarchecklist1-v3.docx
