The olfactory receptor SNIF-1 mediates foraging for leucine-enriched diets in C. elegans
- Division of Molecular Microbiology, School of Life Sciences, University of Dundee, United Kingdom
- Department of Developmental Biology and Genetics, Indian Institute of Science, India
- Institute of Biology of the Ecole Normale Supérieure, France
- Department of Molecular Biology, Umeå University, Sweden
Figures
Figure 1 with 2 supplements
C. elegans relies on odors to select leucine-supplemented bacteria.
(A) Schematic representation of ‘odor-only’ diet preference assay. Preference index (PI) of wild-type (WT) worms in an ‘odor-only’ diet preference assay (indicated as 
) for individual diet supplemented with (B) 5 mM leucine (+LEU), (C) 5 mM isoleucine (+ILE), and (D) 5 mM valine (+VAL). Significant differences are indicated as *p≤0.05, **p≤0.01, and ****p≤0.0001 determined by one-sample t-test. (E) Schematic representation of ‘odor-only’ diet preference assay between individual CeMbio bacteria and E. coli OP50. (F) Preference index (PI) of WT worms in an ‘odor-only’ diet preference assay between individual CeMbio bacteria and E. coli OP50. Also, see Figure 1—video 1 for diet preference assay. Error bars indicate SEM (n≥15).
Figure 1—figure supplement 1
C. elegans does not prefer some essential amino acid (EAA)-supplemented diets.
Preference index (PI) of wild-type (WT) worms in an ‘odor-only’ diet preference assay for individual diet supplemented with (A) 5 mM threonine (+THR), (B) 5 mM methionine (+MET), (C) 5 mM phenylalanine (+PHE), (D) 5 mM tryptophan (+TRP), (E) 5 mM lysine (+LYS), (F) 5 mM histidine (+HIS) and (G) 5 mM arginine (+ARG). 
symbol indicates ‘odor-only’ preference assays. Significant differences are indicated as *p≤0.05, **p≤0.01, and ****p≤0.0001 determined by one-sample t-test. (H) Chemotaxis index (CI) for WT worms to leucine (LEU) at various concentrations. Error bars indicate SEM (n≥10).
Figure 1—video 1
WIld-type (WT) worms prefer CEent1 over E. coli OP50 in a diet preference assay.
Figure 2 with 1 supplement
Leucine supplementation boosts isoamyl alcohol levels via the Ehrlich degradation pathway.
Gas chromatography-mass spectrometry (GC-MS/MS) profile of odors produced by CEent1 under (A) leucine-supplemented and (B) leucine-unsupplemented conditions. Unmarked peaks represent masses contributed by fiber or media alone (n≥3). (C) Heat map representing the relative abundance of various odors in the headspace of CEent1, JUb66, and BIGb0170 with and without leucine supplementation. (D) Absolute abundance of isoamyl alcohol (IAA) (in moles) produced by CEent1 under leucine-supplemented and unsupplemented conditions. *p≤0.05 as determined by a two-tailed unpaired t-test. (E) Schematic of the Ehrlich degradation pathway. (F) Fold change of transcript levels of ilvE under leucine-supplemented over unsupplemented conditions for CEent1. Error bars indicate SEM (n≥3).
Figure 2—figure supplement 1
Increased levels of isoamyl alcohol upon leucine-enriched influence worms’ diet preference.
Gas chromatography-mass spectrometry (GC-MS/MS) profile of odors produced by JUb66 in (A) leucine supplemented (+LEU) and (B) leucine unsupplemented (-LEU) conditions. GC-MS/MS profile of odors produced by BIGb0170 in (C) leucine supplemented (+LEU) and (D) leucine unsupplemented (-LEU) conditions. Unmarked peaks represent masses contributed by fiber or media alone (n≥3). (E) Standard curve showing the correlation between the area under the curve for odor peak and the moles of isoamyl alcohol (IAA). Absolute abundance of IAA (in moles) produced by (F) JUb66 and (G) BIGb0170 under leucine-supplemented and unsupplemented conditions. **p≤0.01, ***p≤0.001 as determined by the two-tailed unpaired t-test. Error bars indicate SEM (n≥3). (H) Schematic representation of chemotaxis assay between different concentrations of IAA. (I) Chemotaxis index (CI) of wild-type (WT) worms to IAA (4µL over 1µL). Error bars indicate SEM (n≥15).
Figure 3 with 2 supplements
Odors sensed through AWC neurons mediate the diet preference of C. elegans.
Preference index (PI) of wild-type (WT), odr-7, and AWC(-) worms for (A) CEent1, (B) JUb66, and (C) BIGb0170 supplemented with leucine over unsupplemented conditions. Symbol 
indicates ‘odor-only’ preference assays. Chemotaxis index (CI) of WT, odr-7, and AWC(-) worms for (D) isoamyl alcohol (IAA), (E) acetoin (ACE), (F) isovalerate (ISV), (G) isobutanol (ISB), (H) phenylethyl alcohol (PEA), (I) butyl acetate (BA), and (J) methyl isovalerate (MIV). (K) Summary schematic representing the role of AWA and AWC odor sensory neurons in ‘odor-only’ diet preference for leucine-supplemented diets and chemotaxis assays. Significant differences are indicated as *p≤0.05, **p≤0.01, ***p≤0.001, and ****p≤0.0001 determined by one-way ANOVA followed by post hoc Dunnett’s multiple comparison test. Error bars indicate SEM (n=15).
Figure 3—figure supplement 1
AWA and AWC neurons facilitate the diet preference of C. elegans.
Preference index (PI) of wild-type (WT), odr-7, and AWC(-) worms in a diet preference assay for (A) CEent1, (B) JUb66, and (C) BIGb0170 over E. coli OP50. (D) Summary representing the role of AWA and AWC odor sensory neurons in diet preference. Significant differences are indicated as *p≤0.05, **p≤0.01, and ***p≤0.001 determined by one-way ANOVA followed by post hoc Dunnett’s multiple comparison test. Error bars indicate SEM (n=15).
Figure 3—figure supplement 2
Dose-dependent chemotaxis response of C. elegans to individual odors produced by preferred bacteria.
(A) Schematic representation of C. elegans’ chemotaxis assay. Chemotaxis index (CI) for wild-type (WT) worms to (B) isoamyl alcohol (IAA), (C) acetoin (ACE), (D) isovalerate (ISV), (E) isobutanol (ISB), (F) phenylethyl alcohol (PEA), (G) butyl acetate (BA), (H) methyl isovalerate (MIV), (I) 2,3-butanediol (BDL), (J) isoamyl acetate (ISA), and (K) indole (IND) to various concentrations of chemicals. Error bars indicate SEM (n=15).
Figure 4 with 1 supplement
Isoamyl alcohol regulates the diet preference of worms.
(A) Schematic representation of the adaptation regimen followed by chemotaxis assays. Chemotaxis index (CI) for naïve worms and worms adapted with CEent1, JUb66, or BIGb0170 odors to (B) isoamyl alcohol (IAA), (C) acetoin (ACE), (D) isovalerate (ISV), (E) isobutanol (ISB), (F) phenylethyl alcohol (PEA), (G) butyl acetate (BA), and (H) methyl isovalerate (MIV). Dark gray bars indicate naïve worms, and light gray bars indicate worms adapted to bacterial odors. Significant differences are indicated as *p≤0.05, **p≤0.01, ***p≤0.001, and ****p≤0.0001 determined by one-way ANOVA followed by post hoc Dunnett’s multiple comparison test. Error bars indicate SEM (n=15).
Figure 4—figure supplement 1
C. elegans utilizes isoamyl alcohol to make dietary preferences.
(A) Schematic representation of the odor adaptation regimen followed by diet preference assays. (B) Chemotaxis index (CI) to isoamyl alcohol (IAA) for naïve worms and worms adapted with IAA. Preference index (PI) of naïve worms and worms adapted with IAA in a diet preference assay for (C) CEent1, (D) JUb66, and (E) BIGb0170 over E. coli OP50. Significant differences are indicated as **p≤0.01, ***p≤0.001, and ****p≤0.0001 determined by one-way ANOVA followed by post hoc Dunnett’s multiple comparison test. Error bars indicate SEM (n=15).
Figure 5
Robust chemoperception of isoamyl alcohol in wild isolates of C. elegans.
(A) World map representing the distinct geographical locations (source) of wild isolates of C. elegans used in this study. Chemotaxis index (CI) of wild-type (WT) and wild isolates of worms for (B) isoamyl alcohol (IAA), (C) diacetyl (DA), (D) phenylethyl alcohol (PEA), and (E) acetoin (ACE). Significant differences are indicated as *p≤0.05, **p≤0.01, ***p≤0.001, and ****p≤0.0001 determined by one-way ANOVA followed by post hoc Dunnett’s multiple comparison test. Error bars indicate SEM (n=15).
Figure 6 with 2 supplements
SNIF-1 G-protein coupled receptor (GPCR) mediates isoamyl alcohol sensing and diet preference in C. elegans.
(A) List of GPCRs that are highly expressed in AWC neurons. Chemotaxis index (CI) of wild-type (WT) and GPCR-edited strains to 1:1000 isoamyl alcohol (IAA) (n≥3). All GPCR mutants of C. elegans used for screening have the CHS designation along with the codes mentioned in the panels. Also, refer to Supplementary file 3 for strain information. (B) Schematic for chemotaxis assay plate used for movement track analysis. Movement tracks of five animals in a chemotaxis arena with 1:1000 IAA for 15 min, for (C) WT, and snif-1 mutants- (D) VSL2401, and (E) VSL2402. Also, refer to Figure 6—video 1. Individual color represents the track for a single worm. (F) Chemotaxis index (CI) in response to IAA (1:1000 dilution) for WT, VSL2401, and VSL2402 worms. (G) Preference index (PI) of WT, VSL2401, and VSL2402 worms for a preferred diet, CEent1, over E. coli OP50. 
symbol indicates ‘odor-only’ preference assays. (H) Chemotaxis index (CI) in response to IAA (1:1000 dilution) for WT, VSL2401, VSL2401 [snif-1p:: snif-1], VSL2401 [AWCp::snif-1] and VSL2401 [AWBp::snif-1]. Significant differences are indicated as *p≤0.05, **p≤0.01, and ****p≤0.0001 determined by one-way ANOVA followed by post hoc Dunnett’s multiple comparison test. Error bars indicate SEM (n≥15). (I) Schematic showing the soma and processes of AWC neurons in the amphid region. Representative images of the reporter line expressing GFP under snif-1 promoter, and mCherry under odr-1 promoter (to mark AWC neurons) (n≥30).
Figure 6—figure supplement 1
Differential effect of SNIF-1 on locomotion of C. elegans.
(A) Average speed of worms (μm/s), and (B) total distance traveled (in mm) by wild-type (WT), VSL2401, and VSL2402 worms in a chemotaxis arena in response to isoamyl alcohol (IAA) in 30 min (n≥3). (B) Chemotaxis index (CI) of WT, VSL2401, and VSL2402 worms for (C) 500 mM acetoin (ACE), and (D) absolute phenylethyl alcohol (PEA). (n≥15). Significant differences are indicated as **p≤0.01 determined by one-way ANOVA followed by post hoc Dunnett’s multiple comparison test. Error bars indicate SEM.
Figure 6—video 1
Chemotaxis response of wild-type (WT), VSL2401, and VSL2402 worms to isoamyl alcohol (IAA).
Figure 7
Model depicting odor-based foraging strategy used by C. elegans.
C. elegans prefers leucine-supplemented diets in an odor-dependent manner. Preferred bacteria catabolize leucine, an essential amino acid (EAA), to produce isoamyl alcohol (IAA) via the Ehrlich degradation pathway. SRD-12/SNIF-1 G-protein coupled receptor (GPCR) expressed in AWC odor sensory neurons mediates the foraging behavior of C. elegans by sensing IAA.
Author response image 1
(A) Chemotaxis index (CI) of WT, VSL2401, VSL2401 [AWCp::snif-1] and VSL2401 [AWBp::snif-1] worms to IAA at 1:1000 dilution.
Significant differences are indicated as **** P ≤ 0.0001 determined by one-way ANOVA followed by post hoc Dunnett’s multiple comparison test. Error bars indicate SEM (n≥15).
Author response image 2
Chemotaxis index (CI) of WT, VSL2401, VSL2401 [AWCp:: snif-1] and VSL2401 [snif-1p::snif-1] worms to IAA at 1:1000 dilution.
Significant differences are indicated as **** P ≤ 0.0001 determined by one-way ANOVA followed by post hoc Dunnett’s multiple comparison test. Error bars indicate SEM (n≥15).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Caenorhabditis elegans) | srd-12 | Wormbase | WormBase ID: WBGene00005090 | Renamed in this article as snif-1 |
| Strain, strain background (Caenorhabditis elegans) | N2 | CGC | CGC reference 257 | |
| Sequence-based reagent | snif-1 promoter for position 1_F | This paper | Cloning PCR primers | GGGGACAACTTTGTATAGAAAAGTTGtctagtgtaagagtgaaacttg |
| Sequence-based reagent | snif-1 promoter for position 1_R | This paper | Cloning PCR primers | GGGGACTGCTTTTTTGTACAAACTTGgactttgatttctgaaaaagaaaa |
| Sequence-based reagent | snif-1 for position 2_F | This paper | Cloning PCR primers | GGGGACAAGTTTGTACAAAAAAGCAGGCTATGTTTGATTTTGCTGTTCTCTTCT |
| Sequence-based reagent | snif-1 for position 2_R | This paper | Cloning PCR primers | GGGGACCACTTTGTACAAGAAAGCTGGGTctcaTTATCCAATAATATGAATAC |
| Sequence-based reagent | snif-1_F | This paper | genotyping PCR primers for VSL2401 and VSL2402 | TCAGAAATCAAAGTCATGTTTGATTTTGCTG |
| Sequence-based reagent | snif-1_R | This paper | genotyping PCR primers for VSL2401 and VSL2402 | CCTGAGACCAGATGAAGGAGATCCATT |
| Sequence-based reagent | ilvE_F | This paper | qRT-PCR primers | TGTGATCATTGCTGCGTTCC |
| Sequence-based reagent | ilvE_R | This paper | qRT-PCR primers | CCAGCAGTGAGGAGAGGTAG |
| Sequence-based reagent | rpoB_F | This paper | qRT-PCR primers | ACCTGACCAAATACACCCGT |
| Sequence-based reagent | rpoB_R | This paper | qRT-PCR primers | GATCTTCCTGAACCACACGC |
| Commercial assay or kit | iScript cDNA synthesis kit | Bio-Rad | 170–8891 | |
| Commercial assay or kit | RNeasy Mini kit | Qiagen | 74104 | |
| Chemical compound, drug | CBR-5884 | Sigma Aldrich | SML1656 | |
| Chemical compound, drug | 2,3-Butanediol | Sigma | 237639–1 G | |
| Chemical compound, drug | Acetoin | Sigma | 40,127 U | |
| Chemical compound, drug | Agar | HiMedia | GRM026 | |
| Chemical compound, drug | Butyl acetate | Sigma | 287725–100 ML | |
| Chemical compound, drug | CaCl2 | SRL | 10035-04-8 | |
| Chemical compound, drug | Chloroform | VWR Chemicals | BDH83626.400 | |
| Chemical compound, drug | Diacetyl | Sigma | B85307 | |
| Chemical compound, drug | Difco Luria-Bertani | BD Difco | 11778902 | |
| Chemical compound, drug | DNase I | NEB | M0303S | |
| Chemical compound, drug | Ethanol | Merck Millipore | 100983 | |
| Chemical compound, drug | Indole | Sigma | I3408-100G | |
| Chemical compound, drug | Isoamyl acetate | Sigma | W205532-SAMPLE-K | |
| Chemical compound, drug | Isoamyl alcohol | Sigma | W205710-SAMPLE-K | |
| Chemical compound, drug | Isobutanol | Sigma | 294829–100 ML | |
| Chemical compound, drug | Isovalerate | TCI | 503-74-2 | |
| Chemical compound, drug | K2HPO4 | SRL | 2139900 | |
| Chemical compound, drug | KH2PO4 | SRL | 7778-77-0 | |
| Chemical compound, drug | Methyl isovalerate | TCI | 556-24-1 | |
| Chemical compound, drug | MgSO4 | SRL | 10034-99-8 | |
| Chemical compound, drug | NaCl | SRL | 7647-14-5 | |
| Chemical compound, drug | Phenylethyl alcohol | Sigma | 77861–250 ML | |
| Chemical compound, drug | RNAprotect Bacteria Reagent | Qiagen | 76506 | |
| Chemical compound, drug | Sodium azide | Sigma | 71290–10 G | |
| Chemical compound, drug | SYBR Green detection mix | Bio-Rad | 1725124 | |
| Software, algorithm | MATLAB | Release R2022b |
Additional files
-
Supplementary file 1
Bacterial strains used in this study.
- https://cdn.elifesciences.org/articles/101936/elife-101936-supp1-v1.xlsx
-
Supplementary file 2
List of volatiles produced by bacteria.
- https://cdn.elifesciences.org/articles/101936/elife-101936-supp2-v1.xlsx
-
Supplementary file 3
List of C. elegans used in this study.
- https://cdn.elifesciences.org/articles/101936/elife-101936-supp3-v1.xlsx
-
Supplementary file 4
Details of primers used in this study.
- https://cdn.elifesciences.org/articles/101936/elife-101936-supp4-v1.xlsx
-
Supplementary file 5
List of volatiles and their respective solvents used for chemotaxis assay.
- https://cdn.elifesciences.org/articles/101936/elife-101936-supp5-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/101936/elife-101936-mdarchecklist1-v1.docx
-
Source code 1
MATLAB code used for extracting the set of binary images from the video.
- https://cdn.elifesciences.org/articles/101936/elife-101936-code1-v1.zip
-
Source code 2
MATLAB code used for calculating average speed and distance traveled by worms using motility lab spreadsheet.
- https://cdn.elifesciences.org/articles/101936/elife-101936-code2-v1.zip
-
Source data 1
Source data for all the figures showing the processed values.
- https://cdn.elifesciences.org/articles/101936/elife-101936-data1-v1.xlsx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
The olfactory receptor SNIF-1 mediates foraging for leucine-enriched diets in C. elegans
eLife 13:RP101936.
https://doi.org/10.7554/eLife.101936.3
