1. Cancer Biology
  2. Chromosomes and Gene Expression

Interplay of YEATS2 and GCDH regulates histone crotonylation and drives EMT in head and neck cancer

  1. Deepak Pant
  2. Parik Kakani
  3. Rushikesh Joshi
  4. Abin Sabu
  5. Shruti Agrawal
  6. Atul Samaiya
  7. Sanjeev Shukla  Is a corresponding author
  1. Department of Biological Sciences, Indian Institute of Science Education and Research Bhopal, India
  2. Department of Pathology, Bansal Hospital, India
  3. Department of Surgical Oncology, Bansal Hospital, India
https://doi.org/10.7554/eLife.103321.3
Share this article
Cite this article
  1. Deepak Pant
  2. Parik Kakani
  3. Rushikesh Joshi
  4. Abin Sabu
  5. Shruti Agrawal
  6. Atul Samaiya
  7. Sanjeev Shukla
(2025)
Interplay of YEATS2 and GCDH regulates histone crotonylation and drives EMT in head and neck cancer
eLife 14:RP103321.
https://doi.org/10.7554/eLife.103321.3
  2. Download BibTeX
  3. Download .RIS
13 figures, 4 tables and 7 additional files

Figures

Figure 1 with 1 supplement
Download asset Open asset
YEATS2 is upregulated in head and neck cancer.

(A) Computational strategy used to find epigenetic factors with poor patient prognosis overexpressed in head and neck cancer (HNC). (B) Heatmap depicting the TCGA mRNA expression of top 10 epigenetic factors shortlisted using strategy mentioned in (A). (C) RT-qPCR result showing mRNA expression of YEATS2 in HNC samples (n=8). (D) Kaplan-Meier curve of YEATS2 showing association with overall head and neck cancer patient survival. (E–F) Gene expression profile of YEATS2 in publicly available HNC microarray datasets, GSE30784 (E) and GSE9844 (F). (G) Immunoblot showing protein levels of YEATS2 (quantification on right) in nuclear protein lysates extracted from HNC tissues (n=23). (H) Volcano plot of differentially expressed genes in RNA-seq analysis of shControl vs. shYEATS2 in BICR10 cells. (I) Results of overrepresentation analysis of genes significantly downregulated in shControl vs. shYEATS2 RNA-seq data. Error bars, min to max, mean ± SEM for (G); two-tailed t-test, ∗∗∗p<0.001, N-Normal, T-Tumor.

Figure 1—source data 1

PDF file containing original western blots for Figure 1G, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig1-data1-v1.zip
Figure 1—source data 2

Original files for western blot displayed in Figure 1G.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig1-data2-v1.zip
Figure 1—source data 3

Raw data file for Figure 1C and E–G.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig1-data3-v1.xlsx
Figure 1—figure supplement 1
Download asset Open asset
YEATS2 is upregulated in head and neck cancer.

(A–B) RT-qPCR result showing mRNA expression of (A) RUVBL1 and (B) MRGBP in head and neck cancer (HNC) samples. (C) Scatter plot showing positive correlation of YEATS2 expression with the expression of genes included in the hallmark EPITHELIAL_MESENCHYMAL_TRANSITION gene signature, in HNC TCGA data. (D) Expression of YEATS2 in different grades of TCGA HNC samples, showing a significant increase in expression from grade 1 to subsequent grades. (E) Gene set enrichment analysis (GSEA) plot showing significant enrichment of metastasis-associated gene sets in TCGA samples stratified as YEATS2_high as compared to YEATS2_low samples. (F) Immunoblot showing protein levels of YEATS2 in nuclear lysates extracted from HNC samples (YEATS2 band indicated by *). (G) Results of overrepresentation analysis of genes significantly upregulated in shControl vs. shYEATS2 RNA-seq data. Error bars, min to max; two-tailed t-test, ns- non-significant, ∗p<0.05, N-Normal, T-Tumor.

Figure 1—figure supplement 1—source data 1

PDF file containing original western blots for Figure 1—figure supplement 1F, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig1-figsupp1-data1-v1.zip
Figure 1—figure supplement 1—source data 2

Original files for western blot displayed in Figure 1—figure supplement 1F.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig1-figsupp1-data2-v1.zip
Figure 1—figure supplement 1—source data 3

Raw data file for Figure 1—figure supplement 1A–B.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig1-figsupp1-data3-v1.xlsx
Figure 2 with 1 supplement
Download asset Open asset
YEATS2 drives epithelial-to-mesenchymal transition (EMT) in head and neck cancer cells.

(A) Immunoblot showing the expression levels of various EMT factors upon YEATS2 knockdown in BICR10. (B–C) Results of invasion assay with quantification (below), after knockdown (B) or overexpression (C) of YEATS2 in BICR10 (Scale bar, 200 μm). (D–E) Wound healing assay performed after knockdown (D) or overexpression (E) of YEATS2 in BICR10 (Scale bar, 275 μm). (F–G) Results of 3D invasion assay showing change in invasive potential of BICR10 cells in collagen matrix after silencing (F) or overexpression (G) of YEATS2 (quantification shown below). (Scale bar: ×4 , 200 μm; ×10 , 50 μm) Error bars, mean ± SEM; two-tailed t-test, ∗p<0.05, ∗∗p<0.01, ∗∗∗p<0.001, n=3 biological replicates.

Figure 2—source data 1

PDF file containing original western blots for Figure 2A, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig2-data1-v1.zip
Figure 2—source data 2

Original files for western blot displayed in Figure 2A.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig2-data2-v1.zip
Figure 2—source data 3

Raw data file for Figure 2B–C , and F–G.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig2-data3-v1.xlsx
Figure 2—figure supplement 1
Download asset Open asset
YEATS2 drives epithelial-to-mesenchymal transition (EMT) in head and neck cancer cells.

(A) Immunoblot showing the expression levels of various EMT factors upon YEATS2 knockdown in SCC9. (B and D) Results of invasion assay after knockdown (B) or overexpression (D) of YEATS2 in SCC9 (Scale bar, 200 μm). (C) Immunoblot showing the expression level of Twist1 upon YEATS2 overexpression in SCC9. (E–F) Wound healing assay results performed after knockdown (E) or overexpression (F) of YEATS2 in SCC9 (Scale bar, 275 μm). (G–H) Results of 3D invasion assay showing change in invasive potential of SCC9 cells in collagen matrix after silencing (G, quantification below) or overexpression (H, quantification on right) of YEATS2. (Scale bar: ×4 , 200 μm; ×10 , 50 μm) Error bars, mean ± SEM; two-tailed t-test, ∗p<0.05, ∗∗p<0.01, n=3 biological replicates.

Figure 2—figure supplement 1—source data 1

PDF file containing original western blots for Figure 2—figure supplement 1A and C, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig2-figsupp1-data1-v1.zip
Figure 2—figure supplement 1—source data 2

Original files for western blot displayed in Figure 2—figure supplement 1A and C.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig2-figsupp1-data2-v1.zip
Figure 2—figure supplement 1—source data 3

Raw data file for Figure 2—figure supplement 1B, D and G-H.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig2-figsupp1-data3-v1.xlsx
Figure 3 with 1 supplement
Download asset Open asset
Regulation of epithelial-to-mesenchymal transition (EMT) by YEATS2 is SP1-dependent in head and neck cancer (HNC).

(A) Luciferase assay results showing the difference in relative luciferase activity of the two YEATS2 promoter deletion constructs in BICR10. (B) Plot showing decrease in mRNA expression of YEATS2 on SP1-knockdown in BICR10 cells. (C) Immunoblot showing the reduced expression level of YEATS2 upon SP1-knockdown in BICR10. (D) Plot depicting SP1 binding on YEATS2 promoter in SP1-ChIP-qPCR assay in BICR10. (E) Plot showing difference in relative luciferase activity of YEATS2 Luc-508 in shControl vs. shSP1 BICR10 cells (n=2). (F) Schematic showing mutation of SP1-binding site sequence in YEATS2 Luc-508 construct (above), and relative luciferase activity of wild-type (WT) vs. mutant (Mut) YEATS2 Luc-508 in BICR10 (below). (G) Immunoblot depicting the decreased Twist1 levels on SP1 knockdown and its subsequent rescue of expression upon YEATS2 overexpression in BICR10 (* indicates endogenous YEATS2 band). (H) Invasion assay images (with quantification on right) showing decrease and rescue of the percentage of invaded cells in shSP1 BICR10 cells, and shSP1 cells with YEATS2 overexpression, respectively (Scale bar, 200 μm). Error bars, mean ± SEM; two-tailed t-test, ∗p<0.05, ∗∗p<0.01, ∗∗∗p<0.001, n=3 biological replicates.

Figure 3—source data 1

PDF file containing original western blots for Figure 3C and G, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig3-data1-v1.zip
Figure 3—source data 2

Original files for western blot displayed in Figure 3C and G.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig3-data2-v1.zip
Figure 3—source data 3

Raw data file for Figure 3A–B, D–F , and H.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig3-data3-v1.xlsx
Figure 3—figure supplement 1
Download asset Open asset
Regulation of epithelial-to-mesenchymal transition (EMT) by YEATS2 is SP1-dependent in head and neck cancer (HNC).

(A) Luciferase assay results showing the difference in relative luciferase activity of the two YEATS2 promoter deletion constructs in SCC9. (B–C) Expression levels of SP1 (B) and KLF5 (C) in TCGA HNC gene expression dataset. (D) Plot showing decrease in mRNA expression of YEATS2 on SP1-knockdown in SCC9 cells. (E) Immunoblot showing the reduced expression level of YEATS2 upon SP1-knockdown in SCC9. (F) Plot depicting SP1 binding on YEATS2 promoter in SP1-ChIP-qPCR assay in SCC9 cells. (G) Relative luciferase activity of wild-type (WT) vs. mutant (Mut) YEATS2 Luc-508 in SCC9 (n=2). (H) Invasion assay images (with quantification on right) showing decrease and rescue of the percentage of invaded cells in shSP1 SCC9 cells, and shSP1 cells with YEATS2 overexpression, respectively. Scale bar, 200 μm. Error bars, mean ± SEM; two-tailed t-test, one-way ANOVA for (G), ns- non-significant, ∗p<0.05, ∗∗p<0.01, ∗∗∗p<0.001, n=3 biological replicates.

Figure 3—figure supplement 1—source data 1

PDF file containing original western blots for Figure 3—figure supplement 1E, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig3-figsupp1-data1-v1.zip
Figure 3—figure supplement 1—source data 2

Original files for western blot displayed in Figure 3—figure supplement 1E.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig3-figsupp1-data2-v1.zip
Figure 3—figure supplement 1—source data 3

Raw data file for Figure 3—figure supplement 1A, D and F-H.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig3-figsupp1-data3-v1.xlsx
Figure 4 with 4 supplements
Download asset Open asset
YEATS2 and glutaryl-CoA dehydrogenase (GCDH) regulate histone crotonylation in head and neck cancer (HNC).

(A) Gene set enrichment analysis (GSEA) plot showing enrichment of KEGG LYSINE_DEGRADATION_PATHWAY in TCGA samples stratified as YEATS2_high as compared to YEATS2_low samples (NES- net enrichment score, NOM p- nominal p-value). (B) Schematic depicting the canonical lysine degradation pathway highlighting the step that leads to crotonyl-CoA production via GCDH. (C) RT-qPCR result showing enhanced mRNA expression of GCDH in tumor vs. normal samples (n=8). (D) Immunoblot showing enhanced levels of H3K27cr (quantification on right) in nuclear lysates extracted from HNC tumor vs. normal samples (n=23). (E) Representative IHC images showing the levels of ECHS1, GCDH, YEATS2, H3K27cr, and Twist1 in HNC normal vs. tumor tissue samples (n=8) (Scale bar, 100 μm). (F) Quantification of IHC experiment performed in (E). (G–H) Immunoblot depicting the decrease in H3K27cr levels on (G) YEATS2- and (H) GCDH-knockdown in BICR10 cells. (I–J) Immunofluorescence images depicting the decrease in H3K27cr levels on (I) YEATS2- and (J) GCDH-knockdown in BICR10 cells (Scale bar, 10 μm). Error bars, mean ± SEM; two-tailed t-test, ∗p<0.05, ∗∗p<0.01, ∗∗∗p<0.001. n=3 biological replicates. N- normal, T- tumor.

Figure 4—source data 1

PDF file containing original western blots for Figure 4D and G–H, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig4-data1-v1.zip
Figure 4—source data 2

Original files for western blot displayed in Figure 4D and G–H.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig4-data2-v1.zip
Figure 4—source data 3

Raw data file for Figure 4C–D, F and I–J.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig4-data3-v1.xlsx
Figure 4—figure supplement 1
Download asset Open asset
YEATS2 and glutaryl-CoA dehydrogenase (GCDH) regulate histone crotonylation in head and neck cancer (HNC).

(A–B) Plots showing an increase or decrease in expression of GCDH (A) and ECHS1 (B) genes, respectively, in HNC TCGA data. (C) Scatter plot showing positive correlation between YEATS2 and GCDH expression levels in HNC TCGA data. (D) Immunoblot showing enhanced levels of H3K27cr in nuclear lysates extracted from HNC tumor (T) vs. normal (N) samples. ∗∗p<0.01, ∗∗∗p<0.001.

Figure 4—figure supplement 1—source data 1

PDF file containing original western blots for Figure 4—figure supplement 1D, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig4-figsupp1-data1-v1.zip
Figure 4—figure supplement 1—source data 2

Original files for western blot displayed in Figure 4—figure supplement 1D.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig4-figsupp1-data2-v1.zip
Figure 4—figure supplement 2
Download asset Open asset
Representative IHC images showing the levels of ECHS1, GCDH, YEATS2, H3K27cr, and Twist1 in head and neck cancer (HNC) normal (N) vs. tumor (T) tissue samples (Scale bar, 100 μm).
Figure 4—figure supplement 3
Download asset Open asset
Representative IHC images showing the colocalization of nuclear GCDH with H3K27cr (Scale bar, 100 μm).

Cells with nuclear GCDH-H3K27cr localization indicated by red arrows, whereas non-nuclear staining indicated by black arrows.

Figure 4—figure supplement 4
Download asset Open asset
YEATS2 and glutaryl-CoA dehydrogenase (GCDH) regulate histone crotonylation in head and neck cancer (HNC).

(A–B) Immunoblot depicting the decrease in H3K27cr levels on (A) YEATS2- and (B) GCDH-knockdown in SCC9 cells (YEATS2 band indicated by *). (C) Immunofluorescence images (quantification on right) depicting the increase in H3K27cr levels on YEATS2 overexpression (Scale bar, 10 μm).

Figure 4—figure supplement 4—source data 1

PDF file containing original western blots for Figure 4—figure supplement 4A–B, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig4-figsupp4-data1-v1.zip
Figure 4—figure supplement 4—source data 2

Original files for western blot displayed in Figure 4—figure supplement 4A–B.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig4-figsupp4-data2-v1.zip
Figure 4—figure supplement 4—source data 3

Raw data file for Figure 4—figure supplement 4C.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig4-figsupp4-data3-v1.xlsx
Figure 5 with 1 supplement
Download asset Open asset
YEATS2 regulates expression of epithelial-to-mesenchymal transition (EMT)-related SPARC in head and neck cancer (HNC).

(A) Venn diagram showing SPARC gene obtained after integration of RNA-seq data (genes downregulated in shControl vs. shYEATS2), YEATS2 ChIP-seq data and, hallmark EPITHELIAL_MESENCHYMAL_TRANSITION gene signature. (B) Integrative genome viewer (IGV) plot showing decrease in SPARC expression in shControl vs. shYEATS2 RNA-seq data. (C) YEATS2-ChIP-qPCR results showing decreased binding of YEATS2 on SPARC promoter in shYEATS2 BICR10 cells. (D) RT-qPCR results showing decreased expression of SPARC on YEATS2-knockdown in BICR10. (E) Immunoblot showing decreased expression of SPARC in conditioned media derived from shControl and shYEATS2 BICR10 cells. (F) p300-ChIP-qPCR results showing decreased binding of p300 on SPARC promoter in shYEATS2 BICR10 cells. (G) Immunoblot showing decreased SPARC levels on p300 knockdown in conditioned media from shControl and shEP300 BICR10 cells. (H) Immunoblot showing co-immunoprecipitation of YEATS2 by p300 in YEATS2-overexpressed BICR10 cells (endogenous YEATS2 band is highlighted by *). (I–J) Immunoblot depicting the overexpression of Flag-tagged SPARC in shYEATS2 BICR10 cells (I), and invasion assay images (J) (with quantification on right) showing decrease and rescue of the percentage of invaded cells in shControl vs. shYEATS2 BICR10 cells, and shYEATS2 cells with SPARC overexpression, respectively (Scale bar, 200 μm). Error bars, mean ± SEM; two-tailed t-test, ∗p<0.05, ∗∗p<0.01, ∗∗∗p<0.001, n=3 biological replicates.

Figure 5—source data 1

PDF file containing original western blots for Figure 5E and G–I, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig5-data1-v1.zip
Figure 5—source data 2

Original files for western blot displayed in Figure 5E and G–I.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig5-data2-v1.zip
Figure 5—source data 3

Raw data file for Figure 5C–D, F and J.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig5-data3-v1.xlsx
Figure 5—figure supplement 1
Download asset Open asset
YEATS2 regulates expression of epithelial-to-mesenchymal transition (EMT)-related SPARC in head and neck cancer (HNC).

(A) Pie chart showing the genomic distribution of YEATS2 peaks in BICR10 cells. (B) Integrative genome viewer (IGV) plot showing the enrichment of YEATS2 on the promoter of SPARC in YEATS2 ChIP-seq data. Arrows indicate the regions probed for YEATS2 binding on SPARC in YEATS2-ChIP-qPCR assay; region corresponding to F1R1 showed significant change in YEATS2 occupancy in shYEATS2 BICR10 cells. (C) Increased expression of SPARC gene in TCGA HNC tumor vs. normal data. (D) YEATS2-ChIP-qPCR results showing decreased binding of YEATS2 on SPARC promoter in shYEATS2 SCC9 cells. (E) RT-qPCR results showing decreased expression of SPARC on YEATS2-knockdown in SCC9. (F) Immunoblot showing decreased expression of SPARC on YEATS2-knockdown in SCC9. (G) EP300 expression levels in Normal vs. Tumor HNC samples from TCGA. Error bars, mean ± SEM; two-tailed t-test, ∗p<0.05, ∗∗p<0.01, ∗∗∗p<0.001, n=3 biological replicates, N-normal, T-tumor.

Figure 5—figure supplement 1—source data 1

PDF file containing original western blots for Figure 5—figure supplement 1F, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig5-figsupp1-data1-v1.zip
Figure 5—figure supplement 1—source data 2

Original files for western blot displayed in Figure 5—figure supplement 1F.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig5-figsupp1-data2-v1.zip
Figure 5—figure supplement 1—source data 3

Raw data file for Figure 5—figure supplement 1D–E.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig5-figsupp1-data3-v1.xlsx
Figure 6 with 1 supplement
Download asset Open asset
Maintenance of H3K27cr marks is dependent on YEATS2-mediated recruitment of p300 on SPARC promoter.

(A) H3K27cr-ChIP-qPCR results showing decrease in H3K27cr enrichment on SPARC promoter on YEATS2 knockdown. (B) H3K27ac-ChIP-qPCR results showing non-significant change in H3K27ac enrichment on SPARC promoter on YEATS2 knockdown (n=2). (C) RNA Pol II ChIP-qPCR showing decrease in Pol II occupancy on SPARC after YEATS2 downregulation in BICR10. (D) H3K27cr-ChIP-qPCR results showing increase in H3K27cr enrichment on SPARC promoter on treating BICR10 cells with 2.5 mM sodium crotonate (NaCr). (E–F) RT-qPCR (E) and immunoblot (F) showing enhanced SPARC expression in untreated BICR10 cells vs. BICR10 cells treated with 2.5 mM NaCr. (G) Invasion assay images (with quantification on right) showing increased invasion on treating BICR10 cells with 2.5 mM NaCr (Scale bar, 200 μm). (H) H3K27cr-ChIP-qPCR data depicting the lack of significant difference in H3K27cr levels between shYEATS2 vs. shYEATS2 + 2.5 mM NaCr cells. (I) Immunoblot showing inability of NaCr treatment to rescue SPARC expression in YEATS2-knockdown BICR10 cells. (J) H3K27cr ChIP-qPCR showing decrease in H3K27cr levels in BICR10 shControl vs. shEP300 cells. (K–L) p300 (K) and H3K27cr ChIP-qPCR (L) showing decrease and subsequent rescue in p300 binding and H3K27cr enrichment on SP1 knockdown and YEATS2 overexpression, respectively. Error bars, mean ± SEM; two-tailed t-test, ns- non-significant, ∗p<0.05, ∗∗p<0.01, ∗∗∗p<0.001.

Figure 6—source data 1

PDF file containing original western blots for Figure 6F and I, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig6-data1-v1.zip
Figure 6—source data 2

Original files for western blot displayed in Figure 6F and I.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig6-data2-v1.zip
Figure 6—source data 3

Raw data file for Figure 6A–E, G–H , and J–L.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig6-data3-v1.xlsx
Figure 6—figure supplement 1
Download asset Open asset
YEATS2 regulates SPARC expression by recruiting crotonyltransferase p300 at SPARC promoter.

(A) H3K27cr-ChIP-qPCR results showing decrease in H3K27Cr enrichment on SPARC promoter on YEATS2 knockdown in SCC9 cells. (B) H3K27ac-ChIP-qPCR results showing non-significant change in H3K27ac enrichment on SPARC promoter on YEATS2 knockdown in SCC9. (C) H3K27cr-ChIP-qPCR results showing increase in H3K27cr enrichment on SPARC promoter on treating SCC9 cells with 2.5 mM sodium crotonate (NaCr). (D–E) RT-qPCR (D) and immunoblot (E) showing enhanced SPARC expression in untreated SCC9 cells vs. SCC9 cells treated with 2.5 mM NaCr. (F) Invasion assay images (with quantification on right) showing increased invasion on treating SCC9 cells with 2.5 mM NaCr (Scale bar, 200 μm). Error bars, mean ± SEM; two-tailed t-test, ns- non-significant, ∗p<0.05, ∗∗p<0.01.

Figure 6—figure supplement 1—source data 1

PDF file containing original western blots for Figure 6—figure supplement 1E, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig6-figsupp1-data1-v1.zip
Figure 6—figure supplement 1—source data 2

Original files for western blot displayed in Figure 6—figure supplement 1E.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig6-figsupp1-data2-v1.zip
Figure 6—figure supplement 1—source data 3

Raw data file for Figure 6—figure supplement 1A–D and F.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig6-figsupp1-data3-v1.xlsx
Figure 7 with 1 supplement
Download asset Open asset
GCDH expression is SP1-dependent and it regulates H3K27cr-mediated SPARC expression with YEATS2 synergistically.

(A) RT-qPCR results showing decrease in SPARC expression on GCDH-knockdown in BICR10 cells. (B) Immunoblot showing the reduced expression of SPARC upon GCDH-knockdown in SCC9 cells. (C) Decrease in H3K27cr levels on SPARC promoter in shGCDH BICR10 cells (n=2). (D) Immunoblot showing the reduced expression of GCDH on SP1-knockdown in BICR10 cells. (E) Plot showing SP1 binding on GCDH promoter in SP1-ChIP assay in BICR10. (F) Invasion assay images (quantification shown below) showing decrease in invasion of BICR10 cells on GCDH knockdown (Scale bar, 200 μm). (G) IF images (quantification shown below) showing reduced nuclear localization of GCDH in shYEATS2 BICR10 cells. Scale bar, 5 μm. (H) Immunoblot depicting decreased SPARC expression on SP1 knockdown and its subsequent rescue upon dual YEATS2 and GCDH overexpression in shSP1 BICR10 cells. Error bars, mean ± SEM; two-tailed t-test, ∗p<0.05, ∗∗p<0.01, ∗∗∗p<0.001, n=3 biological replicates.

Figure 7—source data 1

PDF file containing original western blots for Figure 7B, D and H, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig7-data1-v1.zip
Figure 7—source data 2

Original files for western blot displayed in Figure 7B, D and H.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig7-data2-v1.zip
Figure 7—source data 3

Raw data file for Figure 7A, C and E–G.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig7-data3-v1.xlsx
Figure 7—figure supplement 1
Download asset Open asset
Glutaryl-CoA dehydrogenase (GCDH) expression is SP1-dependent and it regulates H3K27cr-mediated SPARC expression with YEATS2 synergistically.

(A) RT-qPCR results showing decrease in SPARC expression on GCDH-knockdown in SCC9 cells. (B) Co-IP Immunoblot showing lack of interaction between YEATS2 and GCDH in HEK293T cells. (C) Scatter plot showing positive correlation between GCDH and SP1 expression levels in HNC TCGA data. (D) Immunoblot showing the reduced expression of GCDH on SP1-knockdown in SCC9 cells. (E) Plot showing SP1 binding on GCDH promoter in SP1-ChIP assay in SCC9. (F) Invasion assay images showing an increase in invasion of BICR10 cells on GCDH overexpression (Scale bar, 200 μm). Error bars, mean ± SEM; two-tailed t-test, ∗p<0.05, ∗∗p<0.01, n=3 biological replicates.

Figure 7—figure supplement 1—source data 1

PDF file containing original western blots for Figure 7—figure supplement 1B and D, indicating the relevant bands.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig7-figsupp1-data1-v1.zip
Figure 7—figure supplement 1—source data 2

Original files for western blot displayed in Figure 7—figure supplement 1B and D.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig7-figsupp1-data2-v1.zip
Figure 7—figure supplement 1—source data 3

Raw data file for Figure 7—figure supplement 1A, E and F.

https://cdn.elifesciences.org/articles/103321/elife-103321-fig7-figsupp1-data3-v1.xlsx
Figure 8
Download asset Open asset
YEATS2 regulates gene expression by maintaining H3K27cr levels globally.

(A) Differential ChIP-seq profile of H3K27cr in shControl vs. shYEATS2. (B) Overrepresentation analysis showing pathways enriched among genes with decreased H3K27cr enrichment in H3K27cr ChIP-seq data. (C) Overlap of genes with reduced H3K27cr on their promoter and downregulated genes in RNA-seq. (D–E) Integrative genome viewer (IGV) plot showing representative examples of genes (CREB3L2 and ERG) common in (C).

Figure 9
Download asset Open asset
Schematic showing YEATS2- and glutaryl-CoA dehydrogenase (GCDH)-mediated regulation of epithelial-to-mesenchymal transition (EMT) through H3K27cr-dependent SPARC upregulation in head and neck cancer.
Author response image 1
Download asset Open asset
Author response image 2
Download asset Open asset
Author response image 3
Download asset Open asset
Author response image 4
Download asset Open asset

Tables

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (E. coli)Stbl3Thermo Fisher ScientificC737303
Cell line (Human)BICR10ECACC04072103,
RRID:CVCL_2307
Cell line (Human)SCC9ECACC89062003,
RRID:CVCL_1685
Cell line (Human)HEK293TATCCCRL-3216,
RRID:CVCL_0063
Transfected construct (Human)shControlSigma-AldrichSHCLNGLentiviral particles were prepared
using this shRNA (sequence
provided in Table 1)
Transfected construct (Human)YEATS2 shRNAs (YEATS2_1 and YEATS2_2)Sigma-AldrichSHCLNGLentiviral particles were prepared
using these shRNAs (sequences
provided in Table 1)
Transfected construct (Human)SP1 shRNAs (SP1_1 and SP1_2)Sigma-AldrichSHCLNGLentiviral particles were prepared
using these shRNAs (sequences
provided in Table 1)
Transfected construct (Human)p300 shRNAs (EP300_1 and EP300_2)Sigma-AldrichSHCLNGLentiviral particles were prepared
using these shRNAs (sequences
provided in Table 1)
Transfected construct (Human)GCDH shRNAs (GCDH_1 and GCDH_2)Sigma-AldrichSHCLNGLentiviral particles were prepared
using these shRNAs (sequences
provided in Table 1)
AntibodyAnti-YEATS2 (Rabbit polyclonal)ProteintechCat #24717–1-AP, RRID:AB_2879686IB (1:1000), ChIP (1:100),
IHC (1:50)
AntibodyAnti-H3 (Mouse monoclonal)Active MotifCat #61475, RRID:AB_2687473IB (1:1000)
AntibodyAnti-Twist1 (Rabbit polyclonal)Cell Signaling Technology (CST)Cat #46702 S, RRID:AB_2799308IB (1:500), IHC (1:50)
AntibodyAnti-Vimentin (Rabbit polyclonal)AbcamCat #ab137321, RRID:AB_2921312IB (1:3000)
AntibodyAnti-N-cadherin (Mouse monoclonal)AbcamCat #ab19348, RRID:AB_444868IB (1:1000)
AntibodyAnti-GAPDH (Rabbit monoclonal)CSTCat #5174 S, RRID:AB_10622025IB (1:2000)
AntibodyAnti-SP1 (Rabbit monoclonal)CSTCat #9389 S, RRID:AB_11220235IB (1:1000), ChIP (1:100)
AntibodyAnti-GFP (Rabbit polyclonal)Affinity BiosciencesCat #T0006, RRID:AB_2839423IB (1:1000), Co-IP (1:100)
AntibodyAnti-H3K27cr (Rabbit monoclonal)PTM BioCat #PTM-545RM, RRID:AB_2927631IB (1:1000), ChIP (1:500),
IF (1:200), IHC (1:200)
AntibodyAnti-GCDH (Rabbit polyclonal)Sigma-AldrichCat #HPA043252, RRID:AB_2678390IB (1:1000), IHC (1:50),
Co-IP (1:100), IF (1:50)
AntibodyAnti-SPARC (Rabbit polyclonal)CSTCat #5420 S, RRID:AB_10692794IB (1:1000)
AntibodyAnti-p300 (Rabbit monoclonal)CSTCat #54062 S, RRID:AB_2799450IB (1:1000), Co-IP (1:100),
ChIP (1:100)
AntibodyAnti-Flag Tag (Rat monoclonal)NovusCat #NBP1-06712SS, RRID:AB_1625982IB (1:500)
AntibodyAnti-ECHS1 (Rabbit polyclonal)Sigma-AldrichCat #HPA022476, RRID:AB_1847975IHC (1:50)
AntibodyAnti-H3K27ac (Rabbit polyclonal)AbcamCat #ab4729, RRID:AB_2118291ChIP (1:500)
AntibodyNormal Rabbit IgGCSTCat #2729 S, RRID:AB_1031062ChIP (1:100 or 1:500),
Co-IP (1:100)
AntibodyAlexa-Fluor 680 anti-rabbit IgGInvitrogenCat #A32734; RRID:AB_2633283IB (1:50,000)
AntibodyAlexa-Fluor 800 anti-mouse IgGInvitrogenCat #A32730; RRID:AB_2633279IB (1:50,000)
AntibodyAlexa-Fluor 680 anti-rat IgGInvitrogenCat #A-21096, RRID:AB_141554IB (1:10,000)
AntibodyAlexa-Fluor 555 anti-rabbit IgGInvitrogenCat # A32732, RRID:AB_2633281IF (1:3000)
Recombinant DNA reagentpEGFP-C3BD Biosciences Clontech6082–1
Recombinant DNA reagentpEGFP-C3-YEATS2This paperYEATS2 overexpression
construct
Recombinant DNA reagentpGL3-BasicPromegaE1751
Recombinant DNA reagentpGL3-Basic-Luc 508This paperYEATS2 promoter deletion
construct
Recombinant DNA reagentpGL3-Basic-Luc 311This paperYEATS2 promoter deletion
construct
Recombinant DNA reagentpGL3-Basic-Luc 508 MutThis paperYEATS2 promoter deletion
construct with mutated SP1
binding site
Recombinant DNA reagentpCMV-3Tag-1AAgilent240195
Recombinant DNA reagentpCMV-3Tag-1A-SPARCThis paperSPARC overexpression construct
Recombinant DNA reagentpCMV-3Tag-1A-GCDHThis paperGCDH overexpression construct
Recombinant DNA reagentpCMV-3Tag-1A-SP1This paperSP1 overexpression construct
Chemical compound, drugCrotonic acidSigma-Aldrich113018Used to prepare sodium crotonate
Software, algorithmSTARDobin et al., 2013RRID:SCR_004463https://code.google.com/archive/p/rna-star/
Software, algorithmHTSeq v2.0.5Anders et al., 2015RRID:SCR_005514https://github.com/htseq/htseq
Software, algorithmDESeq2Love et al., 2014RRID:SCR_015687DESeq2 package
Software, algorithmGene Set Enrichment Analysis (GSEA)Subramanian et al., 2005RRID:SCR_003199http://software.broadinstitute.org/gsea/
Software, algorithmSamtoolsLi et al., 2009RRID:SCR_002105http://htslib.org/
Software, algorithmdeepTools v3.5.6Ramírez et al., 2014RRID:SCR_016366https://github.com/deeptools/deepTools
Software, algorithmBowtie2 v2.3.4Langmead and Salzberg, 2012RRID:SCR_016368https://bowtie-bio.sourceforge.net/bowtie2/manual.shtml
Software, algorithmMACS2 v2.1.2Zhang et al., 2008RRID:SCR_013291https://github.com/macs3-project/MACS/
Software, algorithmDiffBind v3.6.5Stark and Brown, 2012RRID:SCR_012918https://bioconductor.org/packages/release/bioc/html/DiffBind.html
Table 1
Sequences of shRNAs used in this study.
shRNATarget Sequence 5'–3'
shControlCCGGTACAACAGCCACAACGTCTATCTCGAGATAGACGTTGTGG
shYEATS2_1CCGGCCAGTCAGAAATCTGTTCTATCTCGAGATAGAACAGATTTCTGACTGGTTTTTTG
shYEATS2_2CCGGCGTCAGAGTTCAAGTTCATTTCTCGAGAAATGAACTTGAACTCTGACGTTTTTTG
shSP1_1CCGGCCCAAGTTTATTTCTCTCTTACTCGAGTAAGAGAGAAATAAACTTGGGTTTTT
shSP1_2CCGGGCAGCAACTTGCAGCAGAATTCTCGAGAATTCTGCTGCAAGTTGCTGCTTTTT
shGCDH_1CCGGATGGGATTTCTGACGAGTATCCTCGAGGATACTCGTCAGAAATCCCATTTTTTG
shGCDH_2CCGGGATGAGAGCAGACTCCATTTACTCGAGTAAATGGAGTCTGCTCTCATCTTTTTG
shEP300_1CCGGCCAGCCTCAAACTACAATAAACTCGAGTTTATTGTAGTTTGAGGCTGGTTTTTG
shEP300_2CCGGCCCGGTGAACTCTCCTATAATCTCGAGATTATAGGAGAGTTCACCGGGTTTTTG
Table 2
Sequences of primers used in this study.
Molecular CloningForward primer 5'–3'Reverse primer 5'–3'
YEATS2 Luc-508CGGGGTACCGATTAATAGGGAAGCTCATACACGCCCAAGCTTAAACAATGCCCCGGAGAG
YEATS2 Luc-311CGGGGTACCATCCCTGGGAGCTCCGCCCCGACCCAAGCTTAAACAATGCCCCGGAGAG
YEATS2 Luc-508 MutAGCCCGGACCAGCCCCGCCCATACCATACCATAC
CTCATCCCTGGGAGCTCCG		CGGAGCTCCCAGGGATGAGGTATGGTATGGT
ATGGGCGGGGCTGGTCCGGGCT
YEATS2 OverexpressionATAAGAATGCGGCCGCATGTCTGGAATCAAGCGAACCATCAACGCGTCGACTCACTGGTCCTCATTCAATATTCC
SPARC OverexpressionCCCAAGCTTATGAGGGCCTGGATCTTCTTTCCGCGGATCCTTAGATCACAAGATCCTTGTCG
GCDH OverexpressionCCCAAGCTTATGGCCCTGAGAGGCGTCTACGCGTCGACTCACTTGCTGGCCGTGAACG
SP1 OverexpressionCCGGAATTCATGAGCGACCAAGATCACTCCATACGCGTCGACTCAGAAGCCATTGCCACTGATAT
RT-qPCRForward primer 5'–3'Reverse primer 5'–3'
YEATS2TGCACAACAGTCTGAAGGAATGTGGCAGCCTTGCAGGTT
MRGBPGAAGAACTCCTCAGACTTGGGCTTGGCAGCACTGGGACT
RUVBL1CAGAAATCACAGACAAACTTCGAGTGGATGCAAAGATGACGAT
SPARCGCAGCAATGACAACAAGACCAAGGCCCGATGTAGTCCAG
GCDHCCTCGACAGGATGCAGTTTTGTCCTGGTCCTTCAAGC
RPS16AAACGCGGCAATGGTCTCATCAAGTGGAGATGGACTGACGGATAGCAT
ChIP-qPCRForward primer 5'–3'Reverse primer 5'–3'
SPARC PromoterAGATCAAGACACTTGGGCCTGATGACCCAGAACAGCCTCT
YEATS2 PromoterGTCCCAGCCCGGACCAGCCCCCCGCACGTCAGCAGCTG
GCDH PromoterCGGATTCTAGGAGGAACCAATGCGAGGCTACAGTGCAACTGAC
Author response table 1
HUGO Gene SymbolCommon NameMarker TypeStatus in shControl vs. shYEATS2 RNA-seq
COL4A1Collagen IV alpha 1EpithelialDownregulated
FN1FibronectinMesenchymalDownregulated
S100A4S100A4MesenchymalDownregulated
CTNNB1Beta-cateninDualDownregulated
CDH11Cadherin-11DualDownregulated
MMP2MMP2MesenchymalDownregulated
TWIST1Twist1MesenchymalDownregulated
CDH1E-cadherinEpithelialUpregulated
GSK3BGSK3BDualUpregulated
SDC1Syndecan-1EpithelialUpregulated
CLDN1Claudin-1EpithelialUpregulated

Additional files

Supplementary file 1

Results for differential gene expression analysis for 10 shortlisted epigenetic factors.

https://cdn.elifesciences.org/articles/103321/elife-103321-supp1-v1.xlsx
Supplementary file 2

Differentially expressed genes in shControl vs. shYEATS2 RNA-seq data (FDR-adjusted p<0.05).

https://cdn.elifesciences.org/articles/103321/elife-103321-supp2-v1.xlsx
Supplementary file 3

Result of gene set enrichment analysis (GSEA) analysis showing positive correlation between YEATS2 expression and lysine degradation pathway genes in TCGA head and neck cancer (HNC) samples.

https://cdn.elifesciences.org/articles/103321/elife-103321-supp3-v1.xlsx
Supplementary file 4

List of genes having YEATS2 ChIP-seq peak in their promoters.

https://cdn.elifesciences.org/articles/103321/elife-103321-supp4-v1.xlsx
Supplementary file 5

List of genes common between ChIP-seq_Lost and RNA-seq_Down groups.

https://cdn.elifesciences.org/articles/103321/elife-103321-supp5-v1.xlsx
Supplementary file 6

Clinical characteristics of patients.

https://cdn.elifesciences.org/articles/103321/elife-103321-supp6-v1.xlsx
MDAR checklist
https://cdn.elifesciences.org/articles/103321/elife-103321-mdarchecklist1-v1.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Deepak Pant
  2. Parik Kakani
  3. Rushikesh Joshi
  4. Abin Sabu
  5. Shruti Agrawal
  6. Atul Samaiya
  7. Sanjeev Shukla
(2025)
Interplay of YEATS2 and GCDH regulates histone crotonylation and drives EMT in head and neck cancer
eLife 14:RP103321.
https://doi.org/10.7554/eLife.103321.3