Nup107 is a crucial regulator of torso-mediated metamorphic transition in Drosophila melanogaster

  1. Jyotsna Kawadkar  Is a corresponding author
  2. Pradyumna Ajit Joshi
  3. Ram Kumar Mishra  Is a corresponding author
  1. Department of Biological Sciences, Indian Institute of Science Education and Research (IISER) Bhopal, India
13 figures, 1 table and 2 additional files

Figures

Figure 1 with 2 supplements
Nup107 depletion impairs metamorphosis.

Analysis of Nup107 depletion and its impact on growth and development of organism. (A) Growth profile of third instar larvae from Actin5C-Gal4-driven control and Nup107 knockdowns (Nup107GD and Nup107KK RNA interference [RNAi] lines) at 96 hr AEL (after egg laying) and 120 hr AEL. (B) Quantitation of Nup107 knockdown efficiency. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. **p=<0.001 and ****p=<0.0001. (C) Immunodetection of Nup107 protein levels in third instar larval brain-complex lysates from control and Nup107 knockdown. (D) Quantification of Nup107 protein levels seen in (C). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ***p=<0.0002 and ****p=<0.0001. (E) Comparison of pupariation profiles of control and Nup107 knockdown organisms.

Figure 1—figure supplement 1
Nup107 staining in salivary glands.

(A-B) Custom-generated polyclonal anti-Nup107 antibody colocalizes with pan-FG-Nup antibody, mAb414 (A), and mRFP-tagged Nup107 (B) at the nuclear rim of the third instar salivary gland. DNA stained with DAPI. Scale bars, 20 µm.

Figure 1—figure supplement 1—source data 1

Original confocal images are presented for Figure 1—figure supplement 1.

The cells highlighted in the yellow box were included in the supplementary figure. The upper panel corresponds to mAb414 staining, while the lower panel corresponds to mRFP-Nup107.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig1-figsupp1-data1-v2.pdf
Figure 1—figure supplement 1—source data 2

Original files for confocal images are displayed in Figure 1—figure supplement 1.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig1-figsupp1-data2-v2.zip
Figure 1—figure supplement 2
Nup107 CRISPR mutant generation.

(A) Schematic representation of Nup107KO generation. (Ai) The genomic locus of nup107 on chromosome-II (2L). The filled black box corresponds to the nup107 ORF (2779 bp) with gRNA(s) positions indicated by red arrows. The first and second gRNAs were designed near start and stop codons, respectively, of the nup107 locus. (Aii) Blue and green arrows indicate two sets of primers located in the 5’-UTR and 3’-UTR regions used for screening of Nup107 mutant. (Aiii) The black discontinuous line represents the nup107 (2752 bp) deletion allele. (B) Confirmation of Nup107 deletion mutant (heterozygous) line assessed by the presence of an ~630 bp band amplified from isolated genomic DNA.

Figure 1—figure supplement 2—source data 1

The original DNA gel image corresponds to Figure 1—figure supplement 2B.

The first lane displays wild-type samples (+/+), while the second lane shows a heterozygous sample (+/-), which has one copy of Nup107 deleted. The third lane contains the DNA ladder.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig1-figsupp2-data1-v2.zip
Figure 1—figure supplement 2—source data 2

The raw original DNA gel image corresponds to Figure 1—figure supplement 2B.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig1-figsupp2-data2-v2.zip
Figure 2 with 2 supplements
Ubiquitous knockdown of Nup107 disrupts ecdysone signaling.

Assessment of ecdysone receptor-dependent signaling in salivary glands of third instar larvae. (A–B) Staining of third instar larval salivary glands from control (A) and ubiquitous Nup107 knockdown (B) with ecdysone receptor (EcR) (anti-EcR antibody, red) and Nup107 (anti-Nup107 antibody, green). DNA is stained with DAPI. Scale bars, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (C) Quantification of the nucleocytoplasmic ratio of EcR under control and Nup107 knockdown conditions. At least 45 nuclei were analyzed from seven to eight pairs of salivary glands. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001. (D–F) Analysis of ecdysone-inducible genes, EcR (D), Eip75A (E), and Eip74EF (F) expression, respectively, at the onset of metamorphosis (late third instar larvae stage). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. The error bars represent the SEM. ***p=<0.0004 and ****p=<0.0001.

Figure 2—source data 1

Original confocal images for Figure 2, showing the EcR localization in Nup107-depleted tissues.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig2-data1-v2.zip
Figure 2—source data 2

Original files for the confocal images presented in Figure 2.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig2-data2-v2.zip
Figure 2—source data 3

Numerical values of graphs are shown in Figure 2.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig2-data3-v2.xlsx
Figure 2—figure supplement 1
Compromised organ size due to ubiquitous depletion of Nup107: Actin5C-Gal4 was used as a ubiquitous driver.

(A-B) Third instar larval salivary gland (A), and brain complex (B) images of Control, Nup107KK RNAi and Nup107GD RNAi. DNA stained with DAPI. Scale bars are 200 µm and 100 µm in (A) and (B), respectively.

Figure 2—figure supplement 1—source data 1

Original confocal images are presented for Figure 1—figure supplement 1.

The upper panel corresponds to salivary gland images, while the lower panel corresponds to brain complex images.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig2-figsupp1-data1-v2.pdf
Figure 2—figure supplement 2
Ubiquitous knockdown of Nup107 using Nup107GD RNA interference (RNAi) disrupts ecdysone signaling.

(A–B) Staining of third instar larval salivary glands from control (A) and ubiquitous Nup107GD knockdown (B) with ecdysone receptor (EcR) (anti-EcR antibody, red) and Nup107 (anti-Nup107 antibody, green). DNA is stained with DAPI, and scale bars, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (C) Quantification of nucleocytoplasmic ratio of EcR under control and Nup107 knockdown conditions. At least 45 nuclei were analyzed from seven to eight pairs of salivary glands. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001. (D–F) Analysis of ecdysone-inducible genes, EcR (D), Eip75A (E), and Eip74EF (F) expression. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. The error bars represent the SEM. ***p=<0.0007 and ****p=<0.0001.

Figure 2—figure supplement 2—source data 1

Original images for Figure 2—figure supplement 2 are shown.

The cells highlighted in the yellow box were included in the supplementary figure.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig2-figsupp2-data1-v2.pdf
Figure 2—figure supplement 2—source data 2

Original files for the confocal images presented in Figure 2—figure supplement 2.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig2-figsupp2-data2-v2.zip
Figure 2—figure supplement 2—source data 3

Numerical values of graphs are shown in Figure 2—figure supplement 2.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig2-figsupp2-data3-v2.xlsx
Figure 3 with 3 supplements
Targeted knockdown of Nup107 in the prothoracic gland (PG) perturbs ecdysone signaling pathway.

Analyzing the impact of tissue-specific Nup107 depletion on ecdysone receptor (EcR) signaling in third instar larval salivary glands. (A–C) Detection and quantitation of nucleocytoplasmic distribution of EcR (anti-EcR antibody, red) and Nup107 (anti-Nup107 antibody, green) in control (A), salivary gland-specific Nup107 depletion (B), and prothoracic gland-specific Nup107 depletion (C) from third instar larval salivary gland nuclei. DNA is stained with DAPI. Scale bars, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (D) EcR nucleocytoplasmic quantification ratio from the salivary gland and prothoracic gland-specific Nup107 knockdown, respectively. At least 45 nuclei were analyzed from seven to eight pairs of salivary glands. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001, and ns is nonsignificant. (E–F) Quantitation of expression of Eip75A (E) and Eip74EF (F) ecdysone-inducible genes at the onset of metamorphosis (RNA isolated from late third instar larvae of control and prothoracic gland-specific Nup107 depletion). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. **p=<0.008 and ****p=<0.0001.

Figure 3—source data 1

Original confocal images for Figure 3, showing the EcR localization in Nup107-depleted tissues.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig3-data1-v2.zip
Figure 3—source data 2

Original files for the confocal images presented in Figure 3.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig3-data2-v2.zip
Figure 3—source data 3

Numerical values of graphs are shown in Figure 3.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig3-data3-v2.xlsx
Figure 3—figure supplement 1
Nup107GD RNA interference (RNAi)-mediated Nup107 depletion regulates ecdysone receptor (EcR)-dependent signaling.

(A–C) Detection and quantitation of nucleocytoplasmic distribution of EcR (anti-EcR antibody, red) and Nup107 (anti-Nup107 antibody, green) in control (A), salivary gland-specific Nup107GD depletion (B), and prothoracic gland-specific Nup107GD depletion (C) from third instar larval salivary gland nuclei. DNA is stained with DAPI. Scale bars, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (D) EcR nucleocytoplasmic quantification ratio from salivary gland and prothoracic gland-specific Nup107 knockdown. At least 45 nuclei were analyzed from seven to eight pairs of salivary glands. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001, and ns is nonsignificant. (E–F) Quantitation of expression of Eip75A (E) and Eip74EF (F) ecdysone-inducible genes at the onset of metamorphosis (RNA isolated from late third instar larval stage). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001.

Figure 3—figure supplement 1—source data 1

Original images for Figure 3—figure supplement 1 are shown.

The cells highlighted in the yellow box were included in the supplementary figure.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig3-figsupp1-data1-v2.pdf
Figure 3—figure supplement 1—source data 2

Original files for the confocal images presented in Figure 3—figure supplement 1.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig3-figsupp1-data2-v2.zip
Figure 3—figure supplement 1—source data 3

Numerical values of graphs are shown in Figure 3—figure supplement 1.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig3-figsupp1-data3-v2.xlsx
Figure 3—figure supplement 2
Nup107 regulates metamorphosis via ecdysone synthesis.

(A) Growth profile of third instar larvae from AB1-Gal4-driven control and Nup107 knockdowns (Nup107KK and Nup107GD RNA interference [RNAi] lines) at 96 hr AEL (hours after egg laying) and 120 hr AEL. (B) Growth profile of third instar larvae from Phm-Gal4-driven control and Nup107 knockdowns (Nup107KK and Nup107GD RNAi lines) at 96 hr AEL and 120 hr AEL. (C) Comparison of pupariation profiles of control and Nup107 knockdown organisms.

Figure 3—figure supplement 2—source data 1

Original images corresponding to Figure 3 and Figure 3—figure supplement 2.

The upper panelc orresponds to AB1-Gal4, and the lower panel corresponds to Phm-Gal4.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig3-figsupp2-data1-v2.pdf
Figure 3—figure supplement 2—source data 2

Original files for Figure 3—figure supplement 2.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig3-figsupp2-data2-v2.zip
Figure 3—figure supplement 2—source data 3

Numerical values of graphs are shown in Figure 3—figure supplement 2.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig3-figsupp2-data3-v2.xlsx
Figure 3—figure supplement 3
Nup107 depletion compromises the prothoracic gland (PG) size.

(A–C) PG-specific driver Phm-Gal4-driven expression of GFP in the PGs of the third instar larva image of control (A), Nup107KK RNA interference (RNAi) (B), and Nup107GD RNAi (C). DNA stained with DAPI. Scale bars, 20 µm.

Figure 4 with 1 supplement
Nup107 critically regulates the expression of ecdysone-biosynthetic genes.

(A) Enzyme-linked immunosorbent assay (ELISA) measurements of whole-body 20-hydroxyecdysone (20E) levels in control, ubiquitous (Actin5C-Gal4), and prothoracic gland-specific (Phm-Gal4) Nup107 depletion at 96 and 120 hr after egg laying (AEL). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. *p=<0.032, **p=<0.0078, and ns is nonsignificant. (B) Schematic representation of a prothoracic gland cell showing genes involved in ecdysone biosynthesis from cholesterol. (C–G) Quantification of ecdysone-biosynthetic gene expression levels of spookier (C), phantom (D), disembodied (E), shadow (F), and shade (G) in cDNA isolated from control and Nup107 knockdown late third instar larvae. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. **p=<0.001, ***p=<0.0005, and ****p=<0.0001. Created with BioRender.com.

Figure 4—figure supplement 1
Nup107GD RNA interference (RNAi)-mediated depletion of Nup107 critically regulates the expression of ecdysone-biosynthetic genes.

(A) Enzyme-linked immunosorbent assay (ELISA) measurements of whole-body 20-hydroxyecdysone (20E) levels in control and prothoracic gland-specific (Phm-Gal4) Nup107GD depletion at 96 and 120 hr after egg laying (AEL). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. **p=<0.0025, and ‘ns’ is nonsignificant. (B–F) Quantification of ecdysone-biosynthetic gene expression levels of spookier (B), phantom (C), disembodied (D), shadow (E), and shade (F) in cDNA isolated from control and Nup107 knockdown late third instar larvae. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001, ***p=<0.0005, **p=<0.001, and *p=<0.03.

Figure 5 with 1 supplement
20-Hydroxyecdysone (20E) supplementation rescues Nup107 depletion-specific ecdysone receptor (EcR) signaling defects.

Immunofluorescence analysis of EcR localization in 20E supplemented and non-supplemented third instar larval salivary glands. (A–F) Visualization of the nucleocytoplasmic distribution of EcR (anti-EcR antibody, red) without 20E (A–C) and with 20E (D–F) treatment in larval salivary glands of control, ubiquitous (Actin5C-Gal4) Nup107 knockdown, and prothoracic gland-specific (Phm-Gal4) Nup107 knockdown. DNA is stained with DAPI. Scale bars, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (G–H) Comparative quantification of expression ecdysone-inducible genes Eip75A (G) and Eip74EF (H) from 20E-treated salivary glands. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. *p=<0.02, **p=<0.002, ***p=<0.0008, and ns is nonsignificant.

Figure 5—figure supplement 1
Ecdysone (20-hydroxyecdysone [20E]) supplementation rescues Nup107GD-dependent Nup107 depletion-specific ecdysone receptor (EcR) signaling defects.

(A–B) Visualization of the nucleocytoplasmic distribution of EcR (anti-EcR antibody, red) without 20E (A) and with 20E (B) treatment in larval salivary glands of control, ubiquitous (Actin5C-Gal4) Nup107GD knockdown, and prothoracic gland-specific (Phm-Gal4) Nup107GD knockdown. DNA is stained with DAPI. Scale bar, 20 μm. Charts represent the line scan intensity profile of EcR (red) and DAPI (cyan) in the salivary gland nucleus region.

Figure 5—figure supplement 1—source data 1

Original images for without 20-hydroxyecdysone (20E) (Figure 5—figure supplement 1A) and with 20E (Figure 5—figure supplement 1B) are shown.

The cells highlighted in the yellow box were included in the supplementary figure.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig5-figsupp1-data1-v2.zip
Figure 5—figure supplement 1—source data 2

Original files for Figure 5—figure supplement 1.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig5-figsupp1-data2-v2.zip
Figure 5—figure supplement 1—source data 3

Numerical values of graphs are shown in Figure 5—figure supplement 1.

https://cdn.elifesciences.org/articles/105165/elife-105165-fig5-figsupp1-data3-v2.xlsx
Figure 6 with 1 supplement
Torso and Nup107 act synergistically to activate the ecdysone signaling.

(A) A model of the Torso pathway and its components. (B) Quantitation of torso transcript levels from control and Nup107-depleted larvae (ubiquitous depletion using Actin5C-Gal4). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. ****p=<0.0001. (C–D) Comparison of pupariation profiles of control, Nup107 knockdown, and torso and rasV12 overexpressing rescue organisms. (E–G) Detection and quantitation of nucleocytoplasmic distribution of EcR (anti-EcR antibody, red) and Nup107 (anti-Nup107 antibody, green) in control, torso overexpressing ubiquitous Nup107 knockdown (Actin5C-Gal4>Nup107KK; UAS-torso) and torso overexpressing PG-specific Nup107 knockdown (Phm-Gal4>Nup107KK; UAS-torso) third instar larval salivary gland nuclei. DNA is stained with DAPI. Scale bars, 20 μm. Charts show the line scan intensity profiles of EcR (red) and DAPI (cyan) in the salivary gland nucleus region. (H–I) Quantification of expression of Eip75A (H) and Eip74EF (I) ecdysone-inducible genes, respectively. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. *p=<0.03, **p=<0.008, ****p=<0.0001, and ns is nonsignificant. Created with BioRender.com.

Figure 6—figure supplement 1
Torso rescues metamorphic defects of Nup107 knockdown.

(A) Growth profile of third instar larvae from different genotypes (control, Nup107KK, Nup107KK;UAS-torso, and Nup107KK;UAS-rasV12) at 96 hr AEL (after egg laying). (B–E) Quantification of ecdysone-biosynthetic gene expression levels of spookier (B), phantom (C), disembodied (D), and shadow (E) in cDNA isolated from control and Nup107-depleted torso overexpressing larvae (by using Actin5C-Gal4 and Phm-Gal4). Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. (*) represents p<0.03, and ‘ns’ is nonsignificant.

Theoretical model of Nup107 functions in metamorphosis.

During metamorphosis, the prothoracic gland (PG) responds to prothoracicotropic hormone (PTTH) via Torso receptors. The MAP kinase pathway involving Raf, MEK, and ERK, initiated by Ras, leads to Halloween gene expression responsible for ecdysone synthesis and release. Ecdysone is converted to active 20-hydroxyecdysone (20E) in peripheral tissues. The binding of 20E to the ecdysone receptor (EcR) allows EcR nuclear translocation and EcR pathway activation, culminating in target gene expression facilitating the metamorphic transition. Nup107 depletion negatively impacts Torso levels and Torso pathway activation, inducing pupariation arrest, which can be rescued by autonomous activation of the Torso pathway. Created with BioRender.com.

Author response image 1
Nup153 depletion does not affect the Drosophila metamorphosis.
Author response image 2
Nup107 depletion does not perturb overall NPC composition.

Comparison of salivary gland nucleus upon control and Nup107 knockdown. The Nup107 is shown in green and mAb414, staining for other FG-repeat containing nucleoporins is shown in red. Scale bars, 5µm.

Author response image 3
Nup107 levels are significantly reduced upon Nup107KK RNAi.

Quantification of Nup107 transcript levels from control and Nup107 depleted larvae [tissue specific depletion using AB1-Gal4 (A) and Phm-Gal4 (B)]. Data are represented from at least three independent experiments. Statistical significance was derived from the Student’s t-test. Error bars represent SEM. **p = <0.004

Author response image 4
Nup107 knockdown does not affect the PTTH level.

Quantitation of PTTH transcript levels from control and Nup107 depleted larvae (Prothoracic specific depletion Phm-Gal4). Data are represented from at least three independent experiments. Statistical significance was derived from the Student's t-test. ns is non-significant.

Author response image 5
Prothoracic gland’s specific torso expression rescues EcR nuclear translocation defects.

Immunofluorescence-based detection of nucleocytoplasmic distribution of EcR (EcR antibody, red) in control, prothoracic gland specific Nup107 knockdown (Phm-Gal4>Nup107KK) and torso overexpressing PG-specific Nup107 knockdown (Phm-Gal4>Nup107KK; UAS-torso) third instar larval Prothoracic gland nuclei. DNA is stained with DAPI. Scale bars, 20 μm.

Author response image 6
Nup107 regulates torso activation dependent p-ERK localization.

Detection of nucleocytoplasmic distribution of p-ERK (anti- p-ERK antibody, green) in the third instar larval prothoracic glands of control, PG-specific Nup107 knockdown (Phm-Gal4>Nup107KK) and PG-specific torso overexpression in Nup107 knockdown background (Phm-Gal4>Nup107KK; UAS-torso). DNA is stained with DAPI. Scale bars, 20 µm.

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Genetic reagent
(D. melanogaster)
w1118Bloomington Drosophila Stock CenterBDSC:3605; FLYB: FBst000360;
RRID:BDSC_3605
w[1,118]
Genetic reagent
(D. melanogaster)
w1118; P{GD12024}v22407Vienna Drosophila Resource
Center
VDRC: v22407; FLYB: FBst0454535;
RRID:FlyBase_ FBst0454535
P{GD12024}v22407
(Nup107GD RNAi)
Genetic reagent
(D. melanogaster)
P{KK108047}VIE-260BVDRC: v110759; FLYB: FBst0482324;
RRID:FlyBase_FBst0482324
P{KK108047}VIE-260B
(Nup107KK RNAi)
Genetic reagent
(D. melanogaster)
y[1] w[*]; P{w[+mW.hs]=GawB}AB1Bloomington Drosophila Stock CenterBDSC:1824; FLYB: FBti0001249;
RRID:BDSC_1824
AB1-Gal4
Genetic reagent
(D. melanogaster)
y[1] w[*]; P{w[+mC]=phtm-GAL4.O}22BDSC:80577; FLYB: FBti0201787;
RRID:BDSC_80577
Phm-Gal4
Genetic reagent
(D. melanogaster)
y[1] w[*]; P{Act5C-GAL4-w}E1/CyOBDSC:25374; FLYB: FBti0127834;
RRID:BDSC_25374
Actin5C-Gal4
Genetic reagent
(D. melanogaster)
w[*]; wg[Sp-1]/CyO; P{w[+mC]=mRFP-Nup107.K}7.1BDSC:35517; FLYB: FBti0130064;
RRID:BDSC_35517
mRFP-Nup107
Genetic reagent
(D. melanogaster)
y[1] M{w[+mC]=nanos-Cas9.P}ZH-2A w[*]Bloomington Drosophila Stock CenterBDSC:54591; FLYB: FBti0159183;
RRID:BDSC_54591
Nanos.Cas9
Genetic reagent
(D. melanogaster)
w[*]; TI{w[+mW.hs]=TI}trk[Delta]/CyO; P{w[+mC]=UASp-tor.G}5.7BDSC:92604; FLYB: FBti0216047;
RRID:BDSC_92604
UAS-torso
Genetic reagent
(D. melanogaster)
w[1118]; P{w[+mC]=UAS-Ras85D.V12}TL1BDSC:4847; FLYB: FBti0012505;
RRID:BDSC_4847
UAS-rasV12
Genetic reagent
(D. melanogaster)
Nup107KK;UAS-GFPGenerated in the RKM (corresponding authors)
laboratory and details are reported in the
Materials and methods under Fly
stocks and genetics section.
Genetic reagent
(D. melanogaster)
UAS-GFP;Nup107GD
Genetic reagent
(D. melanogaster)
UAS-GFP;Phm-Gal4/TM6.Tb
Genetic reagent
(D. melanogaster)
Nup107 gRNA line
Genetic reagent
(D. melanogaster)
Nup107KK;UAS-torso
Genetic reagent
(D. melanogaster)
Nup107KK;UAS-rasV12
AntibodyAnti-Nup107
(Rabbit polyclonal)
This studyWB (1:500), IF (1:100)
Generated in the RKM
(corresponding authors) laboratory
and details are reported in the Materials and methods under antibody generation and western blotting section.
AntibodyAnti-Nuclear Pore Complex Proteins
(Mouse monoclonal)
BioLegendCat#902902 (MAb414)IF (1:500)
AntibodyAnti-EcR (Mouse monoclonal)DSHBCat#DDA2.7IF (1:20)
AntibodyAnti-α tubulin
(Mouse monoclonal)
DSHBCat#12G10IB (1:5000)
AntibodyGoat anti-rabbit
Alexa Fluor Plus 680
Thermo Fisher
Scientific
Cat#A32734IB (1:40,000)
AntibodyGoat anti-mouse Alexa Fluor Plus 800Cat#A32730IB (1:40,000)
AntibodyGoat anti-rabbit Alexa Fluor 488Cat#A11034IF (1:800)
AntibodyGoat anti-rabbit
Alexa Fluor 568
Cat#A11036IF (1:800)
AntibodyGoat anti-mouse
Alexa Fluor 488
Cat#A11029IF (1:800)
AntibodyGoat anti-mouse Alexa Fluor 568Cat#A11004IF (1:800)
AntibodyGoat anti-rabbit Alexa Fluor 647Jackson
ImmunoResearch
Cat#111-605-045IF (1:800)
Sequence-based reagentNup107_gRNA1Generated in the RKM (corresponding authors) laboratory and details are reported in the material and methods under antibody generation and western blotting, Nested PCR, Quantitative RT-PCR, Transgenic fly generation sectionsPCR primers (5'–3'):TGGCCGACAGCCCGTTCCCG
Sequence-based reagentNup107_ gRNA2PCR primers (5'–3'):GGAGCTGCTCAACTCGAAACTGG
Sequence-based reagent5’UTR Primer1_FPCR primers (5'–3'):GCTCCCAAATACTCGCTGCC
Sequence-based reagent3’UTR Primer1_RPCR primers (5'–3'):CTTCTGCCGGCGGATTTGTT
Sequence-based reagent5’UTR Primer2_FPCR primers (5'–3'):GGTACCCCATACTAATGATTC
Sequence-based reagent3’UTR Primer2_RPCR primers (5'–3'):CATGTTGTTTGTCTCGCTACT
Sequence-based reagentNup107
(for antibody generation)
PCR primers (5'–3'):Forward: ATCGGATCCATGGCCGACAGCCCGTTC
Reverse: ATCGAATTCCTACCACGCCATCATACGATC
Sequence-based
reagent
Nup107_RTPCR primers (5'–3'):Forward: GCAGGCTCACCGATCGGAAG
Reverse: TCCATCTGCAGTAGGCGATG
Sequence-based
reagent
EcR_RTPCR primers (5'–3'):Forward: AAGAGGATCTCAGGCGTATAA
Reverse: GGCCTTTAGTAACGTGATCTG
Sequence-based
reagent
Eip75A_RTPCR primers (5'–3'):Forward: ACCACAGCACCACCCATTT
Reverse: TGTTTGGCGGTAGTTTCAGG
Sequence-based
reagent
Eip74EF_RTPCR primers (5'–3'):Forward: CTCTGCTCCACATAAAGACG
Reverse: CCGCTAAGCAGATTGTGG
Sequence-based
reagent
Phm_RTPCR primers (5'–3'):Forward: GGATTTCTTTCGGCGCGATGTG
Reverse: TGCCTCAGTATCGAAAAGCCGT
Sequence-based
reagent
Spok_RTPCR primers (5'–3'):Forward: TATCTCTTGGGCACACTCGCTG
Reverse: GCCGAGCTAAATTTCTCCGCTT
Sequence-based
reagent
Dib_RTPCR primers (5'–3'):Forward: TGCCCTCAATCCCTATCTGGTC
Reverse: ACAGGGTCTTCACACCCATCTC
Sequence-based
reagent
Sad_RTPCR primers (5'–3'):Forward: CCGCATTCAGCAGTCAGTGG
Reverse: ACCTGCCGTGTACAAGGAGAG
Sequence-based
reagent
Shd_RTPCR primers (5'–3'):Forward: CGGGCTACTCGCTTAATGCAG
Reverse: AGCAGCACCACCTCCATTTC
Sequence-based reagentTorso_RTPCR primers (5'–3'):Forward: CAGCTACTGCGACAAGGTCATCG
Reverse: CTCGGTTGCAGCTTGCAGTTG
Sequence-based reagentRpl49_RTPCR primers (5'–3'):Forward: CGTTTACTGCGGCGAGAT
Reverse: GTGTATTCCGACCACGTTACA
Commercial assay or kitRNA isolation kitFavorgen
Biotech
Cat#FATRK-001–2
Commercial assay or kitiScriptTM cDNA synthesis kitBio-RadCat#170–8891
Commercial assay or kit20-Hydroxyecdysone ELISA kitThermo Fisher ScientificCat#EIAHYD
Chemical compound, drugFluoroshieldSigma-AldrichCat#F6057
Chemical compound, drugTriton X-100Cat#X100-1L
Chemical compound, drugTween-20Cat#274348
Chemical compound, drugParaformaldehydeCat#158127
Chemical compound, drugiTaq Universal SYBR Green SupermixBio-RadCat#1725122
Chemical compound, drugG9 Taq Polymerase
10× buffer with MgCl2
GCC BiotechCat#G7115
Chemical compound, drugdNTPsSBS GENETECHCat#EN-2
Chemical compound, drug20-HydroxyecdysoneSigma-AldrichCat# H5142
Chemical compound, drugEDTASigma-AldrichCat#03690
Chemical compound, drugSDSHIMEDIACat#GRM886
Chemical compound, drugProteinase KMP BiomedicalsCat#193981
Chemical compound, drugTrisHIMEDIACat#MB029
Chemical compound, drugPotassium acetateHIMEDIACat#MB042
Chemical compound, drugIsopropanolMP BiomedicalsCat#194006
Chemical compound, drugEthanolMerckCat#100983
Chemical compound, drugSucroseANJ BiomedicalsCat#100314
Chemical compound, drugIPTGSigma-AldrichCat#I6758
Chemical compound, drugProtease inhibitor cocktail (PIC)RocheCat#04693132001
Chemical compound, drugNaClEmparta ACSCat#1.93206.0521
Chemical compound, drugEGTASigma-AldrichCat#E4378
Chemical compound, drugSodium deoxycholateCat# 30970
Chemical compound, drugSodium azideCat#438456
Chemical compound, drugN-Hydroxy-succinimidyl
(NHS) Sepharose
Sigma-AldrichCat#H8280
Chemical compound, drugUreaMP BiomedicalsCat#194857
Software, algorithmImageJ/FijiNational
Institutes of
Health, USA
http://imagej.nih.gov/ij/
Software, algorithmGraphPad Prism softwareGraphPadhttps://www.graphpad.com/
Software, algorithmAdobe Photoshop 2023Adobehttps://www.adobe.com/in/products/photoshop.html
Software, algorithmQuantStudio Design
& Analysis Software
Applied
Biosystems
https://www.thermofisher.com/in/en/home/products-and-services/promotions.html

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jyotsna Kawadkar
  2. Pradyumna Ajit Joshi
  3. Ram Kumar Mishra
(2026)
Nup107 is a crucial regulator of torso-mediated metamorphic transition in Drosophila melanogaster
eLife 14:RP105165.
https://doi.org/10.7554/eLife.105165.3