Figures and data in The Drosophila EGF domain protein uninflatable sets the switch between wrapping glia growth and axon wrapping instructed by Notch

Figures
Tables
Additional files

10 figures, 1 table and 4 additional files

Figures

Figure 1 with 1 supplement

Download asset Open asset

Heartless is required for wrapping glia development.

Confocal images of third instar larval filet preparations, stained for CD8::mCherry expression. The segmental nerves posterior to the ventral nerve cord are shown. Wrapping glial morphology is (A) not changed in control animals expressing (*nrv2-Gal4*) mock *GFP^dsRNA*. (B) Differentiation of wrapping glial cells is affected following expression of a dominant negative form of Htl and thin wrapping glial cells are detected (arrowhead). (C) Expression of a constitutively active form of Htl [*nrv2-Gal4; UAS- λhtl*] leads to nerve bulges around the wrapping glial nuclei (C, arrowhead). Scale bars 100 µm. The white dashed lines indicate the level of sections shown in Figure 2.

Figure 1—figure supplement 1

Download asset Open asset

Suppressor screen for genes downstream of activated *heartless*.

Exemplary images of living third instar larvae expressing *repo-stinger::GFP*. Analyzed genes were classified according to the changes in bulge size. 0=no change; 1, 2=slight changes in the bulge size. 3=strong suppression of the bulge size; 4=complete suppression of the bulging phenotype. For the list of genes screened, please see Supplementary file 1.

Figure 2

Download asset Open asset

Heartless controls growth of wrapping glia cells.

Electron microscopic images of segmental nerves from wandering third instar larvae. (A) Nerve of a control larva expressing GFP in wrapping glia sectioned 150 µm posterior to the ventral nerve cord. Normally differentiated wrapping glia can be seen. (**B–H**) Nerves of larvae expressing activated Heartless in wrapping glia [*nrv2-Gal4; UAS-λhtl*] sectioned at the positions indicated in Figure 1C. (B) Note the poorly differentiated wrapping glial cells distant from the nerve bulge. (**C,D**) At the beginning of the nerve bulge, excessive differentiation of wrapping glial cell processes starts to be detected that do not always grow around axons (magenta). (**E–G**) Higher magnifications of the boxed areas in (D). Note the formation of wrapping glial cell processes that do not contact axons (ax, magenta) but rather contact glial cell processes. (H) In the central area of the nerve bulge, liquid-filled vacuolar structures (asterisks) can be detected. Thin wrapping glial cell processes (arrows) span the bulged area.

Figure 3 with 1 supplement

Download asset Open asset

*uninflatable* affects differentiation of wrapping glia.

Confocal images of third instar larval filet preparations, stained for CD8::mCherry expression. The segmental nerves posterior to the ventral nerve cord are shown. (A) Filet preparation of a control third instar larva. (B) *uif* knockdown in wrapping glial cells [*nrv2-Gal4; UAS-uif^{dsRNA-HMS01822}*] impairs their development, which (C) cannot be rescued by co-expression of activated Htl. (**D–H**) Ubiquitous expression of (D) mock control *GFP^sgRNA*, (E) *uif^{sgRNA 2nd Exon}*, (F) *uif^{sgRNA CS}*, (G) *uif^{sgRNA TMD}*, or (H) *uif^{sgRNA CD}* in *Cas9*-expressing larvae. All *uif* sgRNAs disrupt wrapping glial cell development, and wrapping glia appear thin and fragmented (arrowheads). n=5 larvae for all genotypes. Scale bars 100 µm.

Figure 3—source data 1 Excel file giving the number of axons in the analyzed nerves to calculate the wrapping index.: https://cdn.elifesciences.org/articles/105759/elife-105759-fig3-data1-v1.xlsx
Download elife-105759-fig3-data1-v1.xlsx
Figure 3—source data 2 Excel file giving the number of axons in the analyzed nerves to calculate the wrapping index.: https://cdn.elifesciences.org/articles/105759/elife-105759-fig3-data2-v1.xlsx
Download elife-105759-fig3-data2-v1.xlsx

Figure 3—figure supplement 1

Download asset Open asset

Schematic representation of sgRNA target sites used for CRISPR-mediated *uif* knockout.

Target sites (black arrowhead) and predicted protein residues (Uif isoform B; present domains shown in color, absent domains shown in gray). Sequence of domains from N- to C-terminus: signal sequence (pink); one C-type lectin-like (CLECT) domain (turquoise), proposed to be a calcium-dependent carbohydrate binding module Cambi and Figdor, 2003; one low-density lipoprotein receptor protein class A (LDLa) domain (dark yellow), predicted to have a protein binding function May et al., 2007; three CUB domains (light yellow), a structural domain of unknown function; eight CCP domains (beige), predicted to be adhesion protein interaction domains; 18 EGF-like repeats (10 are Ca²⁺ binding; light/dark petrol), which are protein interaction domains involved in cell signaling Appella et al., 1988; two coagulation factor 5/8 C-terminal (FA58C) domains (light red), which are carbohydrate binding motifs Zhang and Ward, 2009; three hyaline repeat (HYR) domains (dark red), with a putative function in cell adhesion Carroll et al., 2008; five ephrin-like domains (orange) and one laminin G domain (light blue), also likely involved in cell adhesion and signaling Banerjee et al., 2011; proteolytic cleavage site (scissors) at amino acid 2991 Zhang and Ward, 2009; antibody binding site (AB) at amino acid 2882–3157 Zhang and Ward, 2009; additional exon isoform C indicated by red line; transmembrane domain (dark blue); intracellular C-terminus does not contain any conserved domains (Zhang and Ward, 2009).

Figure 4 with 1 supplement

Download asset Open asset

*uif* affects axonal ensheathment of wrapping glia.

(A+B, D–F) Electron microscopic cross sections of third instar larval abdominal peripheral nerves with wrapping glia-specific expression [*nrv2-Gal4; R90C03-Gal80*] of (A) *GFP^dsRNA* mock control transgene and (B) *uif^dsRNA*^-HMS01822. Upon knockdown of *uif,* wrapping glial cell complexity is reduced. (C) Single plane of a confocal image of a third instar larval nerve stained for CD8::mCherry expression. Expression of *uif::GFP* in wrapping glial cells causes bulge formation, while outside the bulge, wrapping glia appear thin (arrowheads). The dashed lines indicate the plane of section in relation to the bulge of the images shown in (**D, E**). (D) Upon *uif::GFP* overexpression specifically in wrapping glia, glial morphology is reduced outside the bulge region. (E) Within the nerve bulge, wrapping glial membrane increases in size while most axons lack proper wrapping. (F) Close-up of the region indicated in (E). *GFP^dsRNA* n=4 larvae, 4–7 nerves per specimen; *uif^dsRNA* n=3 larvae, 5–9 nerves per specimen; *uif::GFP* n=3 larvae, 5–6 nerves per specimen. Scale bars 2 µm unless indicated otherwise.

Figure 4—figure supplement 1

Download asset Open asset

Quantification of the wrapping index (WI).

WI quantified from electron microscopic cross sections of third instar larval abdominal peripheral nerves with (A) wrapping glia-specific (*nrv2-Gal4;R90C03-Gal80*) expression of mock control *GFP^dsRNA* (WI = 0.17), *uif* dsRNA^HMS01822, uif::GFP, Su(H)^dsRNA, and *mam^dsRNA* is plotted. Both *uif* knockdown (WI = 0.03) and overexpression (WI = 0.08) lead to a significant reduction of axonal wrapping (comparing the WI of control and *uif^dsRNA* larvae: p=2.88 × 10^–7; comparing the WI of control and *uif::GFP* larvae: p=2.56 × 10^–9). Similarly, knockdown of the Notch downstream components *Su(H*) and *mam* reduces the WI significantly (*mam^dsRNA*, WI = 0.07, p=4.29 × 10^–9; *Su(H)^dsRNA*, WI = 0.075, p=4.21 × 10^–11). (B) Neuronal knockdown (*nSyb-Gal4*) of *Contactin* leads to a significant reduction in the WI from 0.15 to 0.11 (for both RNAi lines p=0,006). For statistical analysis, a t-test was performed for normally distributed data (Shapiro test), and a Mann-Whitney U test was performed for not normally distributed data. *GFP^dsRNA* n=4 larvae with 4–7 nerves per specimen; *uif^dsRNA* n=3 larvae, 5–9 nerves per specimen; *uif::GFP* n=3 larvae, 5–6 nerves per specimen; *mam^dsRNA* n=3 larvae with 5–9 nerves per specimen; *Su(H)^dsRNA* n=4 larvae with 6–8 nerves per specimen; *Cont^dsRNA* (both) n=5 larvae with 10 nerves per specimen. **p≤0.01, ***p≤0.001.

Figure 5 with 1 supplement

Download asset Open asset

*Notch* is required for wrapping glial development.

Filet preparations of wandering third instar larvae stained for CD8::mCherry expression. The segmental nerves just posterior to the ventral nerve cord are shown. (A) Control larvae expressing the mock control *GFP^dsRNA* in wrapping glial cells specifically [*nrv2-Gal4; R90C03-Gal80*]. Upon expression of dsRNA targeting *Notch* mRNAs (B) *N^GD144*, (C) *N^9G*. (D) Control larva expressing sgRNA directed against the GFP open reading frame in [*nrv2-Gal4; UAS-Cas9*]. (E) Conditional knockout of *Notch* leads to dramatically altered morphology of wrapping glial cells. (F) Control larva cultured at the same temperature regime as the *N^ts1* larva shown in (G). Wrapping glial cells appear smaller compared to the control. Scale bars 100 µm.

Figure 5—figure supplement 1

Download asset Open asset

Notch activation impairs wrapping glial development at higher temperatures.

Filet preparations of wandering third instar larvae stained for CD8::mCherry expression. (A) Nuclear *LacZ* as mock control for (B) overexpression of Notch intracellular domain in wrapping glia specifically (*nrv2-Gal4;R90C03-Gal80*). *N^ICD* overexpression does not affect wrapping glial morphology. n=5 larvae for all genotypes. Scale bars 100 µm.

Figure 6 with 1 supplement

Download asset Open asset

*Notch* function affects axonal wrapping.

Electron microscopic images of segmental nerves from wandering third instar larvae sectioned 100 µm posterior to the ventral nerve cord. (A) Control nerve of an animal expressing *dsRNA* directed against GFP [*nrv2-Gal4; R90C03-Gal80*]. Axons are wrapped by processes of the wrapping glia. The entire nerve is engulfed by the perineurial glia and the subperineurial glia. For quantification of glial wrapping, see (D). (B) Upon expression of *dsRNA* targeting *Notch mRNA* (*N^GD144*), glial wrapping is reduced. (C) Upon expression of an activated form of Notch (*N^intra*), glial wrapping is increased. (D) Quantification of wrapping index (WI). While *Notch* knockdown significantly decreases the WI (from 0.17 to 0.12, p=0.00079), activation of Notch signaling significantly increases glial wrapping and the WI (from 0.17 to 0.27, p=0.014). For statistical analysis, a t-test was performed for normally distributed data (Shapiro test), and Mann-Whitney U test was performed for not normally distributed data. *GFP^dsRNA* n=4 larvae with 4–7 nerves each; *N^dsRNA* n=5, larvae with 7–9 nerves each; *N^ICD* n=5 larvae with 3–8 nerves each. α=0.05, *p≤0.05, ***p≤0.001. Scale bars 2 µm.

Figure 6—source data 1 Excel file giving the number of axons in the analyzed nerves to calculate the wrapping index.: https://cdn.elifesciences.org/articles/105759/elife-105759-fig6-data1-v1.xlsx
Download elife-105759-fig6-data1-v1.xlsx

Figure 6—figure supplement 1

Download asset Open asset

The Notch activity reporter is active in differentiated glia.

Maximum intensity projection of a confocal image stack of third instar larval filet and adult brain preparations stained for anti-LacZ, representing Notch activity (green), glial nuclei (anti-Repo, magenta), and neuronal membranes (anti-HRP, blue). Bacterial *LacZ* gene under the control of three copies of palindromic *Grainyhead* (*Grh*) binding sites (*Gbe*), and *Su(H*) binding is active specifically in cells where Notch signaling is present. (**A, B**) Expression can be detected in neuroblasts of the brain lobes (asterisk and close-up) and the thoracic neuromeres (unfilled arrowhead). Additional Notch activity is detected in the imaginal discs (filled arrowheads); scale bar 200 µm. (**C–C’’**) No Notch activity is found in larval peripheral glial nuclei; scale bar 100 µm. (**D, E**) LacZ staining overlaps with Repo staining, indicating expression in adult glia (close-ups, filled arrowheads), which is also detectable in non-glial cells (close-ups, unfilled arrowheads). Not all Repo-positive cells show LacZ staining (close-ups, asterisk), indicating that Notch signaling is not active in all glia. Scale bar 100 µm. (**F–F’’’**) Single plane of Z-stack is shown. Some peripheral glial cells show LacZ staining (arrowheads); scale bar 100 µm. n=3 animals for both developmental stages.

Figure 7 with 3 supplements

Download asset Open asset

Knockdown of *mam*, *Su(H*), and *contactin* impairs axonal wrapping.

Electron microscopic cross sections of third instar larval abdominal peripheral nerves. Glial cell morphology is indicated in orange color. (**A–C**) Wrapping glia-specific [*nrv2-Gal4; R90C03-Gal80*] expression of *GFP*^dsRNA as mock control, (B) *Suppressor of Hairless* (*Su(H*)) dsRNA^HMS05748, or (C) *mastermind* (*mam*) dsRNA^KK110687. Note reduced complexity of glial cell processes. (D) Neuron-specific [*nSyb-Gal4*] expression of *LacZ^dsRNA* as mock control and (E) *Contactin* (*Cont*) dsRNA^GD12610 inserted on the third chromosome. Upon neuronal knockdown of *Cont*, glial wrapping of peripheral axons is impaired. Scale bars 2 µm.

Figure 7—figure supplement 1

Download asset Open asset

Knockdown of *mam* and *Su(H*) impairs wrapping glial development.

Filet preparations of wandering third instar larvae stained for CD8::mCherry expression. (A) Wrapping glia-specific (*nrv2-Gal4;R90C03-Gal80*) expression of *GFP*^dsRNA as mock control, (B) *mastermind* (*mam*) *dsRNA^KK110687*, or (C) *Suppressor of Hairless* (*Su(H*)) *dsRNA^HMS05748*. Note impaired wrapping glial morphology (B, C, arrowheads). n=5 larvae for all genotypes. Scale bars 100 µm.

Figure 7—figure supplement 2

Download asset Open asset

Neuronal knockdown of Notch ligands Dl and *Ser* does not affect wrapping glial morphology.

Filet preparations of wandering third instar larvae stained for (A) CD8::mCherry expression or (B) Repo (stains glial nuclei, green) and H2B-mRFP expression. A Trojan-Gal4 insertion in the *Delta* (Dl) locus [*Dl^{MI04868-TG4.1}*] drives expression of (A) *CD8::mCherry* targeting membranes or (B) *H2B::mRFP* targeting nuclei. Two Dl-expressing neurons are found in each hemineuromere and show no *repo* expression (B and B’, close-up). n=5 larvae for all genotypes. Scale bars 100 µm. (**C–E**) Filet preparations stained for *nrv2::GFP* expression. (C) Neuron-specific expression of mock control Cherry dsRNA (D) *Serrate* (*Ser*) dsRNA^GD14442 and (E) *Delta* (Dl) dsRNA^GD2642. Neither *Ser* nor Dl knockdown in neurons affects wrapping glial morphology. n=5 larvae for all genotypes. Scale bars 100 µm.

Figure 7—figure supplement 3

Download asset Open asset

Neuronal knockout of Notch ligands Dl and *Ser* does not affect wrapping glial morphology.

Filet preparations of wandering third instar larvae with the genotypes indicated were sectioned 150 µm distant from the tip of the ventral nerve cord. Electron microscopic images were analyzed for their wrapping index. Cas9-mediated neuronal knockout of neither Delta nor Serrate significantly affects the wrapping index.

Figure 8

Download asset Open asset

*Notch* counteracts *heartless* and *uninflatable* function.

Squeeze preparations of wandering third instar larvae. The segmental nerves posterior to the ventral nerve cord are shown. (**A–C**) Larvae expressing *uninflatable* and CD8::mCherry in the wrapping glia. The nerve bulge shown in the white dashed box is enlarged. (A) Control larvae co-expressing *LacZ*. Uif expression results in nerve bulges. (B) Upon co-expression of *Notch^dsRNA* (*GD144*), the nerve bulging phenotype is not suppressed. (C) Upon activation of Notch signaling by expression of N^ICD, the nerve bulging phenotype is suppressed. (**D–G**) Larvae expressing an activated Heartless receptor (*λhtl*) in the wrapping glia [*nrv2-Gal4*] carrying a *repo3.4-stinger::GFP* element leading to a panglial nuclear GFP expression. (D) Control larvae co-expressing *dsRNA* directed against *mCherry*. Note the prominent nerve bulges. (E) Upon co-expression of *Notch^dsRNA,* the nerve bulging phenotype is enhanced. (F) Likewise, the nerve bulging phenotype is enhanced in a *Notch^ts1* mutant background when the larvae are kept at the restrictive temperature. (G) Upon activation of Notch signaling by expression of N^ICD, the nerve bulging phenotype is significantly rescued. n=7 larvae for all genotypes. (A-C) Scale bars 100 µm, (D-G) Scale bars 75 µm.

Figure 8—source data 1 Excel file giving the number of axons in the analyzed nerves to calculate the wrapping index.: https://cdn.elifesciences.org/articles/105759/elife-105759-fig8-data1-v1.xlsx
Download elife-105759-fig8-data1-v1.xlsx

Figure 9

Download asset Open asset

Model.

The interplay of FGF-receptor, Uninflatable, and Notch signaling controls the switch between glial cell growth and glial cell differentiation, leading to extensive neuron-glia contact. For details, please see the text.

Author response image 1

Download asset Open asset

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background (Escherichia coli)	E. coli OneShot TOP10	Invitrogen	C404003	Chemically competent cells
Genetic reagent (D. melanogaster)	UAS-CD8::mCherry	Bloomington Drosophila Stock Center	RRID:BDSC_27391
Genetic reagent (D. melanogaster)	UAS-mCherry^dsRNA	Bloomington Drosophila Stock Center	RRID:BDSC_35785
Genetic reagent (D. melanogaster)	w¹¹¹⁸	Bloomington Drosophila Stock Center	RRID:BDSC_3605
Genetic reagent (D. melanogaster)	UAS-uif^{dsRNA HMS01822}	Bloomington Drosophila Stock Center	RRID:BDSC_38354
Genetic reagent (D. melanogaster)	nSyb-Gal4	Bloomington Drosophila Stock Center	RRID:BDSC_51635
Genetic reagent (D. melanogaster)	UAS-htl^DN	Bloomington Drosophila Stock Center	RRID:BDSC_5366
Genetic reagent (D. melanogaster)	UAS-Cas9	Bloomington Drosophila Stock Center	RRID:BDSC_58985
Genetic reagent (D. melanogaster)	UAS-Su(H)^{dsRNA HMS05748}	Bloomington Drosophila Stock Center	RRID:BDSC_67928
Genetic reagent (D. melanogaster)	nrv2-Gal4	Bloomington Drosophila Stock Center	RRID:BDSC_6800
Genetic reagent (D. melanogaster)	nrv2::GFP	Bloomington Drosophila Stock Center	RRID:BDSC_6828
Genetic reagent (D. melanogaster)	UAS-N^{dsRNA 9G}	Bloomington Drosophila Stock Center	RRID:BDSC_7077
Genetic reagent (D. melanogaster)	Dl^{MI04868-TG4.1}	Bloomington Drosophila Stock Center	RRID:BDSC_77753
Genetic reagent (D. melanogaster)	U6-Dl^sgRNA	Bloomington Drosophila Stock Center	RRID:BDSC_83095
Genetic reagent (D. melanogaster)	N^sgRNA	Bloomington Drosophila Stock Center	RRID:BDSC_84168
Genetic reagent (D. melanogaster)	U6-Ser^sgRNS	Bloomington Drosophila Stock Center	RRID:BDSC_84169
Genetic reagent (D. melanogaster)	UAS-GFP^dsRNA	Bloomington Drosophila Stock Center	RRID:BDSC_9331
Genetic reagent (D. melanogaster)	UAS-H2B-mRFP	Bloomington Drosophila Stock Center	RRID:BDSC_94270
Genetic reagent (D. melanogaster)	UAS-mam^{dsRNA KK110687}	Vienna Drosophila Resource Center	VDRC102091
Genetic reagent (D. melanogaster)	UAS-N^{dsRNA GD144}	Vienna Drosophila Resource Center	VDRC1112
Genetic reagent (D. melanogaster)	UAS-Ser^{dsRNA GD14442}	Vienna Drosophila Resource Center	VDRC27172
Genetic reagent (D. melanogaster)	UAS-Cont^{dsRNA GD12610}	Vienna Drosophila Resource Center	VDRC28294
Genetic reagent (D. melanogaster)	UAS-Dl^{dsRNA GD2642}	Vienna Drosophila Resource Center	VDRC37287
Genetic reagent (D. melanogaster)	UAS-Cont^{dsRNA GD12610}	Vienna Drosophila Resource Center	VDRC40613
Genetic reagent (D. melanogaster)	N^[ts]1	Shellenbarger and Mohler, 1975
Genetic reagent (D. melanogaster)	UAS-LacZ^NLS	Hummel et al., 2002
Genetic reagent (D. melanogaster)	UAS-λhtl	Michelson et al., 1998
Genetic reagent (D. melanogaster)	UAS-N^ICD	Klein, University of Düsseldorf
Genetic reagent (D. melanogaster)	UAS-uif::GFP	Gonzalez-Gaitan, Loubéry et al., 2014
Genetic reagent (D. melanogaster)	UAS-LacZ^dsRNA	Schirmeier, University of Dresden
Genetic reagent (D. melanogaster)	GFP^sgRNA	Schirmeier
Genetic reagent (D. melanogaster)	uif^{sgRNA 2nd Exon}	This work		See Figure 3—figure supplement 1
Genetic reagent (D. melanogaster)	uif^{sgRNA CS}	This work		See Figure 3—figure supplement 1
Genetic reagent (D. melanogaster)	uif^{sgRNA TMD}	This work		See Figure 3—figure supplement 1
Genetic reagent (D. melanogaster)	uif^{sgRNA CD}	This work		See Figure 3—figure supplement 1
Genetic reagent (D. melanogaster)	nrv2-Gal4;R90C03-Gal80,UAS-CD8::Cherry	Kottmeier et al., 2020
Genetic reagent (D. melanogaster)	Gbe +Su(H)-lacZ	Furriols and Bray, 2001
Genetic reagent (D. melanogaster)	repo4.3-stg-GFP	This work		Figure 1
Antibody	anti-dsRed 1:1000	Clontech Labs 3P	632496	IF(1:1000)
Antibody	anti-β-galactosidase (Mouse monoclonal)	Developmental Studies Hybridoma Bank	40-1a	IF(1:10)
Antibody	anti-Repo (Mouse monoclonal)	Developmental Studies Hybridoma Bank	8D12	IF(1:5)
Antibody	anti-HRP-DyLight 649 (Goat polyclonal)	Dianova	123-165-021	IF(1:500)
Antibody	anti-GFP (Rabbit polyclonal)	Invitrogen	A6455	IF(1:1000)
Antibody	anti-mouse 488 (Goat polyclonal)	Invitrogen	A10680	IF(1:1000)
Antibody	anti-mouse 568 (Goat polyclonal)	Invitrogen	A11031	IF(1:1000)
Antibody	anti-rabbit 488 (Goat polyclonal)	Invitrogen	A11008	IF(1:1000)
Antibody	anti-rabbit 568 (Goat polyclonal)	Invitrogen	A11011	F(1:1000)
Recombinant DNA reagent	pUAST-dU63gRNA vector carrying a ubiquitous U6:3 promoter	Schirmeier, University of Dresden
Sequence-based reagent	Uif2ndExon_gRNA2_fw	This work	sgRNA for uif cleavage 3’ to signal sequence	GTCGTTTCAATATCAAGCACTCGT
Sequence-based reagent	Uif2ndExon_gRNA2_rev	This work	sgRNA for uif cleavage 3’ to signal sequence	AAACACGAGTGCTTGATATTGAAA
Sequence-based reagent	UifCS_gRNA2_fw	This work	sgRNA for uif cleavage 5’ to cleavage site	GTCGTGTTCTGCGTACCTCGGTAG
Sequence-based reagent	UifCS_gRNA2_rev	This work	sgRNA for uif cleavage 5’ to cleavage site	AAATCTACCGAGGTACGCAGAACA
Sequence-based reagent	UifTMD_gRNA4_fw	This work	sgRNA for uif cleavage 5’ to transmembrane domain	GTCGCGCTGTGTGGGCTCCTTTAC
Sequence-based reagent	UifTMD_gRNA4_rev	This work	sgRNA for uif cleavage 5’ to transmembrane domain	AAACGTAAAGGAGCCCACACAGCG
Sequence-based reagent	UifCD_gRNA1_fw	This work	sgRNA for cleavage of uif cytoplasmic domain	GTCGCTACAATGAAACGTACATGA
Sequence-based reagent	UifCD_gRNA1_rev	This work	sgRNA for cleavage of uif cytoplasmic domain	AAACTCATGTACGTTTCATTGTAG
Software, algorithm	Fiji	Schindelin et al., 2012