Towards a unified molecular mechanism for ligand-dependent activation of NR4A-RXR heterodimers
- Department of Biochemistry, Vanderbilt University, United States
- Department of Integrative Structural and Computational Biology, Scripps Research and The Herbert Wertheim UF Scripps Institute for Biomedical Innovation and Technology, United States
- Department of Molecular Medicine, Scripps Research and The Herbert Wertheim UF Scripps Institute for Biomedical Innovation and Technology, United States
- Center for Structural Biology, Vanderbilt University, United States
- Vanderbilt Institute of Chemical Biology, Vanderbilt University, United States
- Center for Applied AI in Protein Dynamics, Vanderbilt University, United States
Figures
Figure 1
Contribution of RXRγ domains on repressing Nur77-mediated transcription.
(a) General scheme of the cellular transcriptional reporter assay. (b) 3xNBRE-luciferase assay performed in SK-N-BE(2)-C cells. Data are normalized to empty vector control (n=9 replicates), shown as a box and whiskers plot with boundaries of the box representing the 25th percentile and the 75th percentile, and representative of three independent experiments. Statistical testing was performed and p-values were calculated using the Brown-Forsythe and Welch multiple comparisons test of the FL Nur77+RXRγ constructs conditions relative to the FL Nur77 control condition. See Figure 1—source data 1 for data plotted.
-
Figure 1—source data 1
Data underlying the plot in Figure 1b.
- https://cdn.elifesciences.org/articles/106861/elife-106861-fig1-data1-v1.xlsx
Figure 2 with 1 supplement
Ligand profiling for Nur77-RXRγ heterodimer activation and pharmacological RXRγ agonism.
(a) General scheme and data from the Nur77-RXRγ/3xNBRE-luciferase cellular transcriptional reporter assay performed in SK-N-BE(2)-C cells treated with RXR ligand (1 µM) or DMSO (dotted line). Data are normalized to DMSO (n=6 replicates), represent the mean ± s.d., and representative of two independent experiments. See Figure 2—source data 1 for data plotted. (b) General scheme and data from RXRγ LBD time-resolved fluorescence resonance energy transfer (TR-FRET) coactivator peptide interaction assay. TR-FRET ratio measured in the presence of DMSO (dotted line) or compound (2–4 µM). Data are normalized to DMSO control (n=3 replicates), represent the mean ± s.d., representative of two independent experiments. See Figure 2—source data 2 for data plotted. (c) General scheme and data from the RXRγ/3xDR1-luciferase cellular transcriptional reporter assay performed in HEK293T cells treated with compound (1 µM) or DMSO control (dotted line). Data normalized to DMSO (n=6 replicates), represent the mean ± s.d., and representative of two independent experiments. See Figure 2—source data 3 for data plotted. (d,e,f) Correlation plots of (d) RXRγ transcriptional reporter data vs. RXRγ LBD TR-FRET data, (e) Nur77-RXRγ cellular transcription data vs. RXRγ LBD TR-FRET data, and (f) Nur77-RXRγ cellular transcription data vs. RXRγ transcriptional reporter data with calculated Pearson (rp) and Spearman (rs) correlation coefficients. For all comparisons, statistical testing was performed, and p-values were calculated, using the Brown-Forsythe and Welch (a,c) or ordinary one-way ANOVA (b) tests for multiple comparisons with Dunnett corrections relative to DMSO control treated condition. Data and RXR ligand label text in (a,b,c) are colored according to RXR ligand activity as grouped in Figure 2—figure supplement 1.
-
Figure 2—source data 1
Data underlying the plot in Figure 2a.
- https://cdn.elifesciences.org/articles/106861/elife-106861-fig2-data1-v1.xlsx
-
Figure 2—source data 2
Data underlying the plot in Figure 2b.
- https://cdn.elifesciences.org/articles/106861/elife-106861-fig2-data2-v1.xlsx
-
Figure 2—source data 3
Data underlying the plot in Figure 2c.
- https://cdn.elifesciences.org/articles/106861/elife-106861-fig2-data3-v1.xlsx
Figure 2—figure supplement 1
RXR ligand set used in this study.
This figure is reproduced from Figure 2 from Yu et al., 2023.
Figure 3 with 6 supplements
Ligand profiling for Nur77-RXRγ LBD heterodimer dissociation.
(a) 2D [1H,15N]-TROSY HSQC data of 15N-labeled Nur77 LBD heterodimerized with unlabeled RXRγ LBD in the presence of RXR ligands focused on the NMR peak of G544. The upper left shows an overlay of two spectra corresponding to 15N-labeled Nur77 LBD monomer (200 µM; purple) and 15N-labeled Nur77 LBD + unlabeled RXRγ LBD heterodimer (1:2 molar ratio; black) to demonstrate the shift of the G544 peak between Nur77 LBD monomer (m) and heterodimer (hd) forms; solid green and dotted blue arrows denote the complex chemical shift perturbation pattern. RXR ligand label text is colored according to RXR ligand activity as grouped in Figure 2—figure supplement 1. (b) Peak intensity estimated ligand-dependent Nur77 LBD monomer populations from G544 and G376 in the 2D [1H,15N]-TROSY HSQC data (n=1). Data and RXR ligand label text are colored according to RXR ligand activity as grouped in Figure 2—figure supplement 1. See Figure 3—source data 1 for data plotted. (c) Correlation plot of Nur77-RXRγ cellular transcription data vs. NMR estimated Nur77 LBD monomer populations for G544 and G376 with calculated Pearson (rp) and Spearman (rs) correlation coefficients; see Figure 3—figure supplement 3 for G376 2D [1H,15N]-TROSY HSQC data. (d) Analytical size exclusion chromatography (SEC) analysis of Nur77-RXRγ LBD in the presence of RXR ligands (solid colored lines) relative to Nur77 LBD monomer (dotted black line) and Nur77-RXRγ LBD heterodimer (solid black line; n=1).
-
Figure 3—source data 1
Data underlying the plot in Figure 3b.
- https://cdn.elifesciences.org/articles/106861/elife-106861-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Multiangle light scattering (MALS) analysis of the ligand-binding domains (LBDs) of Nurr1, Nur77, RXRα, and RXRγ.
Figure 3—figure supplement 2
Overlay of 2D [1H,15N]-TROSY HSQC data of 15N-labeled Nur77 LBD heterodimerized with unlabeled RXRγ LBD.
Figure 3—figure supplement 3
Additional NMR ligand profiling for Nur77-RXRγ LBD heterodimer dissociation focused on Nur77 residue G376.
(a) 2D [1H,15N]-TROSY HSQC data of 15N-labeled Nur77 LBD heterodimerized with unlabeled RXRγ LBD in the presence of RXR ligands focused on the NMR peak of G376. The upper left shows an overlay of two spectra corresponding to 15N-labeled Nur77 LBD monomer (200 µM; purple) and 15N-labeled Nur77 LBD + unlabeled RXRγ LBD heterodimer (1:2 molar ratio; black) to demonstrate the shift of the G376 peak between Nur77 LBD monomer (m) and heterodimer (hd) forms; solid green and dotted blue arrows denote the complex chemical shift perturbation pattern. RXR ligand label text is colored according to RXR ligand activity as grouped in Figure 2—figure supplement 1. (b) Peak intensity estimated ligand-dependent Nur77 LBD monomer populations from G544 and G376 in the 2D [1H,15N]-TROSY HSQC data. Data are colored according to RXR ligand activity as grouped in Figure 2—figure supplement 1. See Figure 3—source data 1 for data plotted.
Figure 3—figure supplement 4
AlphaFold3 structural model of the Nur77-RXRγ LBD heterodimer used to highlight the locations of G376 and G544 that were analyzed in the NMR analysis.
Figure 3—figure supplement 5
Isothermal titration calorimetry (ITC) analysis of Nur77 LBD titrated into RXRγ LBD at the indicated temperatures.
Figure 3—figure supplement 6
Isothermal titration calorimetry (ITC) analysis of Nur77 LBD titrated into RXRγ LBD performed at 5 °C in the presence of the indicated RXR ligands or DMSO (vehicle control).
Figure 4
Reanalysis of published Nurr1-RXRα correlation data excluding Nurr1-RXRα selective agonists.
(a,b) Correlation plots of our previously reported (a) Nurr1-RXRα cellular transcription data vs. RXRα LBD TR-FRET data and (b) Nurr1-RXRα cellular transcription data vs. RXRα LBD cellular transcription data. Pearson (rp) and Spearman (rs) correlation coefficients calculated with or without the two Nurr1-RXRα specific agonists, BRF110 and HX600 (pink data points). (c–e) Principal component analysis (PCA) 2D biplots (left) and proportion of variance plots (right) for our previously published Nurr1-RXRα ligand profiling data (c) including or (d) excluding the Nurr1-RXRα selective agonists BRF110 and HX600; and the (e) Nur77-RXRγ ligand profiling data from this study. Biplots contain the loadings (data types; blue text and blue circles) and ligand-specific PC scores of the first two PCs. Data and RXR ligand label text is colored according to RXR ligand activity as grouped in Figure 2—figure supplement 1.
Chemical structure 1
Synthesis of 5-allyl-2-phenyl-6-(trifluoromethyl)pyrimidin-4-ol (BRF110).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | BL21(DE3) | Sigma-Aldrich | CMC0014 | Electrocompetent cells |
| Cell line (Homo sapiens) | Human embryonic kidney epithelial | ATCC | CRL-11268 | |
| Cell line (Homo sapiens) | SK-N-BE(2) neuroblastoma | ATCC | CRL-2271; RRID:CVCL_0528 | |
| Antibody | LanthaScreen Elite Tb-anti-His antibody | Thermo Fisher | #PV5895; RRID:AB_3720338 | |
| Chemical compound, drug | BRF110 | This study | Synthesis procedure for BRF110 was described previously as cited in the methods. | |
| Chemical compound, drug | HX600 | Axon Medchem | CAS 172705-89–4 | |
| Chemical compound, drug | 9-cis-Retinoic acid | Cayman Chemicals | CAS 5300-03-8 | |
| Chemical compound, drug | Bexarotene | Cayman Chemicals | CAS 153559-49–0 | |
| Chemical compound, drug | LG100268 | Cayman Chemicals | CAS 153559-76-3 | |
| Chemical compound, drug | CD3254 | Cayman Chemicals | CAS 196961-43-0 | |
| Chemical compound, drug | SR11237 | Tocris Bioscience | CAS 146670-40-8 | |
| Chemical compound, drug | UVI3003 | Cayman Chemicals | CAS 847239-17-2 | |
| Chemical compound, drug | LG100754 | Cayman Chemicals | CAS 180713-37-5 | |
| Chemical compound, drug | IRX4204 | MedChemExpress | CAS 220619-73-8 | |
| Chemical compound, drug | Rhein | Sigma-Aldrich | CAS 478–43-3 | |
| Chemical compound, drug | HX531 | Cayman Chemicals | CAS 188844-34-0 | |
| Chemical compound, drug | Danthron | Sigma-Aldrich | CAS 117-10-2 | |
| Chemical compound, drug | PA452 | Tocris Bioscience | CAS 457657-34-0 | |
| Peptide, recombinant protein | FITC-PGC1α | LifeTein | Amino acid sequence: EAEEPSLLKKLLLAPANTQ, with a N-terminal FITC label and an amidated C-terminus. | |
| Recombinant DNA reagent | Nur77-ligand binding domain (LBD) in pET45b(+) | This study | Bacteria expression plasmid | Residues: 356–598 |
| Recombinant DNA reagent | RXRγ-ligand binding domain (LBD) in pET45b(+) | This study | Bacteria expression plasmid | Residues: 233–459 |
| Recombinant DNA reagent | pET45b(+) | Novagen | 71327–3 | |
| Transfected construct (Photinus pyralis) | 3xNBRE-luciferase plasmid | de Vera et al., 2016 | Sanger sequenced | |
| Transfected construct (Photinus pyralis) | 3xDR1-luciferase plasmid | Hughes et al., 2014 | Mammalian expression plasmid, Sanger sequenced | This is the 3xPPRE-luciferase reporter plasmid in the referenced paper |
| Transfected construct (human) | Full-length human Nur77 in pcDNA3.1 | This study | Mammalian expression plasmid, Sanger sequenced | |
| Transfected construct (human) | Full-length human RXRγ in pcDNA3.1 | This study | Mammalian expression plasmid, Sanger sequenced | |
| Recombinant DNA reagent | pcDNA3.1 empty vector | Thermo Fisher Scientific | V790-20 | |
| Sequence-based reagent | RXRγ-ΔLBD-F | This paper | PCR primer ordered from Sigma | CTACCAGTGGTTAGGAAGACATG |
| Sequence-based reagent | RXRγ-ΔLBD-R | This paper | PCR primer ordered from Sigma | CATGTCTTCCTAACCACTGGTAG |
| Sequence-based reagent | ΔNTD-RXRγ | This paper | gBlock sequences ordered from IDT | gBlock sequence in Supplementary file 1 |
| Sequence-based reagent | RXRγ-hinge-LBD | This paper | gBlock sequences ordered from IDT | gBlock sequence in Supplementary file 1 |
| Gene (human) | Nur77 (NR4A1) | Uniprot | Full length: residues 1–598; LBD: residues 356–598 | |
| Gene (human) | RXRγ (NR2B3) | Uniprot | Full length: residues 1–463; LBD: 226–462 | |
| Sequence-based reagent | Restriction enzymes, ligase for cloning | NEB | BamHI | |
| Sequence-based reagent | RXRγ-ΔNTD | This paper | gBlock for Gibson assembly | CTTAAGCTTGGTACCGAGCTCGATGTGTGCTATCTGTGGAGACAGATCCTCAGGAAAGCACTACGGGGTATACAGTTGTGAAGGCTGCAAAGGGTTCTTCAAGAGGACGATAAGGAAGGACCTCATCTACACGTGTCGGGATAATAAAGACTGCCTCATTGACAAGCGTCAGCGCAACCGCTGCCAGTACTGTCGCTATCAGAAGTGCCTTGTCATGGGCATGAAGAGGGAAGCTGTGCAAGAAGAAAGACAGAGGAGCCGAGAGCGAGCTGAGAGTGAGGCAGAATGTGCTACCAGTGGTCATGAAGACATGCCTGTGGAGAGGATTCTAGAAGCTGAACTTGCTGTTGAACCAAAGACAGAATCCTATGGTGACATGAATATGGAGAACTCGACAAATGACCCTGTTACCAACATATGTCATGCTGCTGACAAGCAGCTTTTCACCCTCGTTGAATGGGCCAAGCGTATTCCCCACTTCTCTGACCTCACCTTGGAGGACCAGGTCATTTTGCTTCGGGCAGGGTGGAATGAATTGCTGATTGCCTCTTTCTCCCACCGCTCAGTTTCCGTGCAGGATGGCATCCTTCTGGCCACGGGTTTACATGTCCACCGGAGCAGTGCCCACAGTGCTGGGGTCGGCTCCATCTTTGACAGAGTCCTAACTGAGCTGGTTTCCAAAATGAAAGACATGCAGATGGACAAGTCGGAACTGGGATGCCTGCGAGCCATTGTACTCTTTAACCCAGATGCCAAGGGCCTGTCCAACCCCTCTGAGGTGGAGACTCTGCGAGAGAAGGTTTATGCCACCCTTGAGGCCTACACCAAGCAGAAGTATCCGGAACAGCCAGGCAGGTTTGCCAAGCTGCTGCTGCGCCTCCCAGCTCTGCGTTCCATTGGCTTGAAATGCCTGGAGCACCTCTTCTTCTTCAAGCTCATCGGGGACACCCCCATTGACACCTTCCTCATGGAGATGTTGGAGACCCCGCTGCAGATCACCTGAGATCCACTAGTCCAGTGTGG |
| Sequence-based reagent | RXRγ-hinge-LBD | This paper | gBlock for Gibson assembly | CTTAAGCTTGGTACCGAGCTCGATGAAGAGGGAAGCTGTGCAAGAAGAAAGACAGAGGAGCCGAGAGCGAGCTGAGAGTGAGGCAGAATGTGCTACCAGTGGTCATGAAGACATGCCTGTGGAGAGGATTCTAGAAGCTGAACTTGCTGTTGAACCAAAGACAGAATCCTATGGTGACATGAATATGGAGAACTCGACAAATGACCCTGTTACCAACATATGTCATGCTGCTGACAAGCAGCTTTTCACCCTCGTTGAATGGGCCAAGCGTATTCCCCACTTCTCTGACCTCACCTTGGAGGACCAGGTCATTTTGCTTCGGGCAGGGTGGAATGAATTGCTGATTGCCTCTTTCTCCCACCGCTCAGTTTCCGTGCAGGATGGCATCCTTCTGGCCACGGGTTTACATGTCCACCGGAGCAGTGCCCACAGTGCTGGGGTCGGCTCCATCTTTGACAGAGTCCTAACTGAGCTGGTTTCCAAAATGAAAGACATGCAGATGGACAAGTCGGAACTGGGATGCCTGCGAGCCATTGTACTCTTTAACCCAGATGCCAAGGGCCTGTCCAACCCCTCTGAGGTGGAGACTCTGCGAGAGAAGGTTTATGCCACCCTTGAGGCCTACACCAAGCAGAAGTATCCGGAACAGCCAGGCAGGTTTGCCAAGCTGCTGCTGCGCCTCCCAGCTCTGCGTTCCATTGGCTTGAAATGCCTGGAGCACCTCTTCTTCTTCAAGCTCATCGGGGACACCCCCATTGACACCTTCCTCATGGAGATGTTGGAGACCCCGCTGCAGATCACCTGAGATCCACTAGTCCAGTGTGG |
| Commercial assay or kit | Gibson assembly | NBE | E2611L | |
| Commercial assay or kit | Britelite plus Reporter Gene Assay System | Perkin Elmer | 6066769 | |
| Software, algorithm | NITPIC software | Keller et al., 2012 | Baseline calculation, curve integration | |
| Software, algorithm | SEDPHAT | Brautigam et al., 2016 | Estimation of binding affinity and thermodynamic parameter measurements | |
| Software, algorithm | GUSSI | Brautigam, 2015 | Plot ITC figures | |
| Other | NMR chemical shift assignment of Nur77 LBD | This paper | BMRB52973; https://doi.org/10.13018/BMR52973 | Published NMR peak assignment from Biological Magnetic Resonance Data Bank |
| Software, algorithm | NMRFx | Norris et al., 2016 | NMR data process and analysis | |
| Software, algorithm | Pearsons and Spearman correlation analysis | GraphPad Prism | Correlation analysis | |
| Software, algorithm | Principal Component Analysis (PCA); | GraphPad Prism | Correlation analysis | |
| Software, algorithm | ANOVA multiple comparison test | GraphPad Prism | Statistical testing |
Additional files
-
Supplementary file 1
gBlock sequences used to generate RXRγ truncation constructs.
- https://cdn.elifesciences.org/articles/106861/elife-106861-supp1-v1.docx
-
Supplementary file 2
AlphaFold3 model of the Nur77-RXRγ LBD.
- https://cdn.elifesciences.org/articles/106861/elife-106861-supp2-v1.zip
-
MDAR checklist
- https://cdn.elifesciences.org/articles/106861/elife-106861-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Towards a unified molecular mechanism for ligand-dependent activation of NR4A-RXR heterodimers
eLife 14:RP106861.
https://doi.org/10.7554/eLife.106861.3
