Roles of the membrane-binding motif and the C-terminal domain of RNase E in localization and diffusion in E. coli
- Department of Physics, University of Illinois Urbana-Champaign, United States
- Theoretical and Computational Biophysics Group, NIH Center for Macromolecular Modeling and Visualization, Beckman Institute for Advanced Science and Technology, University of Illinois Urbana-Champaign, United States
- Department of Biochemistry, University of Illinois Urbana-Champaign, United States
- Center for Biophysics and Quantitative Biology, University of Illinois Urbana–Champaign, United States
- Moduli Technologies, LLC, United States
Figures
Figure 1 with 3 supplements
Analysis of single-molecule images for the subcellular localization and dynamics of proteins.
(A) Single-molecule image analysis. Spots were detected in each frame (highlighted with yellow circles), and tracks were created across frames (different colors were chosen for different tracks). (B) Cell detection. Cell outlines were determined from bright-field images. Only non-dividing cells were analyzed (indicated by white outlines). (C) Normalized position of spots of RNE along the short (x) and the long (y) axes of an example cell. Red spots are inside the cell endcaps, and cyan spots are in the cylindrical region of the cell. (D) xNorm histogram of RNE and LacY. Only spots in the cylindrical region of cells (like cyan spots in C) were included, totaling n = 143,000 spots. The standard error of the mean (SEM) calculated from bootstrapping is displayed as a shaded area but is smaller than the line width (see Figure 1—figure supplement 1 for details). (E) The membrane-binding percentage (MB%) of RNE, LacY, and LacZ. Error bars are from the 95% confidence interval. (F) Histogram of absolute xNorm and model fitting of RNE, LacY, and LacZ to determine MB%. Orange highlights indicate the range of xNorm expected based on the standard deviations in the parameter values estimated by MCMC. The white scale bars in panels A and B are 1 µm. See Supplementary file 6 for data statistics.
Figure 1—figure supplement 1
The xNorm histogram of RNE.
The histogram shown in Figure 1D is replotted to show SEM in two ways. The SEM from bootstrapping is displayed as error bars (black lines) and the original shaded region (red). This demonstrates that the original presentation with the shaded error region (red) is very small.
Figure 1—figure supplement 2
Comparison of trajectory counts in live and fixed cells to test for undercounting of cytoplasmic molecules.
(A) Ratio of the mean number of tracks in live versus fixed cells. WT is for RNE-mEos3.2 (SK187) and ΔMTS is for RNE ΔMTS-mEos3.2 (SK249). Error bars represent the uncertainty derived from the standard deviation of track numbers in live or fixed cells. (B) The mean number of tracks per cell measured from live versus fixed cells. Fisher’s exact test result of p = 0.18 suggests no significant association between detectability and cytoplasmic versus membrane localization.
Figure 1—figure supplement 3
xNorm fitting model.
(A) Coordinates used in a theoretical model for xNorm histogram. (B–D) Theoretical xNorm histograms for membrane and cytoplasmic molecules. Top row: simulated spot distribution on the membrane (orange) and in the cytoplasm (blue) shown in the vertical cross-section of a cell with diameter of 1 µm. Bottom row: corresponding theoretical xNorm histograms with parameters: (B) dilF = 1.5, locErr = 0, fCut = 0, (C) dilF = 1.5, locErr = 40 nm, fCut = 0, (D) dilF = 1.5, locErr = 40 nm, fCut = 0.3 µm. Random spots were generated either on the periphery of or inside of the circle representing the cell’s inner membrane. dilF defines the inner membrane away from the cell boundary (black dotted line). In C and D, the localization error was applied by adding a 2D Gaussian noise to all spots. In D, the spots beyond the depth of focus in the z-direction were eliminated.
Figure 2
Mutations in the membrane-targeting sequence (MTS) affecting the localization of RNE.
(A) Linear representation of the RNE monomer. The N-terminal domain (NTD) and the C-terminal domain (CTD) are defined as regions flanking the MTS. Numbers indicate the amino acid residues. (B) xNorm histograms of cytoplasmic RNE mutants. (C) Helical wheel diagram of the MTS region of RNE (residue 568–582). (D) xNorm histogram of RNE MTS point mutants. (E) Membrane-binding percentage (MB%) of RNE MTS point mutants. Error bars indicate the 95% confidence interval. In panels B and D, the SEM from bootstrapping is shown but is smaller than the line width. See Supplementary file 6 for data statistics.
Figure 3 with 4 supplements
RNE diffusion, influenced by membrane binding and interactions with mRNAs.
(A) Mean-squared displacement (MSD) versus time delay (τ) for RNE. Ensemble-averaged time-averaged (EATA) MSD was calculated by averaging the time-averaged MSD of individual tracks. (B) Mean diffusion coefficients of various RNE mutants, lacking the membrane-targeting sequence (MTS) and/or the C-terminal domain (CTD). Change in the mean diffusion coefficient of RNE (C), LacY (D), and ribosome L1 protein (E) when cellular RNAs were depleted by rifampicin treatment. Error bars in panels B–E represent the SEM. See Supplementary file 6 for data statistics.
Figure 3—figure supplement 1
Distribution of RNE’s diffusion coefficients and single- or double-Gaussian fit (both R2 = 0.98).
For a single-Gaussian fit (left), Equation 3 was used. The fitted D coefficient, D1, is 0.014 [0.014, 0.015] µm2/s. The standard deviation of the Gaussian function (σ) was 0.013 [0.013, 0.014] µm2/s. For a double-Gaussian fit (right), Equation 4 was used, yielding D1 of 0.013 [0.013, 0.014] µm2/s and σ1 equal to 0.012 [0.012, 0.013] µm2/s for the slow population (membrane-bound) and D2 equal to 0.043 [0.041, 0.046] µm2/s and σ2 of 0.008 [0.006, 0.01] µm2/s for the fast population (cytoplasmic). The fraction of the slow population was fixed to 93%. See Supplementary file 6 for data statistics.
Figure 3—figure supplement 2
Ensemble-averaged, time-averaged (EATA) mean-squared displacement (MSD) of WT RNE, RNE in rif-treated cells, and ribosomal protein L1.
Surface-immobilized streptavidin-mEos3.2 was tracked and its EATA MSD was plotted to denote the diffusion of stationary objects, as a proxy for the lower limit of D in our imaging condition. Error bars are the SEM. See Supplementary file 6 for data statistics.
Figure 3—figure supplement 3
Distribution of ribosomal protein L1’s diffusion coefficients and a two-population Gaussian fit (R2 = 0.99).
Equation 4 was used for the fit, yielding D1 of 0.015 [0.014, 0.016] µm2/s and σ1 equal to 0.017 [0.016, 0.018] µm2/s for the slow population (polysomes) and D2 equal to 0.054 [0.044, 0.065] µm2/s and σ2 of 0.042 [0.037, 0.048] µm2/s for the fast population (free ribosomal units). The fraction of the slow population was 0.59 [0.51, 0.68]. [ ] indicates a 95% confidence interval. See Supplementary file 6 for data statistics.
Figure 3—figure supplement 4
Effect of chloramphenicol treatment and induction of lacZ mRNA from plasmids on RNE diffusion.
(A) Nucleoid change upon chloramphenicol treatment. The nucleoid (red, visualized with HU-mcherry, SK512) became more compact (right) compared to untreated cells (left) due to an increase in polysome concentrations—an effect shown in previous studies (Stracy et al., 2015; Reyer et al., 2021). 100 µg/ml of chloramphenicol was added to the liquid culture (SK512) for 30 min incubation and also to the agarose pad for imaging. Scale bar = 1 µm. (B) Overexpressed lacZ mRNA levels measured by qRT-PCR. 1 mM IPTG was added to the exponentially growing SK411 cells for 1 hr. Fold change was calculated relative to a reference gene, gapA. The IPTG-induced cells (SK411) showed about 25 times higher lacZ mRNA levels than those from uninduced cells, supporting that the overexpression was effective. Error bars denote the standard deviation from three replicates. (C) Mean diffusion coefficient of WT RNE under various cellular conditions. Diffusion of WT RNE was measured in untreated cells (WT; strain SK187), after treating cells with chloramphenicol (100 μg/ml) for 30 min (+Chlor; strain SK187), and in the presence of a high level of lacZ mRNA from a high-copy plasmid (by treating cells of strain SK411 with 1 mM IPTG for 60 min). Error bars are the SEM. See Supplementary file 6 for data statistics.
Figure 4 with 1 supplement
Localization and diffusion of membrane-binding motifs.
(A) Cartoon schematic of the membrane-binding motifs used in this study (not to scale). The orange circles indicate mEos3.2 used for imaging. (B) xNorm histograms of membrane-binding motifs. The SEM from bootstrapping is displayed but smaller than the line width. Data are from at least 107,000 spots. (C) Mean diffusion coefficients of membrane-binding motifs. Error bars are the SEM from at least 3000 tracks. (D) Estimated mass of membrane-binding motifs based on the amino acid sequence including linkers and mEos3.2. (E) Diffusion coefficients of the membrane-binding motifs obtained from all-atom molecular dynamics (MD) simulation. (F) Representative simulation snapshots of the membrane-binding motifs embedded in the E. coli membrane. Proteins are displayed in purple, and lipid tails are shown in cyan. Nitrogen and phosphorus atoms of the lipid head groups are represented in the van der Waals form in blue and gray, respectively. See Supplementary file 6 for data statistics.
Figure 4—figure supplement 1
All-atom molecular dynamics (MD) simulations of membrane-targeting sequence (MTS) and LacY variants.
(A) Mean-squared displacement (MSD) from simulation data. (B) Interaction energy between the membrane motif and the lipid membrane.
Figure 5 with 2 supplements
Localization and diffusion of chimeric RNE with or without the C-terminal domain (CTD).
Cartoon schematic of RNE chimeric variants with the CTD (A) and without the CTD (B). They are not to scale. (C, D) xNorm histograms of chimeric RNE localization compared with that of LacY. The SEM from bootstrapping is displayed but smaller than the line width. Membrane-binding percentage (MB%) of chimeric RNE mutants without the CTD (E) or with the CTD (F) with various membrane-binding motifs. Error bars are from a 95% confidence interval. Mean diffusion coefficients of chimeric RNE without the CTD (G) or with the CTD (H). Error bars are the SEM. Each dataset contains at least 70,000 tracks for diffusion or 72,000 spots for xNorm. See Supplementary file 6 for data statistics.
Figure 5—figure supplement 1
Linear representation of RNE monomer in various mutants used in this study.
The numbers indicate amino acid residues.
Figure 5—figure supplement 2
Clustering of RNE in E. coli.
(A) Example images of WT RNE or RNE ΔCTD (or RNE (1–592)) fused with Venus. The white scale bar is 1 µm. WT RNE (SK482) shows patch localization on the membrane (i–iii). RNE ΔCTD (SK486) also shows patch membrane localization (iv, v), but in some cells (vi), it shows smooth membrane localization. Images are from live cells grown the same way as single-molecule imaging experiments. RNE-mEos3.2 localization in fixed cells. Each spot represents the first localization event of a track from WT RNE (B) or ΔCTD (C). (D, E) H(r) clustering metric for spots shown in panels B and C, respectively. The clustering metric was also calculated for simulated spot distribution based on a complete spatial randomness (CSR) on the membrane with the same number of spots as the experimental cell. (F) Cluster analysis based on the difference in the areas of experimental and simulated H(r) data from individual cells (n = 123 cells for WT RNE and n = 133 cells for RNE ΔCTD). RNE ΔCTD is shifted to the left of WT RNE and is statistically different (p = 5.1e−08), indicating RNE ΔCTD is less clustered than WT RNE.
Figure 6 with 2 supplements
lacZ mRNA degradation rates in RNE mutant strains.
lacZ mRNA levels in WT RNE (A, strain SK595) and in RNE-LacY2-CTD (B, strain SK505) when lacZ transcription was induced with 0.2 mM IPTG at t = 0 s and re-repressed with 500 mM glucose at t = 75 s. Blue and yellow regions indicate the time windows used to measure kd1 and kd2, respectively, by exponential fitting of 5′ lacZ mRNA (Z5) in individual replicates. Co-transcriptional and post-transcriptional lacZ mRNA degradation rates, kd1 (C, E) and kd2 (D, F), respectively, in various RNE mutants containing different membrane-binding motifs, either with the CTD (solid bars, C, D) or ΔCTD (light bars, E, F). The dotted lines indicate the kd1 and kd2 values of cytoplasmic RNE ΔMTS (strain SK339 in C, D) (Kim et al., 2024) or RNE ΔMTS ΔCTD (strain SK370, in E, F). In all panels, error bars represent the standard deviations from two to three biological replicates. Two-sample t-tests were performed relative to the MTS case in each graph (see Supplementary file 7 for the p-values). ***, ** and * indicate p<0.001, p<0.01 and p<0.05, respectively, and ns indicates a statistically nonsignificant difference.
Figure 6—figure supplement 1
lacZ mRNA degradation rates when RNE is fused to mEos3.2 or not (SK595 vs. SK98).
This comparison is to check the effect of a fluorescent protein attached to RNE on its activity. Both kd1 and kd2 are similar in cell strains containing RNE with or without mEos3.2 attached, suggesting that the fusion does not significantly affect the function of RNE.
Figure 6—figure supplement 2
Effect of RNE overexpression on lacZ mRNA degradation kinetics.
lacZ mRNA degradation was measured in WT RNE (strain SK595) and overexpression of WT RNE (strain SK394). The second-copy RNE was induced with 0.2% arabinose overnight. Error bars are the standard deviations from three biological replicates. ns indicates a statistically nonsignificant difference (two-sample t-test). See Supplementary file 7 for the p-values.
Appendix 1—figure 1
xNorm histogram of various RNE mutants used in this study.
Chimeric RNE with various membrane-binding motifs without the CTD (A) or with the CTD (B). (C) Effect of growth media on MB% of the MTS motif, WT RNE, and RNE ΔCTD. (D) Effect of growth media on MB% of the LacY2 segment, RNE (1–564)-LacY2-CTD, and RNE (1–564)-LacY2. In all panels, experimental data (blue circles) is compared with MCMC-based fitting result (red). Red shaded regions indicate the expected xNorm histogram based on parameter values within the standard deviation. The MB% shown at the bottom left of each plot is the best-fitting result. See Supplementary file 4 for xNorm histogram modeling results.
Appendix 1—figure 2
xNorm of protein constructs with MB% less than 99%.
The xNorm histograms of protein constructs were analyzed by separating molecules (all data) into fast (green) and slow (red) subpopulations. These subpopulations were defined based on the diffusion coefficient D: molecules with D values in the bottom MB% of the entire population (also below Dcutoff) were classified as slow, while the other molecules with D values above the Dcutoff were classified as fast. Protein constructs with uniform membrane or cytoplasmic localization, such as LacY and LacZ, respectively, showed similar xNorm histograms for both fast and slow populations (e.g., panels B, C, E, I, L, and M). See Supplementary file 6 for data statistics.
Tables
Appendix 3—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | SK1 | Bachmann, 1972 | E. coli MG1655 wild-type | |
| Genetic reagent (Escherichia coli) | SK47 | Sanamrad et al., 2014 | BW25993 rplA::rplA-mEos2 | |
| Genetic reagent (Escherichia coli) | SK52 | Jacobs-Wagner | CJW6557 | MG1655 ΔaraFGH araE::P13-araE |
| Genetic reagent (Escherichia coli) | SK72 | Strahl et al., 2015 | NCM3416 rne::rne-mCherry FRT-cat-FRT | |
| Genetic reagent (Escherichia coli) | SK98 | Kim et al., 2019 | MG1655 ΔlacYA | |
| Genetic reagent (Escherichia coli) | SK105 | Kim et al., 2019 | CJW6643 | MG1655 ΔlacIZYA |
| Genetic reagent (Escherichia coli) | SK107 | Thappeta et al., 2024 | CJW5685 | MG1655 rne::rne(ΔMTS)-mCherry |
| Genetic reagent (Escherichia coli) | SK186 | Jacobs-Wagner | JRH474 | MG1655 rne::rne(1-592)-yfp FRT-kan-FRT |
| Genetic reagent (Escherichia coli) | SK187 | Jacobs-Wagner | JRH475 | MG1655 rne::rne-mEos3.2 FRT-kan-FRT |
| Genetic reagent (Escherichia coli) | SK213 | Xiang et al., 2021 | CJW5158 | BW25113 hupA::hupA-mcherry FRT-kan-FRT |
| Genetic reagent (Escherichia coli) | SK249 | This study | MG1655 rne::rneΔMTS-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK290 | This study | MG1655 rne::rne-mEOS3.2 See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK292 | This study | MG1655 lacYA::lacY-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK304 | This study | MG1655 rne::rne-mEos3.2, ΔrhlB::FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK308 | This study | MG1655 rne::rne-mEos3.2, Δpnp::FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK360 | This study | MG1655 ΔaraFGH araE::P13-araE araBAD::rne-yfp-kan rne::rne-mcherry FRT-cat-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK364 | This study | MG1655 ΔaraFGH araE::P13-araE araBAD::rne-yfp rne::rne-mcherry See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK370 | Kim et al., 2024 | MG1655 Δ(lacYA) rne::rne(1-592)-yfp FRT-kan-FRT | |
| Genetic reagent (Escherichia coli) | SK373 | This study | MG1655 rne::rne(1-529)-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK374 | This study | MG1655 rne::rne(1-592)-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK384 | This study | MG1655 rne::rne(1-592)-yfp See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK394 | This study | MG1655 ΔlacYA ΔaraFGH araE::P13-araE araBAD::rne-yfp rne::rne-mcherry See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK404 | This study | MG1655 rne::rne(1-564)-lacY-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK405 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-lacY-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK407 | This study | MG1655 lacZYA::lacZ-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK411 | This study | MG1655 rne::rne-mEos3.2 pUC19-lacI-lacZonly (amp) See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK424 | This study | MG1655 lacYA::lacY(1-73)-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK425 | This study | MG1655 lacYA::lacY(1-192)-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK455 | This study | MG1655 ΔlacIZYA pUC19-lacI-plac-mEos3.2-MTS (amp) See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK466 | This study | MG1655 rne::rne(1-564)-lacY(1-73)-rneCTD-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK467 | This study | MG1655 rne::rne(1-564)-lacY(1-192)-rneCTD-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK482 | This study | MG1655 rne::rne-venus hupA::hupA-mcherry FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK486 | This study | MG1655 rne::rne(1-592)-venus hupA::hupA-mcherry FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK505 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-lacY(1-73)-rneCTD-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK506 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-lacY(1-192)-rneCTD-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK507 | This study | MG1655 rne::rne(1-564)-lacY(1-73)-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK508 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-lacY(1-73)-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK512 | This study | MG1655 rne::rne-mEos3.2 hupA::hupA-mcherry kan See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK592 | This study | MG1655 rne::rne(1-564)-lacY(1-192)-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK593 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-lacY(1-192)-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK594 | This study | MG1655 Δ(lacYA) rne::rne(1-592)-yfp See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK595 | This study | MG1655 Δ(lacYA) rne::rne-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK598 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-lacY-rneCTD-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK741 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-MTS(F574AF575A)- rneCTD -mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK742 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-MTS(F575E)-rneCTD-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK743 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-MTS(F582E)-rneCTD-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK748 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-MTS(F574AF575A)-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK749 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-MTS(F575E)-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Genetic reagent (Escherichia coli) | SK750 | This study | MG1655 Δ(lacYA) rne::rne(1-564)-MTS(F582E)-mEos3.2 FRT-kan-FRT See Supplementary file 2 | |
| Recombinant DNA reagent | pBAD18Kan (plasmid) | Guzman et al., 1995 | ||
| Recombinant DNA reagent | pET29b-H6_ Streptavidin _sfGFP (plasmid) | Addgene | Plasmid # 124296 | A gift from Mark Arbing (Addgene plasmid # 124296; http://n2t.net/addgene: 124296; RRID:Addgene_124296) |
| Recombinant DNA reagent | pKD13 (plasmid) | Datsenko and Wanner, 2000 | ||
| Recombinant DNA reagent | pUC19 (plasmid) | New England Biolabs | N3041S | |
| Recombinant DNA reagent | SJK1606 (plasmid) | This study | pBAD18kan-mEos3.2-MTS See Supplementary file 2 | |
| Recombinant DNA reagent | SJK1689 (plasmid) | This study | pUC19-lacI-lacY2-CTD-mEos3.2-Kan See Supplementary file 2 | |
| Recombinant DNA reagent | SJK1697 (plasmid) | This study | pUC19-lacI-lacY6-CTD-mEos3.2-frtKanfrt See Supplementary file 2 | |
| Recombinant DNA reagent | SJK1716 (plasmid) | This study | pUC19-lacI-lacY12-CTD-mEos3.2-frtKanfrt See Supplementary file 2 | |
| Recombinant DNA reagent | SK141 (plasmid) | Kim et al., 2019 | CJW6647 | pUC19-lacI-lacZonly |
| Recombinant DNA reagent | SK189 (plasmid) | Jacobs-Wagner | JRH515 | pBAD18 rne-yfp-kan |
| Recombinant DNA reagent | SK567 (plasmid) | This study | pET29b-H6_Streptavidin_mEos3.2 See Supplementary file 2 | |
| Other | Glass slides | Fisher | 12-544-1 | |
| Other | #1.5 coverslips | Fisher Or VWR | 12544A 16004-344 | |
| Chemical compound, drug | Agarose | Invitrogen | 16500-100 | |
| Chemical compound, drug | Glycerol | Invitrogen | 15514011 | |
| Chemical compound, drug | Casamino acids | Bacto | 223050 | |
| Chemical compound, drug | Thiamine | Research Products International | T21020 | |
| Chemical compound, drug | Rifampicin | Sigma-Aldrich | R3501 | 250MG |
| Chemical compound, drug | Chloramphenicol | Acros organics | 227920250 | |
| Chemical compound, drug | Isopropyl-β-thiogalactopyranoside (IPTG) | Thermo Fisher Scientific | C9H18O5S | |
| Chemical compound, drug | l(+)-Arabinose | Acros organics | 365180250 | |
| Software algorithm | Oufti | Paintdakhi et al., 2016 | https://oufti.org/ | |
| Software algorithm | u-track | Jaqaman et al., 2008 | https://github.com/DanuserLab/u-track | |
| Software algorithm | spotNorm | This study | https://github.com/sjkimlab/2025_RNaseE | |
| Software algorithm | NAMD 3.0 | Phillips et al., 2005 | https://www.ks.uiuc.edu/Research/namd/ | |
| Software algorithm | CHARMM-GUI | Jo et al., 2008 | https://www.charmm-gui.org/ | |
| Sequence-based reagent | lacZ530F | Kim et al., 2024 | PCR primers | TTTTACGCGCCGGAGAAAAC |
| Sequence-based reagent | lacZ530R | Kim et al., 2024 | PCR primers | AGTCGGTTTATGCAGCAACG |
| Sequence-based reagent | lacZ2732F | Kim et al., 2024 | PCR primers | TTACTGCCGCCTGTTTTGAC |
| Sequence-based reagent | lacZ2732R | Kim et al., 2024 | PCR primers | TGTAGCGGCTGATGTTGAAC |
| Sequence-based reagent | gapA274F | Kim et al., 2024 | PCR primers | GTTGTCGCTGAAGCAACTGG |
| Sequence-based reagent | gapA274R | Kim et al., 2024 | PCR primers | CGATGTCCTGGCCAGCATAT |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/105062/elife-105062-mdarchecklist1-v1.docx
-
Supplementary file 1
List of strains used in this study.
- https://cdn.elifesciences.org/articles/105062/elife-105062-supp1-v1.pdf
-
Supplementary file 2
Strain construction.
- https://cdn.elifesciences.org/articles/105062/elife-105062-supp2-v1.pdf
-
Supplementary file 3
Doubling times and cell sizes.
- https://cdn.elifesciences.org/articles/105062/elife-105062-supp3-v1.pdf
-
Supplementary file 4
xNorm histogram modeling results.
- https://cdn.elifesciences.org/articles/105062/elife-105062-supp4-v1.pdf
-
Supplementary file 5
qRT PCR primers used in study.
- https://cdn.elifesciences.org/articles/105062/elife-105062-supp5-v1.pdf
-
Supplementary file 6
Figure data statistics.
- https://cdn.elifesciences.org/articles/105062/elife-105062-supp6-v1.pdf
-
Supplementary file 7
P-values determined by two-tailed Student’s t-test.
- https://cdn.elifesciences.org/articles/105062/elife-105062-supp7-v1.pdf
-
Supplementary file 8
Diffusion coefficient (D) and 95% CI.
- https://cdn.elifesciences.org/articles/105062/elife-105062-supp8-v1.pdf
-
Source data 1
Metadata for microscopy data.
- https://cdn.elifesciences.org/articles/105062/elife-105062-data1-v1.zip
-
Source data 2
Protein localization data (xNorm, yNorm, and D).
- https://cdn.elifesciences.org/articles/105062/elife-105062-data2-v1.zip
-
Source data 3
Protein diffusion data (D of individual tracks).
- https://cdn.elifesciences.org/articles/105062/elife-105062-data3-v1.zip
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Roles of the membrane-binding motif and the C-terminal domain of RNase E in localization and diffusion in E. coli
eLife 14:RP105062.
https://doi.org/10.7554/eLife.105062.3
