Microenvironmental arginine restriction sensitizes pancreatic cancers to polyunsaturated fatty acids by suppression of lipid synthesis
- Ben May Department for Cancer Research, University of Chicago, United States
- Department of Metabolism and Nutritional Programming, Van Andel Institute, United States
- Department of Physiology and Biophysics, University of Illinois College of Medicine, United States
- Metabolomics Platform, Comprehensive Cancer Center, The University of Chicago, United States
Figures
Figure 1 with 3 supplements
TME nutrient stress impairs SREBP1 and fatty acid synthesis in PDAC.
(A) Diagram of workflow for the transcriptomic comparison of mPDAC cells grown in TIFM or RPMI. Three pairs of cell lines (mPDAC1, mPDAC2, and mPDAC3) derived into TIFM and RPMI were analyzed with a sample size of n = 3 for each cell line. (B) Plotted normalized enrichment scores of metabolic gene sets from the C2 mSigDB database set. SREBP-related gene sets are highlighted in red. (C) Gene set enrichment analysis (GSEA) of the Reactome regulation of cholesterol biosynthesis by SREBP/SREBF gene set in transcriptomic data of mPDAC cell lines cultured in TIFM or RPMI. (D) Row-scaled heatmap of leading edge genes from the GSEA analysis in (C). Z-scores calculated from trimmed mean of M values (TMM) gene counts for reactome regulation of cholesterol biosynthesis by SREBP/SREBF genes in mPDAC cells cultured in TIFM versus RPMI. (E) Diagram of workflow for the transcriptomic comparison of mPDAC3 cells grown in RPMI (n = 3) or as orthotopic allograft murine tumors (n = 6). mPDAC3 cells from each condition were isolated by fluorescence-activated cell sorting (FACS) and RNA was isolated for transcriptomic analysis by next generation sequencing. (F) GSEA of the Reactome regulation of cholesterol biosynthesis by SREBP/SREBF gene set using transcriptomic data of mPDAC3 cell lines cultured in RPMI or orthotopically implanted in C57BL/6 mice. (G) Row-scaled heatmap of leading edge genes from the GSEA analysis in (F). Z-scores calculated from trimmed mean of M values (TMM) gene counts for Reactome regulation of cholesterol biosynthesis by SREBP/SREBF genes in mPDAC3 cells cultured in RPMI or isolated from orthotopic tumors. (H) SREBP signatures for human PDAC tumors and PDAC cancer cell lines generated using publicly available transcriptomic data using MERAV. Each point indicates a tumor specimen or cell line. (I) Row normalized heatmap z-scores of human transcriptomic data of genes from the Reactome regulation of cholesterol biosynthesis by SREBP/SREBF gene set. Genes shown are significantly differentially expressed between patient samples and PDAC cell lines with p-value cutoff of p < 0.05. (J) TMM normalized counts from transcriptomic analysis of mPDAC3 cells grown in TIFM or in RPMI (n = 3). (K) Immunoblot analysis of full length and cleaved SREBP1 expression in mPDAC1 and mPDAC3 cell lines grown in TIFM or RPMI treated with 10 µM MG132. (L) Quantification of immunoblot signal of full length and proteolytically processed SREBP1 normalized to actin. (M) Quantification of immunoblot signal of proteolytically processed SREBP1 divided by immunoblot signal of full-length SREBP1. This analysis was based on triplicate analysis of each cell line in each condition. (N) Nuclear extraction of mPDAC1 cells cultured in TIFM or RPMI. Blot stained for SREBP1, with GAPDH as a control for cytosol and Histone H3 as a control for nuclear protein (left). Quantification of mature SREBP1 normalized to Histone H3 (right). (O) Levels of unlabeled (gray) and deuterium labeled (blue, dark gray) palmitate (16:0) in mPDAC cell lines grown in TIFM or RPMI. Labeled palmitate indicates de novo synthesized lipid (n = 3). (P) Fraction of synthesized palmitate to total palmitate in mPDAC1, 2, and 3 cells grown in TIFM or in RPMI (n = 3). Statistical significance was assessed using two-tailed Welch’s t-test in H, J, M, O, and P. Statistical significance was assessed using a paired t-test in L. Statistical significance was assessed using the weighted Kolmogorov–Smirnov statistic in C, F. Error bars indicate standard deviation.
-
Figure 1—source data 1
Table of significantly differentially expressed metabolism gene sets between mPDAC cells cultured in TIFM and RPMI as shown in Figure 1B.
Gene set names, enrichment scores, normalized enrichment scores, p-values, adjusted p-values, gene set sizes, and leading edges for each geneset are shown in this table.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Mass isotopomer distribution of palmitate analyzed by GC–MS from mPDAC cells after treatment with deuterated water as shown in Figure 1L.
Peak areas are reported in this table for palmitate methyl ester isotopomers M+0 through m+32.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig1-data2-v1.xlsx
-
Figure 1—source data 3
Full unedited immunoblots for immunoblots shown in Figure 1K, N.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig1-data3-v1.zip
-
Figure 1—source data 4
Tables of linear and log transformed levels of proteins from reverse-phase protein array (RPPA) analysis of mPDAC1–3-RPMI and mPDAC1–3-TIFM cultures.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig1-data4-v1.xlsx
Figure 1—figure supplement 1
Transcriptomic analysis reveals exogenous nutrient availability regulates expression of SREBP-regulated fatty acid synthesis genes.
(A) Complete list of significantly altered metabolism gene sets in mPDAC cells grown in TIFM and in RPMI. (B) GATOM analysis of transcriptomic data from mPDAC cells cultured in TIFM or RPMI. (C) Heatmap of log2 transformed protein levels of SREBP1 regulated lipogenic genes in mPDAC1–3-RPMI and mPDAC1–3-TIFM cells from reverse-phase protein array (RPPA) analysis. (D) Proportion human PDAC and normal pancreas specimens from the Human Protein Atlas (Uhlén et al., 2015) classified with low, mid, high, or non-detectable (ND) expression of SREBP1 target gene expression. Significance was tested in D using Fisher’s exact test.
-
Figure 1—figure supplement 1—source data 1
Mass isotopomer distribution of palmitate analyzed by GC–MS from mPDAC cells after treatment with deuterated water as shown in Figure 1—figure supplement 1E.
Peak areas are reported in this table for palmitate methyl ester isotopomers M+0 through m+32.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig1-figsupp1-data1-v1.xlsx
Figure 1—figure supplement 2
Transcriptomic analysis reveals exogenous nutrient availability specifically regulates SREBP1.
(A, B) Read counts of fatty acid (SREBP1) or sterol (SREBP2) synthesis genes in TIFM and RPMI cultured mPDAC cells (two experiments plotted, n = 3 each, n = 6 total). Significance was determined using a two-tailed Welch’s t-test. Error bars indicate standard deviation.
Figure 1—figure supplement 3
TME nutrients downregulated SREBP1 and fatty acid synthesis in human PDAC.
(A) Immunoblot analysis of full length and cleaved SREBP1 expression in Aspc1 human cell lines grown in TIFM or RPMI. (B, C) Levels of unlabeled (gray) and deuterium labeled (blue, dark gray) palmitate (16:0) in human PDAC cell lines grown in TIFM or RPMI. Labeled palmitate indicates de novo synthesized lipid (n = 3). (D) The fraction of cellular palmitate (16:0) that is deuterium labeled indicated human PDAC cell lines in TIFM or RPMI (n = 3). Significance was determined using a two-tailed Welch’s t-test for B–D. Error bars indicate standard deviation.
-
Figure 1—figure supplement 3—source data 1
Unedited immunoblots with sample and band identification for immunoblots shown in Figure 1—figure supplement 3A.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig1-figsupp3-data1-v1.zip
-
Figure 1—figure supplement 3—source data 2
Full unedited immunoblots for immunoblots shown in Figure 1—figure supplement 3A.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig1-figsupp3-data2-v1.zip
-
Figure 1—figure supplement 3—source data 3
Unedited immunoblots with sample and band identification for immunoblots shown in Figure 1K, N.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig1-figsupp3-data3-v1.zip
Figure 2 with 3 supplements
TME arginine restriction limits SREBP1 expression and fatty acid synthesis in PDAC cells and tumors.
(A) Immunoblot analysis of full length and cleaved SREBP1 expression in mPDAC1 cells grown in TIFM, RPMI, or TIFM with supplemented arginine (TIFM + arg; 1.19 mM) treated with 10 µM MG132. (B) The fraction of cellular palmitate (16:0) that is deuterium labeled in mPDAC1 cell lines grown in TIFM, RPMI, TIFM + arg or RPMI with TIFM (2.27 µM) levels of arginine (n = 3). (C) Immunoblot analysis of full length and mature SREBP1 in the same conditions as (B) and treated with 10 µM MG132 with quantification in (D). (E) Schematic for generation of orthotopic tumors in Lyz2-Cre and Arg1fl/fl host animals and analysis of tumor fatty acid synthesis and SREBP1 protein levels. (F) Concentrations of arginine in TIF and plasma isolated from animals bearing orthotopic mPDAC3-TIFM tumors. n = 6 for Lyz2-Cre+/+; Arg1fl/fl animals and n = 5 for Arg1fl/fl littermate controls. (G) (left) Representative immunofluorescent images of mPDAC3-TIFM tumors from Lyz2-Cre+/+; Arg1fl/fl (n = 9) and Arg1fl/fl mice (n = 9). Cancer cells are YFP labeled. (right) Quantification of mean SREBP1 intensity for YFP-positive cancer cells in Lyz2-Cre+/+; Arg1fl/fl animals and Arg1fl/fl littermate controls (n = 3249 cells for each genotype). (H) The fraction of cellular palmitate (16:0) that is deuterium labeled from mPDAC3 cells isolated from tumors from Lyz2-Cre+/+; Arg1fl/fl (n = 4) and Arg1fl/fl (n = 5) mice. (I) The fraction of plasma palmitate (16:0) that is deuterium labeled from Lyz2-Cre+/+; Arg1fl/fl (n = 6) and Arg1fl/fl (n = 7) mice. Significance was assessed using the Mann–Whitney U-test for H and I. Two-tailed Welch’s t-test correction was used to assess significance in B, F, and G. Error bars indicate standard deviation.
-
Figure 2—source data 1
Mass isotopomer distribution of palmitate analyzed by GC–MS from mPDAC cells after treatment with deuterated water as shown in Figure 2B.
Peak areas are reported in this table for palmitate methyl ester isotopomers M+0 through m+32.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig2-data1-v1.xlsx
-
Figure 2—source data 2
Mass isotopomer distribution of palmitate analyzed by GC–MS from mPDAC3 cells sorted from tumors from Lyz2-Cre+/+; Arg1fl/fl or Lyz2-Cre−/−; Arg1fl/fl mice as shown in Figure 2G.
Peak areas are reported in this table for palmitate methyl ester isotopomers M+0 through m+32.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig2-data2-v1.xlsx
-
Figure 2—source data 3
Mass isotopomer distribution of palmitate analyzed by GC–MS from plasma of Lyz2-Cre+/+; Arg1fl/fl or Lyz2-Cre−/−; Arg1fl/fl mice bearing mPDAC3 tumors as shown in Figure 2H.
Peak areas are reported in this table for palmitate methyl ester isotopomers M+0 through m+32.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig2-data3-v1.xlsx
-
Figure 2—source data 4
Unedited immunoblots with sample and band identification for immunoblots shown in Figure 2A, C.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig2-data4-v1.zip
-
Figure 2—source data 5
Full unedited immunoblots for immunoblots shown in Figure 2A, C.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig2-data5-v1.zip
Figure 2—figure supplement 1
Systematic analysis of TIFM content identifies arginine restriction in TIFM as a regulator of PDAC lipid metabolism.
(A) Concentrations of nutrients in TIFM or in RPMI. Each point represents an individual nutrient in RPMI and in TIFM. (B) Cell proliferation of mPDAC1 cell lines TIFM or RPMI with or without exogenous lipids (n = 3). (C) Diagram of nutrient swapping strategy in TIFM. Nutrient pools (e.g. amino acids) are swapped between TIFM and RPMI to determine the nutrients that drive cellular phenotypes such as growth without exogenous lipids. (D) Logical flow chart and (E) data from nutrient swap experiments to identify TIFM nutrients that affect the ability of mPDAC1 cells to grow in the absence of exogenous lipids. Briefly, chemicals unique to TIFM when added to RPMI did not prevent mPDAC1 cells from growing in lipid-depleted conditions, nor did removing these chemicals from TIFM improve mPDAC1 growth without lipids. This led us to conclude that alterations of levels of a shared nutrient between TIFM and RPMI were responsible for differences in lipid metabolism. We then observed that mPDAC1 cells grown in TIFM containing RPMI amino acid levels were able to grow without lipids, indicating that differences in amino acid availability altered lipid metabolism. We then found that supplementation of arginine in TIFM to RPMI levels alone was sufficient to improve mPDAC1 growth without lipids to levels nearly seen in RPMI (n = 3). Error bars indicate standard deviation.
Figure 2—figure supplement 2
SREBP1 activity is rescued by arginine supplementation.
(A) Immunoblot for SREBP1 in Aspc1 cells grown in TIFM or TIFM with supplemented arginine. (B) TMM normalized counts from data analyzing transcriptomic changes between cells grown in TIFM or TIFM with supplemented arginine (n = 3). (C–F) Fraction synthesized palmitate in mPDAC2, mPDAC3, Aspc1, and Panc1 cells grown in TIFM or TIFM with supplemented arginine (n = 3). Significance was determined using a two-tailed Welch’s t-test. Error bars indicate standard deviation.
-
Figure 2—figure supplement 2—source data 1
Unedited immunoblots with sample and band identification for immunoblots shown in Figure 2—figure supplement 2A.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig2-figsupp2-data1-v1.zip
-
Figure 2—figure supplement 2—source data 2
Full unedited immunoblots for immunoblots shown in Figure 2—figure supplement 2A.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig2-figsupp2-data2-v1.zip
Figure 2—figure supplement 3
SREBP1 immunofluorescent signal reflects the expression of SREBP1 in tissues.
(A) Murine kidney and muscle sections were stained with SREBP1 antibody as performed with murine PDAC samples in Figure 2. (B) Expression levels of SREBP1 mRNA in murine muscle versus kidney from Söllner et al., 2017. Error bars indicate standard deviation.
Figure 3 with 4 supplements
Arginine restriction prevents PDAC cells from maintaining lipid homeostasis when starved of exogenous lipids.
(A) PUFA/MUFA ratios of all cellular lipids and (B) major classes of lipid species in mPDAC1 cells cultured in TIFM, RPMI, or TIFM + arg. (C) Triglyceride (TG) levels in mPDAC1 cells cultured in TIFM, RPMI, or TIFM + arg. Plotted data in (C) is row normalized z-scores of total-signal normalized peak areas (n = 3). (D) Immunoblot analysis of full-length and cleaved SREBP1 expression in mPDAC1 cells grown in TIFM or RPMI with and without starvation of exogenous lipid. (E) Transcriptomic analysis of expression of SREBP1 target genes involved in fatty acid synthesis in mPDAC1 cells cultured with exogenous lipids (+lipids) or without exogenous lipids (−lipids) in either TIFM or RPMI. Data plotted are log2 fold change of mRNA expression between cultures (n = 3). (F) Immunoblot analysis of mPDAC1 full-length and cleaved SREBP1 expression in mPDAC1 cells grown in TIFM, RPMI, or TIFM + arg with and without exogenous lipid. (G) Transcriptomic analysis of expression of SREBP1 target genes involved in fatty acid synthesis in mPDAC1 cells cultured with exogenous lipids (+lipids) or without exogenous lipids (−lipids) in either TIFM or TIFM + arg. Data plotted are log2 fold change of mRNA expression between cultures (n = 3). (H) Levels of unlabeled and deuterium-labeled palmitate (16:0) in mPDAC cell lines grown in TIFM or TIFM + arg (n = 3). (I) Principal component analysis of LC–MS measurements of lipid levels of mPDAC1 cells cultured in TIFM or TIFM + arg with or without exogenous lipids (n = 3). Volcano plots depicting the log2 fold change in levels of lipids in mPDAC1 cells upon starvation of exogenous lipids when cultured in TIFM (J) or TIFM + arg (K). Lipids containing only SFA/MUFA acyl groups are highlighted in red. Lipids containing both an SFA or MUFA and PUFA acyl group are highlighted in blue. Lipids containing only PUFA acyl chains are shown in black. The cutoff for statistical significance in this analysis is p < 0.01. (L) Quantification of the percent of an indicated lipid class that is altered upon lipid deprivation in (upper) TIFM or (lower) TIFM + arg cultured mPDAC1 cells. (TG: triglycerides; SM: sphingomyelin; PE: phosphatidylethanolamine; PC: phosphatidylcholine; LPE: lysophosphatidylethanolamine; LPC: lysophosphatidylcholine; Hex1Cer: hex-1-ceramides; DG: diacylglycerol; ChE: cholesterol esters; Cer: ceramides). (M) Number of lipid species with indicated composition of acyl groups whose cellular abundance is significantly altered upon lipid withdrawal in (left) TIFM or (right) TIFM + arg cultured mPDAC1 cells. (N) Cellular growth rate inhibition (GR) of mPDAC1, 2, and 3 cell lines grown in TIFM or TIFM + arg upon lipid deprivation. Each point is plotted average of technical triplicates of the assay for each cell line (n = 3). (O) Immunoblot analysis of SREBP1 expression in mPDAC1 cells transduced with control non-targeting or SREBP1 targeting sgRNAs. (P) GR of mPDAC1 cells analyzed in cultured in TIFM + arg with and without exogenous lipids (n = 3). Statistical significance was assessed in all panels by two-tailed Welch’s t-tests. Error bars indicate standard deviation.
-
Figure 3—source data 1
Mass isotopomer distribution of palmitate analyzed by GC–MS from mPDAC cells after treatment with deuterated water as shown in Figure 3H.
Peak areas are reported in this table for palmitate methyl ester isotopomers M+0 through m+32.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig3-data1-v1.xlsx
-
Figure 3—source data 2
Unedited immunoblots with sample and band identification for immunoblots shown in Figure 3D, F, O.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig3-data2-v1.zip
-
Figure 3—source data 3
Full unedited immunoblots for immunoblots shown in Figure 3D, F, O.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig3-data3-v1.zip
Figure 3—figure supplement 1
TIFM-cultured PDAC cells have more lipid droplets than PDAC cells in standard culture.
(A) Immunofluorescent analysis of YFP-expressing mPDAC3 stained with LipidTox to label lipid droplets. (B) Quantification of lipid droplets per cell area from (A). Significance was assessed in B using a two-tailed Welch’s t-test. Error bars indicate standard deviation.
Figure 3—figure supplement 2
SREBP1 activation is impaired in TIFM-cultured PDAC cells.
Immunoblot analysis of full-length and cleaved SREBP1 expression in (A) mPDAC2 and (B) mPDAC3 cells grown in TIFM or RPMI with and without exogenous lipids. (C) Fold change in expression of ELOVL6 mRNA, an SREBP1 target, in mPDAC1-TIFM and mPDAC1-RPMI cells after deprivation of exogenous lipids (n = 3). Error bars indicate standard deviation.
-
Figure 3—figure supplement 2—source data 1
Unedited immunoblots with sample and band identification for immunoblots shown in Figure 3—figure supplement 2A, B.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig3-figsupp2-data1-v1.zip
-
Figure 3—figure supplement 2—source data 2
Full unedited immunoblots for immunoblots shown in Figure 3—figure supplement 2A, B.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig3-figsupp2-data2-v1.zip
Figure 3—figure supplement 3
PDAC cells in RPMI can maintain lipid homeostasis upon starvation of exogenous lipids.
(A) Volcano plots depicting the log2 fold change in levels of lipids in mPDAC1 cells upon starvation of exogenous lipids when cultured in RPMI. Lipids containing only SFA/MUFA acyl groups are highlighted in red. Lipids containing both an SFA or MUFA and PUFA acyl group are highlighted in blue. Lipids containing only PUFA acyl chains are shown in black. The cutoff for statistical significance in this analysis is p < 0.01. (B) Quantification of the percent of an indicated lipid class that is altered upon lipid deprivation in RPMI cultured mPDAC1 cells. (C) Number of lipid species with indicated composition of acyl groups whose cellular abundance is significantly altered upon lipid withdrawal in RPMI cultured mPDAC1 cells. Error bars indicate standard deviation.
-
Figure 3—figure supplement 3—source data 1
Table of peak areas from LC–MS analysis of mPDAC1 cancer cell lipids cultured in TIFM, RPMI, or TIFM + arg, with or without exogenous arginine supplementation.
As shown in Figure 3C, I—M, Figure 3—figure supplement 3. NA indicates the metabolite not detected.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig3-figsupp3-data1-v1.xlsx
-
Figure 3—figure supplement 3—source data 2
Mass isotopomer distribution of palmitate analyzed by GC–MS from mPDAC cells after treatment with deuterated water as shown in Figure 3—figure supplement 3C–F.
Peak areas are reported in this table for palmitate methyl ester isotopomers M+0 through m+32.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig3-figsupp3-data2-v1.xlsx
Figure 3—figure supplement 4
TIFM-cultured cells are unable to overexpress mature SREBP1.
(A) Immunoblot analysis of cleaved SREBP1 expression in mPDAC1 cells cultured in TIFM or RPMI after transduction with cleaved SREBP1 cDNA.
-
Figure 3—figure supplement 4—source data 1
Unedited immunoblots with sample and band identification for immunoblots shown in Figure 3—figure supplement 4.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig3-figsupp4-data1-v1.zip
-
Figure 3—figure supplement 4—source data 2
Full unedited immunoblots for immunoblots shown in Figure 3—figure supplement 4.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig3-figsupp4-data2-v1.zip
Figure 4
Arginine restriction suppresses SREBP1 levels by activation of GCN2.
(A) Illustration of how GCN2 senses arginine and regulates SREBP1. (B) Immunoblot of ATF4 and GCN2 levels in mPDAC1-RPMI and mPDAC1-TIFM cells. (C) Immunoblot of ATF4 and GCN2 levels in mPDAC1-TIFM cells with or without CRISPR-mediated knockdown of GCN2. (D) GSEA NES scores of integrated stress response (ISR)-related gene sets using transcriptomic data of mPDAC1 cells grown in TIFM or TIFM with supplemented arginine. (E) Immunoblot of ATF4 levels in mPDAC1 cells grown in TIFM or TIFM with supplemented arginine. (F) Immunoblot of SREBP1 levels in mPDAC1-TIFM cultures with GCN2 knockdown and non-targeting control. (G) The fraction of cellular palmitate (16:0) that is deuterium labeled in mPDAC1-TIFM cultures with CRISPR-mediated knockdown of GCN2 or non-targeting controls (n = 3). (H) Growth rates of mPDAC1-TIFM cell lines with CRISPR-mediated knockdown of GCN2 or non-targeting controls in lipid depleted or lipid replete media (n = 3). (I,J) Immunohistochemical analysis of ATF4 and activated GCN2 (p-T899) expression in Rosa26-LSL-KrasG12D/+; TP53-+; Pdx-1-Cre murine tumors (n = 3) and adjacent acinar tissue from Rosa26-LSL-KrasG12D/+; Pdx-1-Cre (n = 2) or Rosa26-LSL-KrasG12D/+; TP53-/+; Pdx-1-Cre (n = 1). Significance assessed in all panels using two-tailed Welch’s t-test. Error bars indicate standard deviation.
-
Figure 4—source data 1
Unedited immunoblots with sample and band identification for immunoblots shown in Figure 4B, C, E, F.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig4-data1-v1.zip
-
Figure 4—source data 2
Full unedited immunoblots for immunoblots shown in Figure 4B, C, E, F.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig4-data2-v1.zip
-
Figure 4—source data 3
Mass isotopomer distribution of palmitate analyzed by GC–MS from mPDAC cells after treatment with deuterated water as shown in Figure 4G.
Peak areas are reported in this table for palmitate methyl ester isotopomers M+0 through m+32.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig4-data3-v1.xlsx
Figure 5 with 3 supplements
Arginine restriction sensitizes PDAC cells to exogenous PUFAs.
(A) Cellular peroxidation index of all cellular lipids and (B) major classes of lipid species in mPDAC1 cells cultured in TIFM, RPMI, or TIFM + arg (n = 3). (C) Cellular GR value of mPDAC1-TIFM or mPDAC1-RPMI cells upon treatment with various PUFAs (n = 3). EPA: eicosapentaenoic acid (250 µM); LNA: linolenic acid (250 µM); LLA: linoleic acid (250 µM); α-ESA: alpha-eleostearic acid (6.25 µM); DHA: docosahexaenoic acid (50 µM). (D) Cellular GR values of mPDAC1 cells cultured in TIFM or TIFM + arg treated with increasing doses of α-ESA with or without ferrostatin-1 (fer-1, 2 µM) (n = 3 per condition). (E) Cell viability of mPDAC1 cells treated with 3.125 µM α-ESA after 48 hr of growth (n = 3). (F) Cellular GR values of mPDAC1 cells cultured in TIFM + arg when transduced with control non-targeting or SREBP1 targeting sgRNAs and treated with α-ESA (6.25 µM) (n = 3). (G) GR values of mPDAC1 cells cultured in TIFM when treated 6.25 µM α-ESA at indicated concentrations with or without supplementation of oleate (MUFA) at 100 µM (n = 3). (H) Principal component analysis of LC–MS measurements of lipid levels of mPDAC1 cells cultured in TIFM or TIFM + arg with α-ESA (50 µM) or vehicle (fatty acid-free BSA) (n = 3). (I) Distribution of 18:3 fatty acyl groups in different complex lipid species. (J) Heatmap of TG and PE species with 18:3 acyl chains in mPDAC1 cells cultured as indicated upon treatment with α-ESA (50 µM). Plotted values are z-scores for each lipid species (n = 3). (K, L) Heatmaps of MUFA-containing PE and TG species in mPDAC1 cells cultured as indicated upon treatment with α-ESA (50 µM). Plotted values are z-scores for each lipid species (n = 3). (M, N) Analysis of the number of significantly altered lipid species containing MUFA or 18:3 acyl groups in mPDAC1 cells cultured as indicated upon treatment with α-ESA (50 µM). Significance cutoff p < 0.05. Calculated cellular phospholipid peroxidation index (CPI) for TGs (O) and PEs (P) in mPDAC1-TIFM and mPDAC1-TIFM + arg cells treated with α-ESA (50 µM) (n = 3). (Q) Cellular GR values of mPDAC1 cells cultured in TIFM treated with indicated α-ESA concentrations and with or without 2.5 µM DGAT1 inhibitor (PF-04620110) and 2.5 µM DGAT2 inhibitor (PF-06424439) (n = 3). Significance assessed in all panels using two-tailed Welch’s t-test. Error bars indicate standard deviation.
-
Figure 5—source data 1
Table of lipid peak areas from LC–MS analysis of mPDAC1 cancer cells cultured in TIFM, RPMI, or TIFM + arg with or without exposure to α-ESA as shown in Figure 5A, B, H—P, Figure 5—figure supplement 3.
NA indicates the metabolite was not detected.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Arginine starvation does not sensitize mPDAC cells to GPX4 or xCT inhibitors.
(A, C, E, G, I, K) GR values and (B, D, F, H, J, L) viability of mPDAC1, mPDAC2, and mPDAC3 cells cultured in TIFM or TIFM + arg upon treatment with RSL3 and erastin at indicated concentrations GPX4 or erastin. Ferrostatin-1 (fer-1, 2 µM) or vehicle (DMSO) was additionally added. Statistical significance was assessed in all panels by two-tailed Welch’s t-tests. Error bars indicate standard deviation.
Figure 5—figure supplement 2
Arginine starvation sensitizes murine and human PDAC cells to exogenous α-ESA.
GR values of (A) mPDAC2, (B) mPDAC3, and (C) Aspc1 cells cultured in TIFM or TIFM + arg with indicated concentrations of α-ESA. Ferrostatin-1 (fer-1, 2 µM) or vehicle (DMSO) was additionally added. (D) GR values of mPDAC1 cells grown in TIFM with supplemented arginine, with or without fatostatin treatment (2.5 µM) and α-ESA treatment (6.25 µM). Error bars indicate standard deviation.
Figure 5—figure supplement 3
α-ESA supplementation of RPMI-cultured PDAC cells has minimal effects on the cellular lipidome.
(A) Principal component analysis of LC–MS measurements of lipid levels of mPDAC1 cells cultured in RPMI with α-ESA (50 µM) or vehicle (fatty acid-free BSA) (n = 3). (B) Heatmap of TG and PE species with 18:3 acyl chains in mPDAC1 cells cultured as indicated upon treatment with α-ESA (50 µM). Plotted values are z-scores for each lipid species (n = 3). (C) Heatmaps of MUFA-containing PE and TG species in mPDAC1 cells cultured as indicated upon treatment with α-ESA (50 µM). Plotted values are z-scores for each lipid species (n = 3). (D) Analysis of the number of significantly altered lipid species containing MUFA or 18:3 acyl groups in mPDAC1 cells cultured as indicated upon treatment with α-ESA (50 µM). Significance cutoff p < 0.05.
Figure 6 with 1 supplement
Arginine deprivation sensitizes PDAC cells and tumors to PUFA enriched oils.
(A) Fatty acid content of tung and safflower oil measured by GC–MS fatty acid methyl ester (FAME) analysis (n = 3 technical replicates). (B) GR values of mPDAC1 cells cultured in TIFM and TIFM + arg cell lines when treated with BSA–tung oil or fatty acid-free BSA with or without ferrostatin-1 (fer-1, 2 µM) (n = 3). (C) Diagram of workflow for treatment of mPDAC3-bearing mice with tung or safflower oil orally. (D) Log2 fold change of FAMEs in plasma of mice treated with tung or safflower oil (n = 13 tung oil-treated mice, n = 12 safflower oil-treated mice). (E) Tumor weights of mice treated with tung or safflower oil (n = 11 safflower oil, n = 13 tung oil). (F) Spearman’s correlation analysis of plasma α-ESA levels and PDAC tumor weights of mice treated with tung oil (n = 13). (G) PUFA/MUFA ratios of PDAC tumors and other SREBP1-expressing (n = 5 tung oil treated mice, n = 5 safflower oil treated mice). (H) Diagram of treatment of mPDAC3-tumor-bearing Lyz2-Cre+/+; Arg1fl/fl and Lyz2-Cre−/−; Arg1fl/fl littermate control mice with tung or safflower oil. (I) mPDAC3 orthotopic tumor weights from Lyz2-Cre+/+; Arg1fl/fl and Lyz2-Cre−/−; Arg1fl/fl mice post tung or safflower oil treatment (Arg1fl/fl/Safflower n = 12; Arg1fl/fl/Tung n = 12; Lyz2-Cre+/+; Arg1fl/fl/Safflower n = 10; Lyz2-Cre+/+; Arg1fl/fl/Tung n = 15). (J) Cellular peroxidation index (CPI) for TGs in mPDAC3 cells sorted from tumor-bearing Lyz2-Cre+/+; Arg1fl/fl and Arg1fl/fl mice given tung or safflower oil (Arg1fl/fl/Safflower n = 5; Arg1fl/fl/Tung n = 6; Lyz2-Cre+/+; Arg1fl/fl/Safflower n = 7; Lyz2-Cre+/+; Arg1fl/fl/Tung n = 6). Statistical significance in E and I was assessed using the Mann–Whitney U-test. Statistical significance was assessed using a two-tailed Welch’s t-test correction in D, G, and J. Error bars indicate standard deviation.
-
Figure 6—source data 1
Table of peak areas of GC–MS fatty acid methyl ester (FAME) analysis of plasma of mice treated with tung oil or safflower oil as shown in Figure 6D.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig6-data1-v1.xlsx
-
Figure 6—source data 2
Table of peak areas of GC–MS fatty acid methyl ester (FAME) analysis of tumors and tissues of mice treated with tung oil or safflower oil as shown in Figure 6G.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig6-data2-v1.xlsx
-
Figure 6—source data 3
Table of peak areas from LC–MS analysis of mPDAC3 cells sorted from orthotopic tumors from Lyz2-Cre+/+; Arg1fl/fl or Lyz2-Cre−/−; Arg1fl/fl mice treated with tung or safflower oil as shown in Figure 6J.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig6-data3-v1.xlsx
Figure 6—figure supplement 1
PUFA-rich oils alter the lipidomic profile of mPDAC1-TIFM cells in an arginine-dependent manner.
(A) Principal component analysis of LC–MS measurements of lipid levels of mPDAC1 cells cultured in TIFM or TIFM + arg with BSA-tung oil (200 µg/ml) or vehicle (fatty acid-free BSA) (n = 3). (B) Distribution of 18:3 fatty acyl groups in different complex lipid species in BSA-tung oil (200 µg/ml) or vehicle (fatty acid-free BSA) treated mPDAC1 cells cultured in TIFM or TIFM + arg. (C) Heatmap of TG and PE species with 18:3 acyl chains in mPDAC1 cells cultured as indicated upon treatment with BSA-tung oil (200 µg/ml) or vehicle (fatty acid-free BSA). Plotted values are z-scores for each lipid species (n = 3). (D) Calculated cellular phospholipid peroxidation index (CPI) for TGs in TIFM and TIFM + arg cultured mPDAC1 cells treated with BSA-tung oil (200 µg/ml) or vehicle (fatty acid-free BSA) (n = 3). Significance assessed using two-tailed Welch’s t-test. Error bars indicate standard deviation.
-
Figure 6—figure supplement 1—source data 1
Table of lipid peak areas from LC–MS analysis of mPDAC1 cancer cells cultured in TIFM or TIFM + arg with or without exposure to tung oil–BSA conjugates as shown in Figure 6—figure supplement 1A–D.
NA indicates the metabolite was not detected.
- https://cdn.elifesciences.org/articles/106492/elife-106492-fig6-figsupp1-data1-v1.xlsx
Figure 7 with 1 supplement
PUFA treatment synergizes with other ferroptosis inducers in arginine-restricted PDAC cells.
GR value (left) and viability (right) of mPDAC1 cells cultured in RPMI or TIFM when treated with α-ESA (2 µM) of vehicle (fatty acid-free BSA) in tandem with (A) deprivation of cystine to fraction present in base media as indicated, (B) Erastin at indicated concentrations, or (C) RSL3 at indicated concentrations. Ferrostatin-1 (fer-1, 2 µM) or vehicle (DMSO) was additionally added. Statistical significance was assessed using a two-tailed Welch’s t-test correction in all panels. Error bars indicate standard deviation.
Figure 7—figure supplement 1
mPDAC1 cells are not sensitive to FSP1 inhibition.
(A) GR values of mPDAC1 cells treated with α-ESA (2 µM) of vehicle (fatty acid-free BSA) in tandem with viFSP1 at indicated concentrations. Ferrostatin-1 (fer-1, 2 µM) or vehicle (DMSO) was additionally added. Error bars indicate standard deviation.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Mus musculus) | Mouse PDAC | Derived in lab | mPDAC1 | KrasG12D; Trp53−/− |
| Cell line (Mus musculus) | Mouse PDAC | Derived in lab | mPDAC2 | KrasG12D; Trp53−/− |
| Cell line (Mus musculus) | Mouse PDAC | Derived in lab | mPDAC3 | KrasG12D; Trp53−/− |
| Cell line (Homo sapiens) | Human PDAC | ATCC | PANC-1 (CRL 1469) RRID:CV/CL_0480 | KRASG12D;TP53R273H;CDKN2A−/− |
| Cell line (Homo sapiens) | Human PDAC | ATCC | Aspc-1 (CRL-1682) RRID:CVCL_0152 | KRASG12D;SMAD4R100T;TP53C135A; MAP2K4−/− |
| Cell line (Homo sapiens) | Human Kidney | ATCC | 293T (CRL 3216) RRID:CVCL_0063 | Used for producing virus |
| Recombinant DNA reagent | pLV-EF1a-IRES-Blast | Addgene | #85133 RRID:Addgene_85133 | Overexpression plasmid |
| Recombinant DNA reagent | pcDNA3.1-2xFlag-SREBP1a | Addgene | #26801 RRID:Addgene_26801 | Plasmid with SREBP1 insert (AA1–460) |
| Recombinant DNA reagent | LenticrisprV2 | Addgene | #52961 RRID:Addgene_52961 | Plasmid for CRISPR knockdowns |
| Recombinant DNA reagent | Gcn2 sg1 (forward) | This lab | Knockout guide mouse GCN2 | ATTCTGGCAGAGCACGTCAG |
| Recombinant DNA reagent | Gcn2 sg1 (reverse) | This lab | Knockout guide mouse GCN2 | CTGACGTGCTCTGCCAGAAT |
| Recombinant DNA reagent | Gcn2 sg2 (forward) | This lab | Knockout guide mouse GCN2 | CGTAGGTGTAGTCTATAGCG |
| Recombinant DNA reagent | Gcn2 sg2 (reverse) | This lab | Knockout guide mouse GCN2 | CGCTATAGACTACACCTACG |
| Recombinant DNA reagent | Srebp1 sg1 (forward) | This lab | Knockout guide mouse SREBP1 | CAGGCTCGAGTAACCCAGCA |
| Recombinant DNA reagent | Srebp1 sg1 (reverse) | This lab | Knockout guide mouse SREBP1 | TGCTGGGTTACTCGAGCCTG |
| Recombinant DNA reagent | Srebp1 sg2 (forward) | This lab | Knockout guide mouse SREBP1 | AATGCCCCAGCCGAAAAGCG |
| Recombinant DNA reagent | Srebp1 sg2 (reverse) | This lab | Knockout guide mouse SREBP1 | CGCTTTTCGGCTGGGGCATT |
| Recombinant DNA reagent | Srebp1 sg3 (forward) | This lab | Knockout guide mouse SREBP1 | TCTGCCTACAGAATCACTGA |
| Recombinant DNA reagent | Srebp1 sg3 (reverse) | This lab | Knockout guide mouse SREBP1 | TCAGTGATTCTGTAGGCAGA |
| Recombinant DNA reagent | Incucyte Nuclight Red Lentivirus 2.0 (puro) | Sartorius | BA-04887 | |
| Commercial assay or kit | Incucyte Cytotox Dye for Counting Dead Cells | Sartorius | 4633 | |
| Chemical compound, drug | α-Eleostearic acid | Cayman Chemical | 10008349 | |
| Chemical compound, drug | Eicosapentaenoic acid | Cayman Chemical | 90110 | |
| Chemical compound, drug | Linoleic acid | Cayman Chemical | 90150 | |
| Chemical compound, drug | Linolenic acid | Cayman Chemical | 90210 | |
| Chemical compound, drug | Docosahexaenoic acid | Cayman Chemical | 90310 | |
| Chemical compound, drug | Ferrostatin-1 | Medchem Express | HY-100579 | |
| Chemical compound, drug | RSL3 | Cayman Chemical | 19288 | |
| Chemical compound, drug | Erastin | Cayman Chemical | 17754 | |
| Chemical compound, drug | viFSP1 | Cayman Chemical | 39927 | |
| Chemical compound, drug | PF-04620110 | Cayman Chemical | 16425 | |
| Chemical compound, drug | PF-04624439 | Cayman Chemical | 17680 | |
| Chemical compound, drug | Deuterium oxide | Cambridge isotopes | DLM-4-100 | |
| Antibody | Anti-SREBP1 (mouse monoclonal) | Santa Cruz Biotechnology | Sc-13551 RRID:AB_628282 | 1:100 dilution |
| Antibody | Anti-GCN2 (rabbit polyclonal) | Cell Signaling Technology | 3302S RRID:AB_2277617 | 1:1000 dilution |
| Antibody | Anti-beta Actin (mouse monoclonal) | Proteintech | 660009 RRID:AB_2687938 | 1:5000 dilution |
| Antibody | Anti-ATF4 (rabbit monoclonal) | Cell Signaling Technology | 11815 RRID:AB_2616025 | 1:50 dilution for IHC, 1:1000 dilution for immunoblotting |
| Antibody | Anti-p-GCN2T899 (rabbit polyclonal) | Biorbyt | Orb6078 RRID:AB_10931865 | 1:200 dilution |
| Commercial assay or kit | LipidTox neutral lipid stain | Invitrogen | H34477 | |
| Recombinant DNA reagent | ELOVL6 | Genecopeia | MQP037222 | ELOVL6 qPCR primer |
| Recombinant DNA reagent | Actin | Genecopeia | HQP016381 | Beta actin qPCR primer |
Additional files
-
Supplementary file 1
Table with complete formulation of Tumor Interstitial Fluid Medium (TIFM).
- https://cdn.elifesciences.org/articles/106492/elife-106492-supp1-v1.xlsx
-
Supplementary file 2
Table of sgRNA sequences used in this study.
- https://cdn.elifesciences.org/articles/106492/elife-106492-supp2-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/106492/elife-106492-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Microenvironmental arginine restriction sensitizes pancreatic cancers to polyunsaturated fatty acids by suppression of lipid synthesis
eLife 14:RP106492.
https://doi.org/10.7554/eLife.106492.3
