Lipid peroxidation and type I interferon coupling fuels pathogenic macrophage activation causing tuberculosis susceptibility
- The National Emerging Infectious Diseases Laboratory, Boston University, United States
- Systems Biology Ireland, School of Medicine, University College Dublin, Ireland
- Department of Medicine, Boston University Chobanian and Avedisian School of Medicine, United States
- Rutgers University, New Jersey Medical School, Center for Data Science, United States
- Department of Medicine, Division of Infectious Disease, New Jersey Medical School, Rutgers University, United States
- The Department of Pathology and Laboratory Medicine, Boston University Chobanian Avedisian School of Medicine, United States
- Department of Biochemistry, and Cell Biology and Genome Science Institute, Boston University Chobanian and Avedisian School of Medicine, United States
- Center for TB Research, Johns Hopkins School of Medicine, United States
- Conway Institute of Biomolecular and Biomedical Research, University College Dublin, Ireland
- Department of Pharmacology, Yale University School of Medicine, United States
- Altius Institute for Biomedical Sciences, United States
- Cellecta, Inc., United States
- Pulmonary Center, The Department of Medicine, Boston University Chobanian and Avedisian School of Medicine, United States
- Dept. of Microbiology, Boston University Chobanian and Avedisian School of Medicine, United States
Figures
Figure 1 with 1 supplement
Single-cell RNAseq analysis of the population dynamics of B6 and B6.
Sst1S macrophages after TNF stimulation. (A) Connectivity of antioxidant defense (AOD) with the Myc-, Nrf2-, JNK-, and IFN-I-regulated pathways: (1) stress kinase activation by oxidative stress; (2) promotion of IFN-I responses by stress kinases; (3) suppression of AOD by IFN-I; (4) inhibition of Nrf2, AOD, and IFN responses by Myc. (B and C) scRNA-seq analysis (UMAP and individual clusters) of B6 (R) and B6.Sst1S (S) BMDMs either naive (R and S) or after 24 hr of stimulation with TNF (RT and ST, respectively). (D) Expression of the sst1-encoded Sp110 and Sp140 genes in the population of either naïve (R) or TNF-stimulated (RT) B6 BMDMs. (E) Heatmap showing differentially expressed pathways in all cell clusters identified using scRNA-seq. Rows represent pathways and columns represent individual clusters with color intensity indicating the relative expression. (F) Reconstruction of the activation trajectories of TNF-stimulated resistant (RT) and susceptible (ST) macrophage populations using pseudotime analysis. Magenta line indicates B6 and green line indicates B6.Sst1S BMDMs. (G) Heatmap showing differentially expressed pathways in subpopulations 1–5 identified using pseudotime analysis. Rows represent pathways and columns represent individual subpopulations with color intensity indicating the relative expression. (H) Pathway heatmap representing transition from subpopulation 2 to unique subpopulation 3 in TNF-stimulated B6 macrophages. (I) The Sp110 and Sp140 gene regulatory network analysis. The mouse macrophage gene regulatory network was inferred using the GENIE3 algorithm from mouse macrophages gene expression data sets obtained from Gene Expression Omnibus (GEO). First neighbors of Sp110/Sp140 genes were selected to infer a subnetwork of Sp110/Sp140 co-regulated genes. Green nodes represent transcription factors, blue nodes denote their potential targets.
Figure 1—figure supplement 1
Single-cell RNAseq analysis of the B6 and B6.Sst1S macrophages after TNF stimulation.
(A) Relative proportions of either naïve (R and S) or TNF-stimulated (RT and ST) B6 or B6.Sst1S macrophages within individual single cell clusters depicted in Figure 1B. (B) The distribution of macrophages expressing the sst1-encoded Sp110 and Sp140 genes across the populations of naïve (R and S) and TNF-stimulated (RT and ST) B6 or B6.Sst1S macrophages. (C) Heatmap of the IFN-I pathway gene expression in subpopulations 1–5 identified using pseudotime trajectory analysis. (D) The expression of known sst1-dependent genes representing IFN-I, stress response, apoptosis, and immunosuppression in subpopulations 1–5.
Figure 2 with 1 supplement
Gene expression profiling comparing B6 and B6.Sst1.S BMDMs stimulated with TNF and regulation of NRF2.
(A) Total level of Nrf2 protein in B6 and B6.Sst1S BMDMs stimulated with TNF (10 ng/mL) for 8, 12, and 24 hr (western blotting). Average densitometric values from two independent experiments were included above the blot. (B) Cytoplasmic Nrf2 and Bach1 proteins in B6 and B6.Sst1S BMDMs stimulated with TNF (10 ng/mL) for 8 and 12 hr (western blotting). Average densitometric values from two independent experiments were included above the blot. (C) Nuclear Nrf2 and Bach1 protein levels in B6 and B6.Sst1S BMDMs treated with TNF (10 ng/mL) for 8 and 12 hr (western blotting). Average densitometric values from two independent experiments were included above the blot. (D and E) Confocal microscopy of Nrf2 protein in B6 and B6.Sst1S BMDMs stimulated with TNF (10 ng/mL) for 12 hr (scale bar 20 μm). The data shows staining with Nrf2-specific antibody and performed area quantification using ImageJ to calculate the Nrf2 total signal intensity per field. Each dot in the graph represents the average intensity of 3 fields in a representative experiment. The experiment was repeated three times. (F) B6 and B6.Sst1S BMDMs were stimulated with TNF (10 ng/mL) for 8 hr. The Nfe2l2 mRNA levels were quantified using quantitative RT-PCR. Fold induction was calculated by DDCt method, and b-actin was used as internal control and normalized the fold change using B6 UT. (G and H) The Nrf2 protein stability in TNF-stimulated (10 ng/mL) B6 and B6.Sst1S BMDMs. BMDMs were stimulated with TNF. After 6 hr, 25 μg/mL of cycloheximide (CHX) was added and cells were harvested after 15, 30, 45, 60, 90, and 120 min. The Nrf2 protein levels after TNF stimulation and degradation after cycloheximide addition were determined by western blotting. I - Linear regression curves of Nrf2 degradation after addition of CHX. Band intensities were measured by densitometry using ImageJ. No significant difference in the Nrf2 half-life was found: B6: 15.14±2.5 min and B6.Sst1S: 13.35±0.6 min. (I) Nuclear Nrf2 binding to target sequence. Nuclear extracts were prepared from BMDMs treated with TNF (10 ng/mL) for 8 and 12 hr. The binding activity of Nrf2 was monitored by EMSA using biotin-conjugated Nrf2-specific probe (hot probe, red frames). Competition with the unconjugated NRF2 probe (cold probe) was used as specificity control. (J) Anti-oxidant genes co-regulated with Sp110 and Sp140 after stimulation with TNF (10 ng/mL) for 12 hr. The heatmap was generated using FPKM values obtained from RNA-seq expression profiles of B6.Sst1S and B6 BMDMs after 12 hr of TNF stimulation. The data are presented as means ± standard deviation (SD) from three to five samples per experiment, representative of three independent experiments. The statistical significance was performed by two-way ANOVA using Tukey’s multiple comparison test (Panel E, F). Significant differences are indicated with asterisks (*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001).
-
Figure 2—source data 1
PDF file containing original western blots for Figure 2A, B, C and H and EMSA for Figure 2I indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig2-data1-v1.zip
-
Figure 2—source data 2
Original files for western blot analysis displayed in Figure 2A, B, C and H and EMSA for Figure 2I.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig2-data2-v1.zip
Figure 2—figure supplement 1
Antioxidant response of TNF-stimulated B6 and B6.Sst1.S BMDMs.
(A) Total levels of Nrf1, β-TrCP, and Keap1 proteins in B6 and B6.Sst1S BMDMs stimulated with TNF (10 ng/mL) for 8, 12, and 24 hr (western blotting). The experiment was repeated two times and shown the representative blot. (B) B6 and B6.Sst1S BMDMs stimulated with TNF (10 ng/mL) for 12 hr. Total NRF1 levels were evaluated using confocal microscopy. Scale bar = 20 μm. (C) B6 and B6.Sst1S BMDMs stimulated with TNF (10 ng/mL) for 12 hr. Nrf2 nuclear translocation was quantified using automated microscopy (Operetta CLS High Content Analysis System). Untreated samples were considered 100%. (D) The total antioxidant capacity of B6 and B6.Sst1S BMDMs was measured after TNF (10 ng/mL) stimulation. The percentage of induced antioxidant capacity upon TNF stimulation was plotted (Y axis). (E and F) B6 and B6.Sst1S BMDMs stimulated with TNF (10 ng/mL) for 8 and 12 hr. Hmox1 and Nqo1 expressions were quantified using qRT-PCR. (G) The heatmap of all genes related to response to oxidative stress (gene ontology category GO: 0006979). The heatmap was generated using FPKM values obtained using bulk RNAseq of B6.Sst1S and B6 BMDMs after 12 hr of TNF stimulation. For heatmap generation, FPKM values were scaled using Z-scores for each tested gene. The data are presented as means ± standard deviation (SD) from three to five samples per experiment, representative of three independent experiments. The statistical significance was performed by two-way ANOVA using Tukey’s multiple comparison test (Panels C-F). Significant differences are indicated with asterisks (*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001).
-
Figure 2—figure supplement 1—source data 1
PDF file containing original western blots for Figure 2—figure supplement 1A, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig2-figsupp1-data1-v1.zip
-
Figure 2—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 2—figure supplement 1A.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig2-figsupp1-data2-v1.zip
Figure 3 with 1 supplement
Regulation of iron and lipid peroxidation in B6 and B6.Sst1.S BMDMs.
(A and B) The expression of Fth and Ftl genes in B6 and B6.Sst1S BMDMs treated with 10 ng/mL TNF for 12 and 24 hr was determined using qRT-PCR. Fold induction was calculated normalizing with B6 untreated control using ΔΔCt method, and 18 S was used as internal control. (C) The Fth and Ftl protein levels in B6 and B6.Sst1S BMDMs treated with 10 ng/mL TNF for 0, 12, and 24 hr (Fth) and 0, 8, 12, and 24 hr (for Ftl; western blot). Average densitometric values from three independent experiments were included above the blot. (D) The Gpx1 and Gpx4 protein levels in B6 and B6.Sst1S BMDMs stimulated with TNF (10 ng/mL) for 0, 6, 12, and 24 hr (western blot). Average densitometric values from two independent experiments were included above the blot. (E) The labile iron pool (LIP) in TNF-stimulated B6 and B6.Sst1S BMDMs was treated with 10 ng/mL TNF for 24 hr. UT - untreated control. The LIP was determined using the Calcein AM method and represented as fold change as compared to B6 untreated. DFO was used as a negative control, and FeSO4 was used as a positive control. (F) The lipid peroxidation levels were determined by fluorometric method using C11-Bodipy 581/591. BMDMs from B6 and B6.Sst1S were treated with 10 ng/mL TNF for 30 hr. UT - untreated control. (G) Production of lipid peroxidation metabolite malondialdehyde (MDA) by B6 and B6.Sst1S BMDMs treated with 10 ng/mL TNF for 30 hr. UT - untreated control. (H) The accumulation of the intracellular lipid peroxidation product 4-HNE in B6 and B6.Sst1S BMDMs treated with 10 ng/mL TNF for 48 hr. The lipid peroxidation (ferroptosis) inhibitor, Fer-1 (10 μM), was added 2 hr post TNF stimulation in B6.Sst1S macrophages. The 4-HNE adducts accumulation was detected using 4-HNE-specific antibody and confocal microscopy. (I) Reactive oxygen species (ROS) levels were observed using the CellROX assay and quantified by automated microscopy in B6 and B6.Sst1S BMDMs either treated with TNF (10 ng/mL) or left untreated for 36 hr. BHA (100 μM) was used as a positive control. Data are presented as fold mean fluorescence intensity (MFI) normalized by B6 UT, representing ROS levels. (J) Time course of ROS accumulation in B6 and B6.Sst1S BMDMs during TNF-stimulated condition. Reactive oxygen species (ROS) levels were observed using the CellROX assay after 0, 6, 24, and 36 hr of TNF stimulation and quantified by automated microscopy. (K) Induction of c-Jun and ASK1 phosphorylation by TNF in B6 and B6.Sst1S BMDMs. The B6 and B6.Sst1S BMDMs were treated with TNF (10 ng/ml) or left untreated for 12, 24, and 36 hr and the c-Jun and ASK1 phosphorylation was determined by western blot. Average densitometric values from two independent experiments were included above the blot. (L) Cell death in B6 and B6.Sst1S BMDMs stimulated with 50 ng/mL TNF for 48 hr. Percent of dead cells was determined by automated microscopy using Live-or-DyeTM 594/614 Fixable Viability stain (Biotium) and Hoechst staining. (M) Inhibition of cell death of B6.Sst1S BMDMs stimulated with 50 ng/mL TNF for 48 hr using IFNAR1 blocking antibodies (5 μg/mL), isotype C antibodies (5 μg/mL), Butylated hydroxyanisole (BHA, 100 μM), or Fer-1 (10 μM). Percent cell death was measured as in L. The data are presented as means ± standard deviation (SD) from three to five samples per experiment, representative of three independent experiments. Statistical analysis was performed using two-way ANOVA followed by Šídák’s multiple comparison test (Panels A, B, F, G, and M) and Tukey’s multiple comparison test (Panels E, I, J, L). Statistical significance is indicated by asterisks: *p0.05, **p<0.01, ***p<0.001, ****p<0.0001.
-
Figure 3—source data 1
PDF file containing original western blots for Figure 3C, D and K, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig3-data1-v1.zip
-
Figure 3—source data 2
Original files for western blot analysis displayed in Figure 3C, D and K.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig3-data2-v1.zip
Figure 3—figure supplement 1
Regulation of TNF-induced ROS, labile iron pool, and lipid peroxidation in B6 and B6.Sst1.S BMDMs.
(A) B6 and B6 BMDMs were treated with 10 ng/mL TNF or left untreated for 48 hr. The cells were stained to observe 4-HNE adducts accumulation and cellular structure using anti-4-HNE and anti-tubulin Ab, respectively. The images were acquired using confocal microscopy. Scale bar = 20 μm. (B) The labile iron pool (LIP) in B6 and B6.Sst1.S BMDMs treated with 10 ng/mL TNF or left untreated for 48 hr. LIP was calculated using the Calcein AM method and represented as fold change. DFO was used as a negative control, and FeSO4 was used as a positive control. (C) Production of lipid peroxidation metabolite malondialdehyde (determined by MDA assay) by B6 and B6.Sst1S BMDMs treated with 10 ng/mL TNF for 48 hr. UT - untreated control. (D–F) The intracellular 4-HNE adducts accumulation in B6 and B6.Sst1.S BMDMs treated with 10 ng/mL TNF for 30 hr (D and E) and 48 hr (F) The 4-HNE adducts accumulation was quantified using ImageJ and plotted as a fold accumulation compared to B6 untreated group. Scale bar = 20 μm. (G) Reactive oxygen species (ROS) levels were observed using the CellROX assay and imaged by fluorescence microscopy in B6 and B6.Sst1S BMDMs either treated with TNF (10 ng/mL) or left untreated for 6, 24, and 36 hr. BHA (100 μM) was used as a positive control. Scale bar = 50 μm. (H) Cell death in B6 and B6.Sst1S BMDMs stimulated with 50 ng/mL TNF for 48 hr. Imaging was performed by automated microscopy using Live-or-DyeTM 594/614 Fixable Viability stain (Biotium) and Hoechst staining. Scale bar = 100 μm. The data represent the means ± SD of three samples per experiment, representative of three independent experiments. The statistical significance was performed by two-way ANOVA using Bonferroni’s multiple comparison test (Panels B, C, D, and F). Significant differences are indicated with asterisks (*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001).
Figure 4 with 2 supplements
Crosstalk of the IFN-I and AOD pathways.
(A) IFNAR1 blockade does not enhance Nrf2 upregulation in TNF-stimulated B6.Sst1S macrophages. B6 and B6.Sst1S BMDMs were treated with 10 ng/m TNF, with or without IFNAR1-blocking antibodies or isotype control (Isotype C Ab) at 5 μg/mL concentration for 4, 8, and 12 hr. Nrf2 protein levels were quantified by western blot. Average densitometric values from two separate experiments were included above the blot. (B) IFNAR1 blockade does not increase Ftl expression in TNF-stimulated B6.Sst1S macrophages. B6.Sst1S BMDMs were treated with 10 ng/mL TNF, with or without IFNAR1-blocking antibodies (5 μg/mL) or Isotype C Ab (5 μg/mL), for 8 and 12 hr. Ftl protein levels were quantified by western blot. Average densitometric values from two independent experiments were included above the blot. (C) IFNAR1 blockade does not increase mRNA levels of Fth, Ftl, and Gpx1. B6 and B6.Sst1S BMDMs were treated with 10 ng/mL TNF, with or without IFNAR1-blocking antibodies or Isotype C Ab, for 12 hr. Blocking antibodies (5 μg/mL) or isotype C antibodies (5 μg/mL) were added 2 hr after TNF stimulation. Fold induction was calculated using B6 untreated control as average one-fold by utilizing the ΔΔCt method with β-actin as the internal control. (D and E) IFNAR1 blockade reduces Rsad2 mRNA levels (E) but does not affect Ifnb1 mRNA levels (D) B6 and B6.Sst1S BMDMs were treated with 10 ng/mL TNF, with or without IFNAR1-blocking antibodies or Isotype C Ab for 16 hr. Blocking antibodies (5 μg/mL) or isotype C antibodies (5 μg/mL) were added 2 hr after TNF stimulation. Fold induction was calculated using B6 untreated control as average onefold by utilizing the ΔΔCt method with β-actin as the internal control. (F) Lipid peroxidation inhibition prevents the superinduction of Ifnb1 mRNA. B6.Sst1S BMDMs were treated with 10 ng/mL TNF, and the lipid peroxidation inhibitor (Fer-1) was added 2 hr post-TNF stimulation. Ifnb1 mRNA levels were measured using qRT-PCR after 16 hr of TNF treatment. Fold induction was calculated using untreated control as average onefold by utilizing the ΔΔCt method with 18 S as the internal control. (G) Lipid peroxidation inhibition reverses the superinduction of Ifnb1 mRNA. B6.Sst1S BMDMs were stimulated with 10 ng/mL TNF for 18 hr, then the LPO inhibitor (Fer-1) was added for the remaining 12 hr. Ifnb1 mRNA levels were measured using qRT-PCR. Fold induction was calculated using untreated control as average onefold by utilizing the ΔΔCt method with 18 S as the internal control. (H and I) IFNAR1 blockade reduces 4-HNE adduct accumulation in B6.Sst1S BMDMs treated with TNF (10 ng/mL) for 48 hr. Blocking antibodies (5 μg/mL) or Isotype C Ab (5 μg/mL) were added 2 hr post-TNF stimulation. The data are presented as means ± standard deviation (SD) from three to five samples per experiment, representative of three independent experiments. The statistical significance was performed by two-way ANOVA using Tukey’s multiple comparison test (Panels C-E), Ordinary one-way ANOVA using Bonferroni’s multiple comparison test (Panels F-G and I). Significant differences are indicated with asterisks (*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001).
-
Figure 4—source data 1
PDF file containing original western blots for Figure 4A and B, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig4-data1-v1.zip
-
Figure 4—source data 2
Original files for western blot analysis displayed in Figure 4A and B.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig4-data2-v1.zip
Figure 4—figure supplement 1
Regulation of lipid peroxide production and type I IFN expression in TNF-stimulated B6 and B6.Sst1.S BMDMs.
(A and B) B6 and B6.Sst1S BMDMs were either treated with 10 ng/mL TNF or left untreated for 6 hr. The LPO production was observed using Click-iT linoleamide alkyne (LAA) method and imaged using confocal microscopy (A) The quantification of signal per field was performed using ImageJ (B) Scale bar = 5 μm. (C). Inhibition of lipid peroxidation prevented the superinduction of Rsad2mRNA. B6.Sst1S BMDMs were stimulated with 10 ng/mL TNF for 2 hr, then the LPO inhibitor (Fer-1) or iron chelator DFO was added for the remaining 14 hr. Fold induction was calculated using untreated control as average onefold by utilizing the ΔΔCt method with 18 S as the internal control. (D) Inhibition of TNF and lipid peroxidation reversed the Rsad2mRNA superinduction after prolonged TNF stimulation. B6.Sst1S BMDMs were stimulated with 10 ng/mL TNF for 18 hr, then the LPO inhibitor (Fer-1) was added for the remaining 12 hr. Fold induction was calculated using untreated control as average onefold by utilizing the ΔΔCt method with 18 S as the internal control. (E) Experimental design for panels F – G. (F and G) Inhibition of the 4-HNE adducts accumulation in TNF-stimulated B6.Sst1.S BMDMs by IFNAR1 blocking antibodies. Cells were treated with 10 ng/mL TNF for 48 hr in the presence of IFNAR1 blocking antibodies. 4-HNE adducts were detected using specific antibody staining and confocal microscopy. The isotype C Ab was added 12 hr post TNF, and anti-IFNAR Ab was added at 12, 24, and 33 hr post TNF stimulation. The 4-HNE adduct accumulation was quantified using ImageJ and plotted as fold accumulation compared to the untreated group. Isotype C Ab - isotype matched negative control antibodies. Scale bar = 20 μm. The data are presented as means ± standard deviation (SD) from three to five samples per experiment, representative of three independent experiments. The statistical significance was performed by Ordinary one-way ANOVA using Bonferroni’s multiple comparison test (B–D) and two-way ANOVA using Tukey’s multiple comparison test (Panel E). Significant differences are indicated with asterisks (*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001).
Figure 4—figure supplement 2
The transient upregulation of transposon mRNAs in B6 macrophages after TNF treatment is affected in the B6.Sst1S.
(A) Line graphs displaying the expression of two mouse LTR transposons, mVL30 and RLTR4i activated in expression by TNF treatment in WT macrophages with the levels less stimulated in the B6.Sst1S. (B) A LINE transposon L1Md expression pattern compared to the distinct expression dynamics of Setdb1 after TNF stimulation between B6 and B6.Sst1S macrophages. Setdb1 protein is implicated as the histone methyltransferase marking H3K9me3 on these two transposons. (C) Reads coverage plots show extensive transcript representation and positive strand bias for LTR transposons, but double-stranded RNA expression from the LINE transposon. (D) Size distribution plots with functional annotations indicate the vast majority of macrophage small RNAs are mainly microRNAs, with little detection of viral and transposon small RNAs that would be indicative of these small interfering RNAs being processed by putative longer double-stranded RNA precursors.
Figure 5 with 1 supplement
Myc dysregulation drives the aberrant state of macrophage activation.
(A) The lack of Myc mRNA downregulation after prolonged TNF stimulation in B6.Sst1S macrophages. BMDMs from B6 and B6.Sst1S were treated with 10 ng/mL TNF for 6, 12, and 24 hr. Expression of Myc was quantified by the ΔΔCt method using qRT-PCR and expressed as a fold induction compared to the untreated B6 BMDMs. β-actin was used as the internal control. (B) Myc protein levels expressed by B6 and B6.Sst1S BMDMs during the course of stimulation with TNF(10 ng/mL) for 6 and 12 hr. (western blot). Average densitometric values from two independent experiments were included above the blot. (C) Myc inhibition restored the levels of Fth and Ftl proteins in TNF-stimulated B6.Sst1S macrophages to the B6 levels. B6 and B6.Sst1S BMDMs were treated with 10 ng/mL TNF alone or in combination with Myc inhibitor, 10058-F4 (10 μM) for 24 hr. 10058-F4 was added 2 hr post TNF stimulation. Protein levels of Fth and Ftl were observed using western blot. Average densitometric values from two independent experiments were included above the blot. (D) Myc inhibition decreased the labile iron pool in TNF-stimulated B6.Sst1S macrophages. B6.Sst1S BMDMs were treated with 10 ng/mL TNF or left untreated for 48 hr. The 10058-F4 inhibitor was added 2 hr post TNF stimulation. The labile iron pool (LIP) was measured using the Calcein AM method and represented as fold change as compared to untreated control. DFO was used as a negative control, and FeSO4 was used as a positive control. (E and F) Myc inhibition reduced lipid peroxidation in TNF-stimulated B6.Sst1S BMDMs. Cells were treated with 10 ng/mL TNF in the presence or absence of 10058-F4 for 48 hr. The inhibitor was added 2 hr post TNF stimulation. The MDA production was measured using commercial MDA assay (E) The lipid peroxidation was measured by fluorometric method using C11-Bodipy 581/591 (F). (G) B6.Sst1S BMDMs were treated as above in E. The accumulation of lipid peroxidation product, 4-HNE after 48 hr was detected by confocal microscopy using 4-HNE-specific antibody. The 4-HNE adducts accumulation was quantified using ImageJ and plotted as fold accumulation compared to untreated group. (H) The BMDMs from B6.Sst1S were treated with 10 ng/mL TNF alone or in combination with Myc inhibitor, 10058-F4 (10 μM) for 24 hr. 10058-F4 was added 2 hr post TNF stimulation. Expression of Ifnb1, Rsad2, Trib3, and Chac1 was quantified by the ΔΔCt method using qRT-PCR and expressed as a fold induction compared to the untreated group. 18 S was used as the internal control. (I and J) B6 (I) and B6.Sst1S (J) BMDMs were treated with TNF (10 ng/ml) for 6, 12, and 24 hr in the presence or absence of JNK inhibitor D-JNK1 (2 μM). The cells were harvested and the protein levels of c-Myc and p-cJun were determined by western blotting. JNK inhibitor D-JNK1 was added 2 hr post TNF stimulation. Average densitometric values from two independent experiments were included above the blot. The data are presented as means ± standard deviation (SD) from three to five samples per experiment, representative of three independent experiments. The statistical significance was performed by two-way ANOVA using Šídák’s multiple comparison test (Panel A) and ordinary one-way ANOVA using Šídák’s multiple comparison test (Panels D-F and H). Significant differences are indicated with asterisks (*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001).
-
Figure 5—source data 1
PDF file containing original western blots for Figure 5B, C, I, and J indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig5-data1-v1.zip
-
Figure 5—source data 2
Original files for western blot analysis displayed in Figure 5B, C, I, and J.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig5-data2-v1.zip
Figure 5—figure supplement 1
Effects of Myc and CSF1R inhibition on B6.Sst1S macrophage activation by TNF.
(A) Myc inhibitor 10058-F4 (10 μΜ) prevents the 4-HNE adducts accumulation in TNF-stimulated B6.Sst1S BMDMs. B6.Sst1S BMDMs were treated with 10 ng/mL TNF for 48 hr. The inhibitor was added 2 hr post TNF stimulation. The accumulation of lipid peroxidation product, 4-HNE, was detected by confocal microscopy using 4-HNE-specific antibody. Scale bar = 20 μm. (B) Myc inhibition reduced lipid peroxidation in TNF-stimulated B6.Sst1S BMDMs. Cells were treated with 10 ng/mL TNF in the presence or absence of 10058-F4 for 48 hr. The inhibitor was added 2 hr post TNF stimulation. The accumulation of lipid peroxidation product, 4-HNE, was detected by confocal microscopy using 4-HNE-specific antibody. The 4-HNE adducts accumulation was quantified using ImageJ and plotted as fold accumulation compared to untreated group. (C) Media change induces Myc upregulation and similar downregulation in B6 and B6.Sst1S BMDMs. Myc protein levels were monitored using western blot. (D) Selection of non-toxic concentration of CSF1R inhibitors. BMDMs from B6.Sst1S were either left untreated or treated with 10 ng/mL TNF. Post 2 hr of TNF stimulation, the inhibitors of CSF1R were added at different concentrations. PLX3397 (30, 10, and 3 nM), BLZ945 (100, 30, and 10 nM), and GW2580 (30, 10, and 3 nM) for 46 hr. Percent of cell number was determined by automated microscopy. (E and F) CSF1R inhibitors do not prevent the IFN-I pathway hyperactivity in TNF-stimulated B6.Sst1S macrophages. BMDMs from B6.Sst1S were treated with 10 ng/mL TNF alone or in combination with CSF1R inhibitors, PLX3397 (3 nM), BLZ945 (10 nM), and GW2580 (10 nM) for 20 hr. CSF1R inhibitors were added 2 hr post TNF stimulation. Expression of Ifnb1 and Rsad2 were quantified by the ΔΔCt method using qRT-PCR and expressed as a fold induction compared to the untreated group. 18 S was used as the internal control. The data are presented as means ± standard deviation (SD) from three to five samples per experiment, representative of three independent experiments. The statistical significance was performed by ordinary one-way ANOVA using Šídák’s multiple comparison test (Panels B, E and F). Significant differences are indicated with asterisks (*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001).
-
Figure 5—figure supplement 1—source data 1
PDF file containing original western blots for Figure 5—figure supplement 1C indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig5-figsupp1-data1-v1.zip
-
Figure 5—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 5—figure supplement 1C.
- https://cdn.elifesciences.org/articles/106814/elife-106814-fig5-figsupp1-data2-v1.zip
Figure 6 with 1 supplement
Myc and lipid peroxidation compromise control of intracellular Mtb by the B6.Sst1S macrophages.
(A) Accumulation of 4-HNE adducts in Mtb-infected B6 and B6.Sst1S macrophage monolayers infected with Mtb. BMDMs were either treated with 10 ng/mL TNF or left untreated (UT), and subsequently infected with Mtb at MOI = 1. 4-HNE adducts were detected by confocal microscopy using 4-HNE-specific antibody 5 dpi. The 4-HNE accumulation was quantified at 5 dpi using ImageJ and plotted as fold accumulation compared to untreated B6 (UT). (B) Naïve and TNF-stimulated B6 and B6.Sst1S BMDMs were infected with Mtb Erdman reporter strain (SSB-GFP, smyc’::mCherry) for 5 days. The accumulation of 4-HNE adducts was detected in both Mtb-infected and non-infected B6.Sst1S cells at day 5 p.i. (C) Naive and TNF-stimulated B6.Sst1S BMDMs were infected with Mtb at MOI = 1. At days 4 post infection Mtb load was determined using a qPCR-based method. (D) Testing the effects of LPO and Myc inhibitors on the Mtb-infected B6.Sst1S BMDM survival and Mtb control: experimental design for panels E – H. (E and F) Prevention of iron-mediated lipid peroxidation improves the survival of and Mtb control by the B6.Sst1S macrophages. BMDMs were treated with 10 ng/mL TNF alone in combination with Fer-1 (3 μM) or DFO (50 μM) for 16 hr and subsequently infected with Mtb at MOI = 1. The inhibitors were added after infection for the duration of the experiment. At days 1 and 5 post infection, total cell numbers were quantified using automated microscopy (E) and Mtb loads was determined using a qPCR-based method (F). The percentage cell number were calculated based on the number of cells at Day 0 (immediately after Mtb infection and washes). The fold change of Mtb was calculated after normalization using Mtb load at Day 0 after infection. (G and H) Myc inhibition improves the survival and Mtb control by B6.Sst1S macrophages. BMDMs were treated with 10 ng/mL TNF alone or in combination with 3 μM or 10 μM 10058-F4 for 16 hr and subsequently infected with Mtb at MOI = 1. At days 1 and 5 post infection, total cell numbers were quantified using automated microscopy (G) and Mtb loads was determined using a qPCR-based method (H). The percentage cell number were calculated based on the number of cells at Day 0 (immediately after Mtb infection). The fold change of Mtb was calculated after normalization using Mtb load at Day 0 after infection and washes. (I) LPO and Myc inhibitors improve Mtb control by B6.Sst1S BMDMs co-cultured with BCG-induced T cells: experimental design for panels J – L. (J) Differential effect of BCG-induced T cells on Mtb control by B6 and B6.Sst1S macrophages. BMDMs of both backgrounds were treated with 10 ng/mL TNF or left untreated and subsequently infected with Mtb at MOI = 1. T lymphocytes purified from lymph nodes of BCG vaccinated B6 mice were added to the infected macrophage monolayers 24 hr post infection. The Mtb load was calculated by qPCR-based method after 2 days of co-culture with T lymphocytes (3 days post infection). The dotted line indicates the Mtb load in untreated cells at day 2 post infection. (K) Inhibition of Myc and lipid peroxidation improves control of Mtb by B6.Sst1S macrophages co-cultured with immune T cells isolated from BCG-vaccinated B6 mice. BMDMs were pretreated with 10 ng/mL TNF alone or in combination with either Fer-1 (3 μM) or 10058-F4 (10 μM) for 16 hr and subsequently infected with Mtb at MOI 1. At 24 hr post infection the lymphocytes from BCG immunized B6 mice were added to the infected macrophage monolayers. The Mtb loads were determined by qPCR based method after 2 days of co-culture with T cells (3 days post infection). (L) Inhibition of type I IFN receptor improves control of Mtb by B6.Sst1S macrophages. BMDMs were pretreated with 10 ng/mL TNF alone or in combination with IFNAR1 blocking Ab or isotype C Ab for 16 hr and subsequently infected with Mtb at MOI 1. At 24 hr post infection the lymphocytes from BCG immunized B6 mice were added to the infected macrophage monolayers. The Mtb loads were determined by qPCR-based method after 2 days of co-culture with T cells (3 days post infection). (M) TNF stimulation inhibits and IFNAR1 blockade restores the response of B6.Sst1S macrophages to IFNγ. BMDMs were pretreated with TNF (10 ng/mL) for 18 hr and the IFNAR1 blocking Abs or isotype C Ab were added 2 hr after TNF. Subsequently, IFNγ (10 U/mL) was added for additional 12 hr. The expression of the IFNγ-specific target gene Ciita was assessed using qRT-PCR. 18 S was used as internal control. The data are presented as means ± standard deviation (SD) from three to five samples per experiment, representative of three independent experiments. The statistical significance was performed by two-way ANOVA using Bonferroni’s multiple comparison test (Panels A, C, J, and K) and Tukey’s multiple comparison test (Panels E-H and L). One-way ANOVA using Bonferroni’s multiple comparison test (Panel M). Significant differences are indicated with asterisks (*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001).
Figure 6—figure supplement 1
Inhibition of lipid peroxidation improves Mtb control by B6.Sst1S mac rophages.
(A and B) Accumulation of 4-HNE adducts in Mtb-infected B6 and B6.Sst1.S macrophage monolayers infected with Mtb. BMDMs were either treated with 10 ng/mL TNF or left untreated (UT), and subsequently infected with Mtb at MOI = 1. 4-HNE adducts were detected by confocal microscopy using 4-HNE-specific antibody 3 dpi. The 4-HNE adducts accumulation was quantified at 3 dpi using ImageJ and plotted as fold accumulation compared to untreated B6 (UT). Scale bar = 20 μm. (C and D) Naïve and TNF-stimulated B6 and B6.Sst1S BMDMs were infected with Mtb Erdman reporter strain (Mtb SSB-GFP, smyc’::mCherry) at MOI = 1 for 5 days. The 4-HNE adducts accumulation and Mtb SSB were observed using confocal microscopy at day 5 p.i. (C) The percent of replicating Mtb was quantified by calculating number of Mtb (red) and SSB-GFP puncta (green) (D) Scale bar = 20 μm. (E) Control of Mtb growth by B6.Sst1.S BMDMs pre-treated with 10 ng/mL TNF alone or in combination with Fer-1 (3 μM) or DFO (50 μM). Macrophages were pretreated 16 h before Mtb infection and infected with Mtb at MOI = 1. Mtb loads were determined on days 1, 3, and 5 post infection using a qPCR-based method. (F) Differential effect of BCG-induced T cells on Mtb control by B6 and B6.Sst1.S macrophages. BMDMs of both backgrounds were treated with 10 ng/mL TNF or left untreated and subsequently infected with Mtb at MOI = 1. T lymphocytes purified from lymph nodes of BCG-vaccinated B6 mice were added to the infected macrophage monolayers 24 hr post infection. The Mtb load was calculated by qPCR-based method after 1 day of co-culture with T lymphocytes (day 2 post infection). The dotted line indicates the Mtb load in untreated cells at day 2 post infection. (G) Inhibition of Myc and lipid peroxidation improves control of Mtb by B6.Sst1S macrophages co-cultured with immune T cells isolated from BCG-vaccinated B6 mice. BMDMs were pretreated with 10 ng/mL TNF alone or in combination with either Ferrostatin 1 (3 μM) or 10058-F4 (10 μM) for 16 hr and subsequently infected with Mtb at MOI 1. At 24 hr post infection, the lymphocytes from BCG-immunized B6 mice were added to the infected macrophage monolayers. The Mtb loads were determined by qPCR-based method after 1 day of co-culture with T cells (2 days post infection). (H) BMDMs from B6 were infected with Mtb at MOI 1. At 24 hr post infection, the splenocytes from non-immunized mice at 10:1, 5:1, and 1:1 ratio (splenocytes:macrophages) or lymphocytes from BCG-immunized B6 mice were added to the infected macrophage monolayers. The Mtb loads were determined by qPCR-based method after 1 day of co-culture with T cells (2 days post infection). (I) Inhibition of type I IFN receptor improves control of Mtb by B6.Sst1S macrophages. BMDMs were pretreated with 10 ng/mL TNF alone or in combination with anti-IFNAR Ab or Isotype C Ab for 16 hr and subsequently infected with Mtb at MOI 1. At 24 hr post infection, the lymphocytes from BCG-immunized B6 mice were added to the infected macrophage monolayers. The Mtb loads were determined by qPCR-based method after 1 day of co-culture with T cells (2 days post infection). The data represent the means ± SD of three samples per experiment, representative of three independent experiments. The statistical significance was performed by two-way ANOVA using Bonferroni’s multiple comparison test (Panels B, D, F, G, and I), and Tukey’s multiple comparison test (Panel E) and One-way ANOVA using Bonferroni’s multiple comparison test (Panel H). Significant differences are indicated with asterisks (*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001).
Figure 7 with 7 supplements
Accumulation of lipid peroxidation products and stress escalation in macrophages during pulmonary TB progression.
(A) Representative 3D confocal images of paucibacillary (n=16) and multibacillary (n=16) pulmonary TB lesions of B6.Sst1S,Ifnb1 -YFP reporter mice stained with anti-4-HNE antibody (yellow). Cells expressing YFP are green, Mtb reporter Mtb (smyc':: mCherry) is red. Arrows indicate Mtb reporter strain expressing mCherry. The mice were infected for 20 weeks. (B) Representative fluorescent multiplexed immunohistochemistry (fmIHC) images of pauci-bacillary and multi-bacillary PTB lesion in B6.Sst1S mice at high magnification (×600). 4-HNE adducts (magenta), CD11b (green), and DAPI (gray). White areas showing 4-HNE adducts and CD11b co-localization. The mice were infected for 20 weeks. (C) Heatmap of interferon-inducible genes differentially expressed in Iba1 + cells within multibacillary vs paucibacillary lesions (fold change 1.5 and above). Pooled gene list of IFN type I and II regulated genes was assembled using public databases (as described in Materials and methods). The mice were infected for 14 weeks. (D) Representative fmIHC images of IFN-I producing (YFP positive) myeloid cells in pauci-bacillary (n=8) and multi-bacillary (n=8) lesion of B6.Sst1S,Ifnb1 -YFP reporter mice. The different markers are shown as Iba1 (red), iNOS (teal), and YFP (green) at ×400 magnification. The mice were infected for 20 weeks. (E) Representative fmIHC images of IFN-I producing (YFP positive) cells accumulating stress markers in pauci-bacillary (n=6) and multi-bacillary (n=9) lesion of B6.Sst1S,Ifnb1 -YFP reporter mice. The different markers are shown as phospho-c-Jun (peach), Chac-1 (yellow), and YFP (green) at ×400 original magnification. The mice were infected for 20 weeks.
Figure 7—figure supplement 1
Pauci- and multi-bacillary pulmonary lesions of Mtb-infected B6.Sst1S mice.
(A) Representative histopathology and Acid Fast Bacteria (AFB) loads in B6.Sst1S mouse lungs at 14 weeks after infection with 106 CFU of Mtb Erdman. Arrows indicate acid-fast bacilli (Mtb). (B) Left- Representative H & E staining and Right - acid-fast staining of B6.Sst1S Mtb-infected lungs at ×200 original magnification. Arrows and boxes indicate acid-fast bacilli (Mtb).
Figure 7—figure supplement 2
Accumulation of 4-HNE and Ifnβ producing cells in Mtb-infected B6.Sst1S mouse lung lesions.
(A) 3D images of uninvolved lung and pulmonary TB lesions in Mtb-infected B6.Sst1S,Ifnb1-YFP mice presented in Figure 7A at low and high magnification. 4-HNE + staining is yellow, and the reporter Mtb (smyc':: mCherry) is red. The mice were infected for 20 weeks. Scale bar = 10 μm. Arrows indicate Mtb reporter strain expressing mCherry. Lower panels are magnified areas of insets shown in top panels. (B) Representative fluorescent single-channel images of pauci- and multibacillary PTB lesions in B6.Sst1S mice and merged images corresponding to Figure 7B. 4-HNE adducts (magenta), CD11b (green), and DAPI (gray).
Figure 7—figure supplement 3
Representative images of GeoMX Region of Interests (ROIs).
Representative images of GeoMX ROIs (Regions of Interest) with tuberculous lesions labeled with DAPI (nuclear stain, blue), anti-pancytokeratin (epithelial cells, green), and anti-Iba1 (macrophages, red). A&B low-magnification views with two (A) or three (B) ROIs outlined (white) containing abundant macrophages (red) and scattered enlarged alveolar epithelial cells (green), as illustrated in a higher magnification view in (C). (Original magnification, A&B ×40, C ×400). The profiling used the Mouse Whole Transcriptome Atlas (WTA) panel which targets ~21,000 + transcripts for mouse protein coding genes plus ERCC negative controls, to profile the whole transcriptome, excluding uninformative high expressing targets such as ribosomal subunits. We assembled lungs from two mice with paucibacillary and two mice with multibacillary lesions to prepare a tissue array of paraffin-embedded lung tissues and used acid-fast Mtb staining on serial sections to classify individual TB lesions in the Mtb paucibacillary and multibacillary categories (Figure 7—figure supplement 1).
Figure 7—figure supplement 4
Analysis of spatial transcriptomics data from Iba1 + cells in pauci- and multi-bacillary lesions in Mtb-infected B6.Sst1S mouse lungs.
(A) Heatmap of all differentially expressed genes (fold change 2 and above) by Iba1 + cells in Multibacillary vs Paucibacillary TB lesions. (B) Top 10 Hallmark pathways upregulated in Iba1 + cells in multibacillary lesions. (C) Top 10 transcription factors enriched in promoters of genes upregulated in Iba1 + cells in multibacillary lesions. (D) Top 10 Hallmark pathways upregulated in the combined gene set of IFN-inducible genes expressed by Iba1 + cells in multibacillary lesions. (E) Top 10 transcription factors enriched in promoters of genes upregulated in the list of IFN-inducible genes expressed by Iba1 + cells in multibacillary lesions.
Figure 7—figure supplement 5
Accumulation of 4-HNE and Ifnβ producing cells in Mtb-infected B6.Sst1S mouse lung lesions.
(A) Confocal images of BMDMs isolated from B6.Sst1S, Ifnb1-YFP mice stimulated with TNF (10 ng/ml) in vitro for 24 hr or left untreated. The endogenous YFP signal is shown in green. Staining with anti-YFP antibody was used to demonstrate YFP expression in activated BMDMs, as a control of specificity. Nuclei in blue (DAPI). Scale bar = 50 μm. (B) Confirmation of YFP signal from B6.Sst1S,Ifnb1-YFP reporter mice using Ifnb1 mRNA in situ hybridization. 3D confocal images of fluorescent in situ hybridization with Ifnb1mRNA probes (red) showed overlap with YFP + cells. Insets at the lower right corner are an enlarged image of the inset at the top right corner, which is showing the same cells expressing both signals. The mice were infected for 20 weeks. Scale bar = 10 μm.
Figure 7—figure supplement 6
Fluorescent multiplexed immunohistochemistry (fmIHC) images representing increased expression of stress markers in macrophages within multi-bacillary pulmonary TB lesions of B6.Sst1S mice.
(A) Quantification of IFN-I producing (YFP positive) myeloid cells in pauci-bacillary (n=8) and multi-bacillary (n=8) lesions of B6.Sst1S, Ifnb1-YFP reporter mice. The quantification was performed by manually counting total and individual group of markers at different lesions at ×400 magnification and calculated the percentage cell number as compared to total DAPI. The average total cell number (DAPI) per field was 140. (B and C) fmIHC images and quantification of total macrophages (Iba1 positive) co-expressing stress markers in paucibacillary (n=15) and multibacillary (n=15) PTB lesions. The quantification was performed using Halo automated analysis as percent lesion area. The different markers are shown as p-c-Jun (peach), Chac-1 (yellow), and Iba1 (red) at ×200 magnification. The mice were infected for 20 weeks. (D) Quantification of IFN-I producing (YFP positive) cells accumulating stress markers in pauci-bacillary (n=6) and multi-bacillary (n=9) lesion of B6.Sst1S, Ifnb1-YFP reporter mice using Halo automated analysis. (E and F) Quantification and representative fmIHC images of activated (iNOS+) macrophages co-expressing stress markers in paucibacillary (n=14) and multibacillary (n=14) PTB lesions. The quantification was performed using Halo automated analysis, and the signals are presented as percent lesion area. The different markers are shown as phospho-c-Jun (peach), Chac-1 (yellow), and iNOS (teal) at ×400 magnification. The mice were infected for 20 weeks. The data represent the means ± SD and the statistical significance was performed by two-tailed unpaired t-test (Panel A, C–E). Significant differences are indicated with asterisks (*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001).
Figure 7—figure supplement 7
Expression of stress markers in pauci- and multi-bacillary lesions of Mtb-infected B6.Sst1S mouse lungs.
(A) Representative monochromogenic immunohistochemistry staining images of Chac1, p-c-Jun, and PKR in uninvolved lung area, paucibacillary, and multibacillary pulmonary lesions in Mtb-infected B6.Sst1S mice. Mice were infected for 14 weeks. (B) No effect of post-exposure BCG vaccination on the survival of Mtb-infected B6.Sst1S mice. Mice were infected with Mtb and BCG-vaccinated 2 months post infection. The survival curves of vaccinated and non-vaccinated mice were compared using the Log-rank (Mantel-Cox). Numbers of mice per group indicated in parentheses. This experiment was performed once. Log-rank (Mantel-Cox) test was applied to determine statistical significances between the groups for panel B. Significant differences are indicated with asterisks (*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001).
Figure 8
Myc upregulated gene signature in peripheral blood of TB patients is associated with treatment failures.
(A) PBMC gene expression profiling of TB patients prior to TB treatment. Boxplot of bootstrapped ssGSEA enrichment AUC scores from several oncogene signatures ranked from lowest to highest area under curve (AUC) score (Y-axis), with Myc_up and Myc_dn gene sets (X-axis) highlighted in red. (B and C) Boxplots of myc upregulated (Myc_up) and downregulated (Myc_dn) gene signatures in successful (control) or failed (failed) TB therapy groups, with the receiver-operating characteristic (ROC) curve of Myc_up depicted in C. (D) Heatmap of all genes utilized in ssGSEA enrichment of the myc_up signature is depicted with individual ssGSEA scores for each patient sample. All plots were generated with the TBSignatureProfiler in R, and p-values were determined by a Student’s t-test.
Figure 9
Schematic representation of B6 and B6.Sst1S macrophage responses to TNF.
Common for B6 and B6.Sst1S: 1. TNF activates c-Myc expression. 2. TNF induces moderate Ifnb1 expression. 3. TNF stimulation upregulates Nrf2. B6-specific: 4. Ifnβ induces the sst1-encoded SP110 and SP140 nuclear proteins that co-activate Nrf2 and suppress c-Myc. 5. Nrf2 activates antioxidant defense (AOD) that inhibits lipid peroxidation (LPO). B6.Sst1S-specific: 6. Sp110 and Sp140 are not expressed. 7. Myc is upregulated, inhibits ferritin expression, and coactivates Ifnb1 transcription. 8. Deficient AOD activation coupled with increased labile iron pool promotes accumulation of LPO products. 9. LPO further co-stimulates Ifnb1 superinduction. 10. IFN-I hyperactivity activates ISR and induces Chac1 that further inhibits the AOD and increases LPO. 11. Alternative mechanisms of IFN-mediated dysregulation of AOD defense and iron homeostasis.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Rabbit polyclonal anti-iNOS antibody | Abcam | Cat# ab15323, RRID:AB_301857 | IHC (1:100) |
| Antibody | Rabbit monoclonal anti-Iba1/AIF-1 (E4O4W) XP antibody | Cell Signaling Technology | Cat# 17198, RRID:AB_2820254 | IHC (1:500) |
| Antibody | Rabbit polyclonal anti-GFP antibody | Invitrogen | Cat# A11122, RRID:AB_221569 | IHC (1:500) IF (1:500) |
| Antibody | Mouse monoclonal anti-IFNAR1 antibody (clone MAR1-5A3), functional grade | Thermo Fisher Scientific | Cat# 16594585, RRID:AB_1210688 | IFN I inhibition (1:200) |
| Antibody | Mouse IgG1 κ isotype control antibody (clone P3.6.2.8.1) | Thermo Fisher Scientific | Cat# 14471482, RRID:AB_470111 | Isotype C Ab (1:200) |
| Antibody | Mouse monoclonal anti-TNFα antibody (clone XT22) | Thermo Fisher Scientific | Cat# MM350D, RRID:AB_223528 | Inhibition of TNF signaling (10 μg/mL) |
| Antibody | Rabbit polyclonal anti-KEAP1 antibody (reactive to human, mouse, rat) | Proteintech Group Inc | Cat# 10503–2-AP, RRID:AB_2132625 | WB (1:5000) |
| Antibody | Rabbit polyclonal anti-NRF2/NFE2L2 antibody (reactive to human, mouse, rat) | Proteintech Group Inc | Cat# 16396–1-AP, RRID:AB_2782956 | WB (1:5000) |
| Antibody | Rabbit polyclonal anti-βTrCP antibody | Proteintech Group Inc | Cat# 28393–1-AP, RRID:AB_2935467 | WB (1:2000) |
| Antibody | Rabbit polyclonal anti-BACH1 antibody | Invitrogen | Cat# PA5-117013, RRID:AB_2901643 | WB (1:1000) |
| Antibody | Rabbit polyclonal anti-Histone H3 antibody | Cell Signaling Technology | Cat# 9715 s, RRID:AB_331563 | WB (1:5000) |
| Antibody | Mouse monoclonal anti-β-tubulin antibody | Santa Cruz Biotechnology | Cat# sc-55529, RRID:AB_2210962 | WB (1:1000) |
| Antibody | Mouse monoclonal anti-β-Actin antibody(Human/Mouse/Rat) | R&D Systems | Cat# MAB8929; RRID:AB_3076436 | WB (1:5000) |
| Antibody | Rabbit polyclonal anti-phospho-cJun antibody | Cell Signaling Technology | Cat# 9261 s, RRID:AB_2130162 | WB (1:1000) |
| Antibody | Rabbit monoclonal anti-c-Myc antibody [Y69] | Abcam | Cat# ab32072, RRID:AB_731658 | WB (1:1000) |
| Antibody | Rabbit monoclonal anti-Ferritin Heavy Chain antibody [EPR18878] | Abcam | Cat# ab183781, RRID:AB_2940987 | WB (1:2000) |
| Antibody | Rabbit monoclonal anti-Ferritin Light Chain antibody [EPR5260] | Abcam | Cat# ab109373, RRID:AB_1086271 | WB (1:5000) |
| Antibody | Rabbit polyclonal anti-4-Hydroxynonenal antibody | Abcam | Cat# ab46545, RRID:AB_722490 | IHC (1:50) IF (1:100) |
| Antibody | Mouse monoclonal anti-NRF1 antibody | Santa Cruz Biotechnology | Cat# sc-515360 | WB (1:500) |
| Antibody | Rabbit polyclonal anti-GPX1 antibody | Proteintech Group Inc | Cat# 29329–1-AP, RRID:AB_2918283 | WB (1:1000) |
| Antibody | Mouse monoclonal anti-GPX4 antibody | Proteintech Group Inc | Cat# 67763–1-Ig, RRID:AB_2909469 | WB (1:1000) |
| Antibody | Horse anti-mouse IgG, HRP-linked antibody (polyclonal) | Cell Signaling Technology | Cat# 7076 s, RRID:AB_330924 | WB (1:2000) |
| Antibody | Goat anti-rabbit IgG, HRP-linked antibody (polyclonal) | Cell Signaling Technology | Cat# 7074 s, RRID:AB_2099233 | WB (1:2000) |
| Antibody | Goat polyclonal anti-rabbit IgG (H+L), ImmPRESS HRP polymer detection kit | Vector Laboratories | Cat# MP-7451, RRID:AB_2631198 | |
| Antibody | Goat polyclonal anti-mouse IgG (H+L), ImmPRESS HRP polymer detection kit | Vector Laboratories | Cat# MP-7452, RRID:AB_2744550 | |
| Antibody | Goat polyclonal anti-rabbit IgG (H+L), Alexa Fluor 546, cross-adsorbed | Invitrogen | Cat# A-11010, RRID:AB_2534077 | IF (1:200) |
| Antibody | Goat polyclonal anti-rabbit IgG (H+L), Alexa Fluor Plus 647, highly cross-adsorbed | Invitrogen | Cat# A-32733, RRID:AB_2633282 | IF (1:200) |
| Strain, strain background (Mycobacterium tuberculosis) | Mycobacterium tuberculosis H37Rv (TMC 102) | ATCC | Cat# 27294 | |
| Strain, strain background (Mycobacterium bovis BCG) | Mycobacterium bovis BCG, TMC 1019 [BCG Japanese] | ATCC | Cat# 35737 | |
| Strain, strain background (Mycobacterium tuberculosis) | Erdman(SSB-GFP, smyc′::mCherry) | Lavin and Tan, 2022 | N/A | A gift from Shumin Tan |
| Chemical compound, drug, peptides | ChromoMap DAB Kit | Roche | Cat#760–159 | |
| Chemical compound, drug, peptides | HRP/DAB detection kit | Abcam | Cat# ab64261 | |
| Chemical compound, drug, peptides | Tris based buffer-Cell Conditioning 1 (CC1) | Roche | Cat#950–124 | |
| Chemical compound, drug, peptides | Pexidartinib (PLX3397) | Selleckchem | Cat# S7818 | |
| Chemical compound, drug, peptides | Sotuletinib (BLZ945) | MedChemExpress | Cat# HY-12768 | |
| Chemical compound, drug, peptides | GW-2580 | MedCHemExpress | Cat#HY-10917 | |
| Chemical compound, drug, peptides | 10058-F4 | Selleckchem | Cat# S7153 | |
| Chemical compound, drug, peptides | Ferrostatin-1 | Selleckchem | Cat#S7243 | |
| Chemical compound, drug, peptides | D-JNK-1 | MedChemExpress | Cat# HY-P0069 | |
| Chemical compound, drug, peptides | Deferoxamine mesylate (DFOM) | Sigma Aldrich | Cat#D9533 | |
| Chemical compound, drug, peptides | Butylated hydroxyanisole (BHA) | Sigma Aldrich | Cat# B1253 | |
| Chemical compound, drug, peptides | Hygromycin B | Roche | Cat# 10843555001 | 50 μg/mL |
| Chemical compound, drug, peptides | Murine IFN-gamma | Peprotech | Cat# 315–05 | |
| Chemical compound, drug, peptides | Murine Interleukin –3 | Peprotech | Cat# 213–13 | |
| Chemical compound, drug, peptides | Murine Interleukin-4 | Peprotech | Cat# 214–14 | |
| Chemical compound, drug, peptides | Murine TNF-alpha | Peprotech | Cat# 315–01 A | |
| Chemical compound, drug, peptides | Middlebrook 7H9 Broth | BD Biosciences | Cat# 271310 | |
| Chemical compound, drug, peptides | Middlebrook 7H10 Agar | BD Biosciences | Cat# 262710 | |
| Chemical compound, drug, peptides | Cycloheximide | Cell Signaling Technology | Cat#2112 | |
| Commercial assay or kit | Live-or-Dye 594/614 Fixable Viability Staining Kits | Biotium | Cat# 32006 | Dilution 1:1000 |
| Commercial assay or kit | TaqMan Environmental Master Mix 2.0 | Fisher Scientific | Cat#4396838–5 mL | |
| Commercial assay or kit | Lipid Peroxidation (MDA) Assay Kit (Colorimetric/Fluorometric) | Abcam | Cat# ab118970 | |
| Commercial assay or kit | BODIPY 581/591 C11 (Lipid Peroxidation Sensor) | Thermo Fisher Scientific | Cat# D3861 | |
| Commercial assay or kit | CellROX Green Reagent | Thermo Fisher Scientific | Cat# C10444 | |
| Commercial assay or kit | Click-iT Lipid Peroxidation Imaging Kit | Thermo Fisher Scientific | Cat# C10446 | |
| Commercial assay or kit | Nuclear Extraction Kit | Signosis | Cat# SK-0001 | |
| Commercial assay or kit | NRF2(ARE) EMSA Kit | Signosis | Cat# GS-0031 | |
| Commercial assay or kit | HCR Ifnb1 probe set | Molecular Instruments | N/A | Detection of Ifnb1 transcripts |
| Commercial assay or kit | HCR Buffers | Molecular instruments | N/A | |
| Commercial assay or kit | Antioxidant Assay Kit | Cayman chemical | Cat# 709001 | |
| Commercial assay or kit | RNeasy plus mini kit | Qiagen | Cat#74136 | |
| Commercial assay or kit | Invitrogen SuperScript III First-Strand Synthesis SuperMix | Invitrogen | Cat#18080400 | |
| Commercial assay or kit | GoTaq qPCR Mastermix | Promega | Cat#A6002 | |
| Commercial assay or kit | PAXgene Blood RNA kit | Qiagen, Hilden, Germany | Cat #762164 | |
| Commercial assay or kit | SureSelect Strand-Specific mRNA Library Prep kit | Agilent, Santa Clara, USA | Cat #5190–6,411 | |
| Commercial assay or kit | HCR RNA-FISH probe set targeting Ifnb1 mRNA (custom design) | Molecular Instruments | N/A | |
| Commercial assay or kit | HCR RNA-FISH amplifier and buffers (used with Ifnb1 probe set) | Molecular Instruments | N/A | |
| Strain, strain background (Mus musculus) | Mouse: C57BL/6 J, adult male and female | The Jackson Laboratory | Stock No.: 000664, RRID:IMSR_JAX:000664 | https://www.jax.org/strain/000664 |
| Strain, strain background (Mus musculus) | Mouse: B6J.C3-Sst1C3HeB/FejKrmn, adult male and female | Pichugin et al., 2009 | Stock No: 043908-UNC https://www.mmrrc.org | Available at https://www.mmrrc.org |
| Strain, strain background (Mus musculus) | Mouse: (C3XB6.Sst1S) F1, adult male and female | This study | N/A | |
| Strain, strain background (Mus musculus) | Mouse: B6.Sst1S;Ifnb1-YFP, adult male and female | Scheu et al., 2008; Yabaji et al., 2025b | N/A | YFP-based detection of Ifnb1 expression |
| Sequence-based reagent | Mtb specific_F | This paper | PCR primers | GGAAATGTCACGTCCATTCATTC |
| Sequence-based reagent | Mtb specific_R | This paper | PCR primers | GCGTTGTTCAGCTCGGTA |
| Sequence-based reagent | Mtb specific probe | This paper | PCR probe | 56-FAM/AGCTTGGTCAGGGACTGCTTCC/36-TAMSp/ |
| Sequence-based reagent | BCG specific_F | This paper | PCR primers | GTGGTGGAGCGGATTTGA |
| Sequence-based reagent | BCG specific_R | This paper | PCR primers | CAACCGGACGGTGATCC |
| Sequence-based reagent | BCG specific probe | This paper | PCR probe | /5Cy5/TTCTGGTCG/TAO/ACGATTGGCACATCC/3IAbRQSp/ |
| Sequence-based reagent | Fth_F | This paper | PCR primers | TGTATGCCTCCTACGTCTATCT |
| Sequence-based reagent | Fth_R | This paper | PCR primers | CCTCATGAGATTGGTGGAGAAA |
| Sequence-based reagent | Ftl_F | This paper | PCR primers | AGGAGGTGAAACTCATCAAGAA |
| Sequence-based reagent | Ftl_R | This paper | PCR primers | TGAGGCGCTCAAAGAGATAC |
| Sequence-based reagent | Myc_F | This paper | PCR primers | TCTCCACTCACCAGCACAACTACG |
| Sequence-based reagent | Myc_R | This paper | PCR primers | ATCTGCTTCAGGACCCT |
| Sequence-based reagent | Hmox-1_F | This paper | PCR primers | CCTTCCCGAACATCGACAGCC |
| Sequence-based reagent | Hmox-1_R | This paper | PCR primers | GCAGCTCCTCAAACAGCTCAA |
| Sequence-based reagent | Nqo1_F | This paper | PCR primers | CCTCGCTGGAAAAAGAAGTG |
| Sequence-based reagent | Nqo1_R | This paper | PCR primers | GGAGAGGATGCTGCTGAAAG |
| Sequence-based reagent | Nfe2l2_F | This paper | PCR primers | CCTCGCTGGAAAAAGAAGTG |
| Sequence-based reagent | Nfe2l2_R | This paper | PCR primers | GGAGAGGATGCTGCGGAAAG |
| Sequence-based reagent | Gpx1_F | This paper | PCR primers | CACCAGGAGAATGGCAAGAA |
| Sequence-based reagent | Gpx1_R | This paper | PCR primers | CATTCCGCAGGAAGGTAAAGA |
| Sequence-based reagent | Ciita_F | This paper | PCR primers | CTTCAAGCAGCCTCAGTATC |
| Sequence-based reagent | Ciita_R | This paper | PCR primers | ATGTGTCCTCTGTCTCATTTAC |
| Sequence-based reagent | Ifnb1_F | This paper | PCR primers | ATGAGTGGTGGTTGCAGGC |
| Sequence-based reagent | Ifnb1_R | This paper | PCR primers | TGACCTTTCAAATGCAGTAGATTC |
| Sequence-based reagent | Rsad2_F | This paper | PCR primers | AAGCTGAGGAGGTGGTGCAG |
| Sequence-based reagent | Rsad2_R | This paper | PCR primers | GAAAACCTTCCAGCGCACAG |
| Sequence-based reagent | Trib3_F | This paper | PCR primers | GCAAAGCGGCTGATGTCTG |
| Sequence-based reagent | Trib3_R | This paper | PCR primers | AGAGTCGTGGAATGGGTATCTG |
| Sequence-based reagent | Chac1_F | This paper | PCR primers | CCTGCTACCCTGCTCTTACCT |
| Sequence-based reagent | Chac1_R | This paper | PCR primers | GAGCTTGGCTCCTCAGGTC |
| Sequence-based reagent | b-actin_F | This paper | PCR primers | GTGGGCCGCTCTAGGCACCA |
| Sequence-based reagent | b-actin_R | This paper | PCR primers | CGGTTGGCCTTAGGGTTCAGGG |
| Sequence-based reagent | 18 S_F | This paper | PCR primers | TCAAGAACGAAAGTCGGAGGT |
| Sequence-based reagent | 18 S_R | This paper | PCR primers | CGGGTCATGGGAATAACG |
| Software, algorithm | Graphpad Prism 9.5.1 (528) | Graphpad | https://www.graphpad.com/, RRID:SCR_002798 | |
| Software, algorithm | Microsoft office | Microsoft | https://www.office.com/?auth=2 | |
| Software, algorithm | Halo HighPlex FL v4.2.3 | Indica Labs Inc. | https://indicalab.com/halo/ | |
| Software, algorithm | EndnoteX9 | Clarivate Analytics | https://endnote.com/downloads | |
| Software, algorithm | Imaris Viewer | Oxford Instruments | https://imaris.oxinst.com/microscopy-imaging-software-free-trial?source%20=viewer | |
| Software, algorithm | ImageJ | National Institutes of Health (NIH) | https://imagej.nih.gov/ij/, SCR_003070 | Image analysis |
| Software, algorithm | STAR | STAR | RRID:SCR_004463 | |
| Software, algorithm | featureCounts | featureCounts | RRID:SCR_012919 | |
| Software, algorithm | DESeq2 | DESeq2 | RRID:SCR_015687 | |
| Software, algorithm | limma | limma | RRID:SCR_010943 | |
| Software, algorithm | GSEA | GSEA | RRID:SCR_003199 | |
| Software, algorithm | Seurat | Seurat | RRID:SCR_007322 | |
| Software, algorithm | Cytoscape | Cytoscape | RRID:SCR_003032 | |
| Software, algorithm | Trimmomatic | Trimmomatic | RRID:SCR_011848 | |
| Software, algorithm | GEO | GEO | RRID:SCR_005012 | |
| Software, algorithm | GENIE3 | GENIE3 | RRID:SCR_000217 | |
| Software, algorithm | RStudio | RStudio | RRID:SCR_000432 | |
| Software, algorithm | Enrichr | Enrichr | RRID:SCR_001575 | |
| Other | Operetta CLS HCA System | Operetta | https://www.perkinelmer.com/in/lab-solutions/product/operetta-cls-system-hh16000020 | |
| Other | Vibratome | Leica VT1200 S | https://www.leicabiosystems.com/us/research/vibratomes/leica-vt1200/ | |
| Other | SP5 Confocal Microscope | Leica | N/A | |
| Other | LAS-4000 | FujiFilm | N/A | |
| Other | Automate in vivo manual gravity perfusion system for mice double 140 mL – IV 4140 | Braintree Scientific, Inc | Cat# IV 4140 | |
| Other | Rapiclear 1.47 | SunJin Lab Co. | Cat# NC1660944 | |
| Other | ProLong Gold Antifade Mountant | Invitrogen | Cat# P36934 | |
| Other | Hoechst 33342 | Fisher Scientific | Cat# H3570 | 10 μg/mL |
| Other | Paraformaldehyde Solution 4% in PBS | Fisher Scientific | Cat# J19943-K2 | |
| Other | L-Glutamine | Corning | Cat# 25–005 CI | |
| Other | Penicillin Streptomycin solution | Corning | Cat# 30–002 CI | |
| Other | HEPES buffer | Corning | Cat# 25–060 CI | |
| Other | L929 Cell Conditioned Media (LCCM) | This paper | N/A | |
| Other | Lymphoprep (1.077 A) | STEMCELL | Cat#07801 | |
| Other | Poly Ethylene Glycol (PEG), Bioultra-8000 | Sigma | Cat#89510 | |
| Other | 5 M NaCl | Invitrogen | Cat#AM9759 | |
| Other | Tris Hydrochloride, 1 M solutions (pH 8.0) | Fisher Scientific | Cat#77-86-1 | |
| Other | Ultrapure 0.5 M EDTA pH 8.0 | Invitrogen | Cat#15575–038 | |
| Other | Ambion Nuclease-free Water | Invitrogen | Cat#AM9932 | |
| Other | SpeedBead Magnetic Carboxylate Modified Particles | GE Healthcare | Cat#65152105050250 | |
| Other | DynaMag-96 side | Life Technologies | Cat#12331D | |
| Other | Glycine | Sigma | Cat#50046 | |
| Other | NaOH Solution | Sigma | Cat#72068 | |
| Other | Proteinase K | Ambion | Cat#AM2546 | |
| Other | Middlebrook 7H9 Broth | BD Biosciences | Cat# 271310 | |
| Other | Middlebrook 7H10 Agar | BD Biosciences | Cat# 262710 |
Additional files
-
Supplementary file 1
Cell cycle analysis of B6 and B6.Sst1S BMDMS 24 h after TNF stimulation using scRNA-seq.
- https://cdn.elifesciences.org/articles/106814/elife-106814-supp1-v1.docx
-
Supplementary file 2
Cell cycle analysis of B6 and B6.Sst1S specific BMDM subpopulations 24 h after TNF stimulation using scRNA-seq.
- https://cdn.elifesciences.org/articles/106814/elife-106814-supp2-v1.docx
-
Supplementary file 3
Gene set enrichment analysis of differentially activated pathways in B6 and B6.Sst1S BMDMs 12 h after TNF stimulation.
- https://cdn.elifesciences.org/articles/106814/elife-106814-supp3-v1.docx
-
Supplementary file 4
Transcription factor binding sites analysis of differentially expressed genes in B6 and B6.Sst1S BMDMs 12 h after TNF stimulation.
- https://cdn.elifesciences.org/articles/106814/elife-106814-supp4-v1.docx
-
Supplementary file 5
The list of identified transcription factors associated with differences between activated genes in response to TNF stimulation in B6 and B6.Sst1S BMDMs.
- https://cdn.elifesciences.org/articles/106814/elife-106814-supp5-v1.docx
-
Supplementary file 6
Master regulator analysis of the transcription factors associated with differences between activated genes in response to TNF stimulation in B6 and B6.Sst1S BMDMs.
- https://cdn.elifesciences.org/articles/106814/elife-106814-supp6-v1.docx
-
Supplementary file 7
Lists of differentially expressed genes in Iba1 + cells from pauci- and multi-bacillary lesions of Mtb infected B6.Sst1S mouse lungs.
- https://cdn.elifesciences.org/articles/106814/elife-106814-supp7-v1.xlsx
-
Supplementary file 8
Expression of IFN pathway genes in Iba1 +cells from pauci- and multi-bacillary lesions of Mtb infected B6.Sst1S mouse lungs.
- https://cdn.elifesciences.org/articles/106814/elife-106814-supp8-v1.xlsx
-
Supplementary file 9
Upregulated Myc pathway genes differentially expressed in peripheral blood cells of human TB patients.
- https://cdn.elifesciences.org/articles/106814/elife-106814-supp9-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/106814/elife-106814-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Lipid peroxidation and type I interferon coupling fuels pathogenic macrophage activation causing tuberculosis susceptibility
eLife 14:RP106814.
https://doi.org/10.7554/eLife.106814.2
