Spatial confinement induces oscillatory migration of epidermal keratinocytes and forms a three-compartment epithelial structure with epithelial–mesenchymal transition dynamics
- Department of Dermatology, Faculty of Medicine and Graduate School of Medicine, Hokkaido University, Japan
- Research Center of Mathematics for Social Creativity, Research Institute for Electronic Science, Hokkaido University, Japan
- Department of Physics, Graduate School of Science, Chiba University, Japan
- Department of Molecular Biology, Graduate School of Medicine, Hokkaido University, Japan
Figures
Figure 1 with 1 supplement
A three-compartment epithelial structure formed by a 3.0-µm-pored membrane.
(a) Schematic diagram of experiments using normal human epidermal keratinocytes cultured on a microporous membrane and exposed to air for 14 days to produce three-dimensional (3D) epidermis. (b) Hematoxylin and eosin (HE) staining and vimentin (Vim: brown) labeling of 3D tissue derived from each microporous membrane (Mem). Scale bar: 50 μm. (c) HE staining of 3D tissue formed by a 3.0-µm-pored membrane. Scale bar: 50 μm. (d) E-cadherin (E-cad)/N-cadherin (N-cad) (upper images), Slug (middle images), and Vim (lower images) staining of 3D tissue formed by a 0.4-µm- (left) or 3.0-µm-pored (right) membrane. Scale bar: 50 μm (low-magnified images) and 20 μm (high-magnified image). (e) Vim staining of 3D tissue formed by a 3.0-µm-pored membrane. Scale bar: 20 μm. (f) Quantitative RT-PCR (qRT-PCR) of CDH1 and CDH2. (g) qRT-PCR of FN1, VIM, SNAI1, and SNAI2. N=12 biological replicates per group. Data were analyzed using two-tailed Mann–Whitney U tests. *p<0.05; ***p<0.001; ****p<0.0001. (h) Schematic diagram of the three-compartment epithelial structure. Representative images from three or more replicates per group are shown.
Figure 1—figure supplement 1
Quantitative analysis of epithelial–mesenchymal transition (EMT) marker expression and laminin β3 distribution.
(a–d) Mean fluorescence intensity (AU) of E-cad (a), N-cad (b), Vim (c), and Slug (d) in the epithelium formed on the 0.4-µm-pored membrane and in the compartments above and below the 3.0-µm-pored membrane. N=3 biological replicates per group. Data were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. *p<0.05; **p<0.01; ***p<0.001; ns, not significant. (e) Laminin β3 staining of 3D tissue formed by a 0.4-µm- (left) or 3.0-µm-pored (right) membrane. Scale bar: 50 μm. Representative images from four replicates per group are shown.
Figure 2 with 5 supplements
Oscillatory movement of keratinocytes (KCs) on a 3.0-µm-pored membrane.
(a) Schematic diagram of LifeAct-KCs cultured on a microporous membrane. Observation at the level of cell exit from the micropores. (b) Time-lapse images of LifeAct-KCs at the level of cell exit from 3.0 µm micropores. Representative images are shown at 30 min time intervals. Time stamp shows hour:minute. Arrows indicate the cells that exit from the pores and expand under the membrane. Arrowheads indicate the cells that show oscillatory movement. Scale bar: 20 µm. (c) Schematic diagram of LifeAct-KCs cultured on a microporous membrane. Observation at the level of cell entry into the micropores. (d) Time-lapse images of LifeAct-KCs at the level of cell entry into 3.0 µm micropores. Representative images are shown at 5 min intervals. Time stamp shows hour:minute. Arrowheads indicate the cells that show oscillatory movement. Scale bar: 20 µm. (e, f) Time-lapse images and schematic diagrams of LifeAct-KCs at the level of cell entry into 3.0 µm (e) or 8.0 µm (f) micropores. Representative images are shown at 2 min intervals. Time stamp shows hour:minute. Scale bar: 10 µm. (g, h) Quantification of oscillatory movement of LifeAct-KCs on 3.0 µm or 8.0 µm micropores. (g) LifeAct signals (white) are shown as a spectrogram, where the X-axis represents each pore, and the Y-axis represents time. Data are summarized from three independent experiments. (h) Graphs comparing the number of pores presenting the LifeAct signals within 3.0 µm or 8.0 µm micropores per time. The left panel shows oscillation time as the X-axis and the number of pores as the Y-axis. The right panel shows unidirectional movement of the cells (no oscillation within 30 min) within each micropore. Data are summarized from three independent experiments. (i, j) E-cad and Vim labeling of LifeAct-KCs at the level of cells above (i) or within (j) 3.0 µm micropores. Autofluorescence of micropores is shown in blue (j). Scale bar: 10 µm. Representative images from three or more replicates per group are shown.
Figure 2—figure supplement 1
Characterization of HaCaT keratinocytes (KCs) and LifeAct-KCs.
(a) LifeAct-KCs kept on a dish. Scale bar: 20 µm. (b) Hematoxylin and eosin (HE) staining of parental HaCaT KCs cultured on a 1.0- or 3.0-µm-pored membrane for 14 days. Scale bar: 20 µm. (c) Ultrastructural findings of HaCaT KCs cultured on a 3.0-µm-pored membrane. Scale bar: 5.0 µm. (d) Ratio of mean fluorescence intensity (Vim/E-cad) in LifeAct-KCs located above the membrane or within the 3.0 µm micropores. For each micropore, fluorescence intensity was measured both above the membrane and within the pore, and the Vim/E-cad ratio was calculated. N=10 micropores from three independent experiments. Data were analyzed using a paired t-test. **p<0.01. Representative images from three or more replicates per group are shown.
Figure 2—video 1
A time-lapse movie of LifeAct-KCs that exited the 3.0-µm-pored membrane (related to Figure 2b).
Images are each separated by 5 min.
Figure 2—video 2
A time-lapse movie of LifeAct-KCs that entered the 3.0 µm micropores (related to Figure 2d).
Images are each separated by 5 min.
Figure 2—video 3
A time-lapse movie of LifeAct-KCs that entered the 3.0 µm micropores (high-magnified view; related to Figure 2e).
Images are each separated by 1 min.
Figure 2—video 4
A time-lapse movie of LifeAct-KCs that entered the 8.0 µm micropores (high-magnified view; related to Figure 2f).
Images are each separated by 1 min.
Figure 3 with 1 supplement
Chemical treatment on keratinocyte (KC) entry into and exit from 3.0 µm micropores.
(a–c) Quantification of LifeAct-KCs present within 3.0 µm micropores 6 hr after cell seeding. Cells were treated with TGF-β ligand (a), TGF-β receptor inhibitors, SB431542, and SB525334 (b), or cytochalasin D (c). (d–f) Quantification of LifeAct-KCs present below 3.0 µm micropores 24 hr after cell seeding. Cells were treated with TGF-β ligand (d), TGF-β receptor inhibitors (e), or cytochalasin D (f). Each dotted line represents an experimental batch, and the red line indicates the overall mean. N=7 biological replicates per group. Data were analyzed using a gamma generalized linear model with a log link function, adjusting for experimental batch as a categorical fixed effect. *p<0.05; ****p<0.0001; ns, not significant.
Figure 3—figure supplement 1
LifeAct-KCs treated with chemicals.
(a–c) Representative images of LifeAct-KCs present within 3.0 µm micropores 6 hr after cell seeding. Cells were treated with TGF-β ligand (a), TGF-β receptor inhibitors, SB431542, and SB525334 (b), or cytochalasin D (c). (d–f) Representative images of LifeAct-KCs present below 3.0 µm micropores 24 hr after cell seeding. Cells were treated with TGF-β ligand (d), TGF-β receptor inhibitors (e), or cytochalasin D (f). Representative images from three or more replicates per group are shown.
Figure 4 with 1 supplement
Regulatory role of Piezo1 and KRT6 on keratinocyte (KC) entry into and exit from 3.0 µm micropores.
(a, b) Quantification of ruthenium red-treated LifeAct-KCs present within 3.0 µm micropores at 6 hr (a) and the cells present below 3.0 µm micropores 24 hr after cell seeding (b). (c, d) Quantification of PIEZO1 KO LifeAct-KCs present within 3.0 µm micropores at 6 hr (c) and the cells present below 3.0 µm micropores 24 hr after cell seeding (d). (e, f) Quantification of Yoda1-treated LifeAct-KCs present within 3.0 µm micropores at 6 hr (e) and the cells present below 3.0 µm micropores 24 hr after cell seeding (f). Each dotted line represents an experimental batch, and the red line indicates the overall mean. N=7 (a, b) or 9 (c–f) biological replicates per group. Data were analyzed using a gamma generalized linear model with a log link function, adjusting for experimental batch as a categorical fixed effect. *p<0.05; ***p<0.001; ****p<0.0001; ns, not significant. (g) Schematic diagram of bulk RNA-seq comparing HaCaT KCs cultured on a 0.4-µm- or 3.0-µm-pored membrane. The magenta dashed rectangles indicate the cells compared in the bulk RNA-seq. (h) Heatmap of differentially expressed genes identified by the bulk RNA-seq. The full gene lists are provided in Figure 4—source data 1. (i) Gene ontology biological process terms enriched in upregulated and downregulated genes. (j) Heatmap of differentially expressed keratin genes in HaCaT KCs cultured on a 0.4-µm- or 3.0-µm-pored membrane. (k) Keratin 6 (KRT6) labeling of normal human epidermal KCs cultured on a 0.4-µm- or 3.0-µm-pored membrane for 14 days. Scale bar: 20 µm. Representative images from three replicates per group are shown. (l, m) Quantification of pan-KRT6 KO LifeAct-KCs present within 3.0 µm micropores at 6 hr (l) and the cells present below 3.0 µm micropores 24 hr after cell seeding (m). Each dotted line represents an experimental batch. N=9 biological replicates per group. The parental data are shared between panels c, d and l, m, because the parental, PIEZO1 KO, and pan-KRT6 KO cell lines were assayed in parallel in the same experiments. Data were analyzed using a gamma generalized linear model with a log link function, adjusting for experimental batch as a categorical fixed effect. ***p<0.001.
-
Figure 4—source data 1
Differentially expressed genes identified by bulk RNA-seq of HaCaT keratinocytes cultured on 0.4-µm- or 3.0-µm-pored membranes.
- https://cdn.elifesciences.org/articles/105192/elife-105192-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Genetic and pharmacological modulation of Piezo1 and keratin 6 in keratinocytes (KCs).
(a, b) Representative images of ruthenium red-treated LifeAct-KCs present within 3.0 µm micropores 6 hr after cell seeding (a) and below 3.0 µm micropores 24 hr after cell seeding (b). (c, d) Representative images of LifeAct-KCs treated with Yoda1 present within 3.0 µm micropores 6 hr after cell seeding (c) and below 3.0 µm micropores 24 hr after cell seeding (d). Scale bar: 30 µm. (e) Quantitative RT-PCR (qRT-PCR) analysis of PIEZO1 expression in parental (N=9) and PIEZO1 KO (N=7) KCs. Data were analyzed using two-tailed Mann–Whitney U tests. ***p<0.001. (f) Western blot analysis using parental and PIEZO1 KO KCs. Immunoblotted by anti-PIEZO1 antibody and anti-GAPDH antibody. (g) qRT-PCR analysis of pan-KRT6 expression in parental (N=9) and pan-KRT6 KO (N=7) KCs. Data were analyzed using two-tailed Mann–Whitney U tests. ***p<0.001. (h) Western blot analysis using parental and pan-KRT6 KO KCs. Immunoblotted by anti-KRT6 antibody and anti-GAPDH antibody. (i) Representative images of parental LifeAct-KCs, PIEZO1 KO KCs, and pan-KRT6 KO KCs present within 3.0 µm micropores 6 hr after cell seeding (upper images) and below 3.0 µm micropores 24 hr after cell seeding (lower images). Scale bar: 30 µm. Representative images from three or more replicates per group are shown.
-
Figure 4—figure supplement 1—source data 1
Original files for western blot analysis displayed in Figure 4—figure supplement 1f and h.
- https://cdn.elifesciences.org/articles/105192/elife-105192-fig4-figsupp1-data1-v1.zip
-
Figure 4—figure supplement 1—source data 2
PDF files containing original western blots for Figure 4—figure supplement 1f and h, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/105192/elife-105192-fig4-figsupp1-data2-v1.zip
Tables
Appendix 1—table 1
Primers used in quantitative RT-PCR (qRT-PCR).
| Gene | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| CDH1 | GCTGGACCGAGAGAGTTTCCCTACGTATAC | CTAACGTCGTAATCACCACACTGAAAGTGA |
| CDH2 | TCTGACAATGGAATTCCTCCTATGAGTGGA | CCTCAAGTGTTACCTCAAGAGGCAGAGACT |
| FN1 | GTGTCAGATACCAGTGCTAC | CAGACCTATCCAAGCTCAAG |
| VIM | CTTGACATTGAGATTGCCACCTACAGGAAG | GATGGACAGGTTATCAACGAAACTTCTCAG |
| SNAI1 | CGCTCTTTCCTCGTCAGG | TCTAATCCAGAGTTTACCTTCCA |
| SNAI2 | CTTCCTGGTCAAGAAGCATT | TGGACACACATACAGTGATTAT |
| GAPDH | GAAGGTGAAGGTCGGAGTC | GAAGATTGGTGATGGGATTTC |
| PIEZO1 | CAAATGCAGCCGAGAGACAG | CAGCGACATGAAGAGCAGTG |
| KRT6 | GGGTTTCAGTGCCAACTCAG | CCAGGCCATACAGACTGCGG |
| YWHAZ | ACTTTTGGTACATTGTGGCTTCAA | CCGCCAGGACAAACCAGTAT |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/105192/elife-105192-mdarchecklist1-v1.docx
-
Source data 1
Numerical source data for all graphs.
Values plotted in Figure 1f, g; Figure 2h; Figure 3a–f; Figure 4a–f, l, m; Figure 1—figure supplement 1a–d; Figure 2—figure supplement 1d; and Figure 4—figure supplement 1e, g. Each worksheet is named after the corresponding panel. For the chemical treatment and knockout experiments, the experimental batch and the biological replicate are indicated for each value, and each value is the mean of eight measurement points, as described in Methods.
- https://cdn.elifesciences.org/articles/105192/elife-105192-data1-v1.xlsx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Spatial confinement induces oscillatory migration of epidermal keratinocytes and forms a three-compartment epithelial structure with epithelial–mesenchymal transition dynamics
eLife 14:RP105192.
https://doi.org/10.7554/eLife.105192.4
