Activity-dependent CO2 production in the axon triggers opening of Connexin32 in the Schwann cell paranode
Figures
Hypothesized connexin32 (Cx32)-mediated CO2 signaling cascade in peripheral myelin.
Three fingers of a myelin paranode have been used for illustrative purposes. Restoration of transmembrane ionic gradients following action potential propagation via the actions of Na+/K+ ATPases incurs a metabolic cost and increases production of ATP and CO2. AQP1, permeable to CO2, provides a pathway for CO2 to leave the node and enter the paranode and bind to Cx32 on the intracellular loop. This triggers opening of Cx32 and release ATP. Carbonic anhydrase (CA) catalyzes the combination of CO2 and H2O and ultimately the production of HCO3- and H+ ions and effectively competes with Cx32 for CO2.
AQP1 localizes to both the Schwann cell paranode and also the axonal node.
(A, B) Representative confocal SIM images from a single optical plane showing the localization of Caspr, connexin32 (Cx32), and AQP1 in an isolated mouse sciatic nerve. Arrowheads indicate the node. Scale bars, 10 μm. (C) Boxplots showing degree of colocalization between Cx32 and AQP1 at the node/paranode. Control measurements (to right of dashed line) used these same images with one channel flipped 90° and the same thresholds as when measuring colocalization. Kruskal-Wallis ANOVA p<0.0001.
-
Figure 2—source data 1
Source data for panel C.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig2-data1-v1.xlsx
Markers for the node, paranode, and juxtaparanode in the isolated mouse sciatic nerve.
(A) Location of the axonal node (KCNQ2) and Schwann cell paranode (Caspr) within an isolated mouse sciatic nerve fibre. KCNA2 is expressed in the outer myelin layer. Arrowheads indicate the node. Scale bar = 15 µm. Confocal LSM image, single optical plane. (B) Schematic indicating the same locations within an isolated nerve fibre.
Connexin32 (Cx32) colocalizes with mitochondria in the Schwann cell paranode, alongside SFXN1.
(A, B) Representative SIM images in single optical plane showing the localization of Cx32, CytC, and SFXN1 in an isolated mouse sciatic nerve. Arrowheads depict the node. Scale bars – 10 μm. (C) Boxplots showing degree of colocalization between Cx32 and CytC and SFXN1 and CytC. M1 is the proportion of Cx32 (or SFXN1) that colocalizes with CytC and M2 is the reverse proportion of CytC that colocalizes with Cx32 (or SFXN1). Control measurements (to right of dotted line for each pair) used these same images with one channel flipped 90° and the same thresholds as when measuring colocalization. Kruskal Wallis ANOVA: Cx32 vs CytC, p=0.0001; SFXN1 vs CytC, p<0.0001.
-
Figure 2—figure supplement 2—source data 1
Source data for panel C.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig2-figsupp2-data1-v1.xlsx
The localization of AQP1 in relation to mitochondria, CytC, in isolated mouse sciatic nerve.
Representative SIM images in single optical plane showing the localization of AQP1 and CytC in an isolated mouse sciatic nerve. Arrows indicate the node. Scale bar – 10 μm.
CAII localizes to myelinating Schwann cells, in particular to the axonal node and the Schwann cell paranode.
(A and B) Representative confocal LSM images in single optical plane showing the localization of CAII and Cx32 in an isolated mouse sciatic nerve. Arrowheads indicate the node. Intense CAII staining, denoted by a white asterisk (*) is present in non-myelinated fibres. Scale bar applies to A and B: 10 μm.
A membrane impermeable dye, FITC, loads into Schwann cell paranodes in a CO2 dependent manner through a hemichannel.
(A) Representative images showing the FITC loading into mouse sciatic nerve bundles. Arrowheads indicate the node. Little FITC loading occurs in response to control (35 mmHg, 10 min) aCSF. FITC loading was greatly increased by 70 mmHg aCSF (10 min) and application of 100 μM FCCP. FITC loading in 70 mmHg aCSF was blocked by carbenoxolone (CBX) but not the TRPA1 antagonist HC030031. (B) Boxplot showing intensity of FITC fluorescence under the different conditions. Each point represents a separate region of interest (ROI) from five different nerves for each condition. Scale bar – 10 μm.
-
Figure 4—source data 1
Source data for panel B.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig4-data1-v1.xlsx
Cx31.3 does not open in response to hypercapnia.
(A) Representative images of GRABATP fluorescence, encoded by a 16 color LUT in Cx31.3 transfected HeLa cells in response to control (35 mmHg), hypercapnic (70 mmHg), and depolarizing (50 mM KCl) aCSF. Scale bar 20 μm. (B) Top, traces showing the normalized GRABATP fluorescence for cells transfected only with GRABATP. Bottom, traces from the cells transfected with both Cx31.3 and GRABATP as shown in (A). (C) Summary statistic box plots showing the [ATP] release, calculated as a ratio from the normalized fluorescence change evoked by a certain solution or stimuli and the fluorescence change evoked by 3 µM ATP. Cells expressing only GRABATP do not exhibit changes in fluorescence to 70 mmHg or 50 mM KCl aCSF. Each data point represents a cell, with all cells coming from at least three transfections.
-
Figure 4—figure supplement 1—source data 1
Source data for panel C.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig4-figsupp1-data1-v1.xlsx
Activity dependent loading of FITC into Schwann cell paranodes.
(A) Representative images showing the FITC loading into mouse sciatic nerve bundles in response to different lengths of stimulation (30 Hz). Arrows indicate the paranode. (B) An isolated mouse sciatic nerve fibre loaded with the membrane impermeable dye FITC (30 Hz, 5 min) and counterstained with Caspr, an axonal membrane protein which is expressed only in the paranodal region. White arrows indicate the paranode of interest. Note the lack of loading into the axon. Scale bars – 15 μm.
Activity dependent loading of FITC is sensitive to manipulation of carbonic anhydrase activity.
(A) Representative images showing the FITC loading into mouse sciatic nerve bundles in response to 1 min of electrical stimulation in the absence (left) or presence (right) of the carbonic anhydrase inhibitor, acetazolamide. Arrows indicate the position of paranodes. Brightfield inset shows the presence of the nerve fibre and the arrowhead in the fluorescence image indicates its position. (B) Summary plot showing how the pixel intensity of Schwann cell paranodes, and, therefore, FITC loading, vary in response to stimulus duration and the presence of acetazolamide (each point mean ± SD). (C) Representative images showing the FITC loading into mouse sciatic nerve bundles in response to 5 min of stimulation in the absence (left) or presence (right) of the carbonic anhydrase enhancer, L-Phenylalanine. Brightfield inset shows the presence of the nerve fibre and the arrowhead in the fluorescence image indicates its position. (D) Boxplot showing the effect L-Phenylalanine had on FITC loading into mouse Schwann cell paranodes. Scale bars – 15 µm. Each point represents a separate ROI from five different nerves. L-Phe vs control MW test: p<0.0001.
-
Figure 6—source data 1
Source data for panels B and D.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig6-data1-v1.xlsx
Acetazolamide and L-Phe do not alter the compound action potential (CAP).
(A) Current-voltage input-output curves for the CAP, comprising data from all nerves subjected to either 100 µM acetazolamide or 1 mM L-Phenylalanine. Curves were produced before application of the respective compound (green circles), at the end of the pre-incubation of the compound (red circles) and at the end of dye loading (black circles) to show that the compounds had no effect on the amplitude of the CAP. N=5 nerves for each condition. Insets show the averaged CAP during incubation with the compound. (B) Boxplots showing the half maximum CAP amplitude for each respective condition and compounds laid out in (A). Kruskal-Wallis ANOVA: Acetazolamide, p=0.4441; L-Phenylalanine, p=0.9917.
-
Figure 6—figure supplement 1—source data 1
Source data for panels A and B.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig6-figsupp1-data1-v1.xlsx
Activity dependent loading of the FITC is reduced by inhibition of the Krebs cycle.
(A) Representative images showing the FITC loading into mouse sciatic nerve bundles in response to 5 min of 30 Hz stimulation in the absence (left) or presence (right) of the 50 µM H2O2 which blocks aconitase and the Krebs cycle. Brightfield inset shows the presence of the nerve fibre and the arrows in the fluorescence images indicate position of paranodes. Scale bar – 15 μm. (B) Boxplot showing the effect 50 µM H2O2 had on FITC loading into mouse Schwann cell paranodes. Each point represents a separate region of interest (ROI) from five different nerves. H2O2 vs control MW test: p<0.0001.
-
Figure 7—source data 1
Source data for panel B.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig7-data1-v1.xlsx
50 µM H2O2 does not alter the compound action potential (CAP).
(A) Current voltage input-output curves for the CAP comprising data from all nerves subjected to 50 µM H2O2. Curves were produced before application of H2O2 (green circles), at the end of the pre-incubation (red circles) and at the end of dye loading (black circles) to show that H2O2 had no effect on the amplitude of the CAP. N=5 nerves for each condition. Inset shows the averaged CAP during incubation with the compound. (B) Boxplots showing the half maximum CAP amplitude for each respective condition in (A). Kruskal-Wallis ANOVA: p=0.6808.
-
Figure 7—figure supplement 1—source data 1
Source data for panels A and B.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig7-figsupp1-data1-v1.xlsx
Activity dependent loading of the FITC is reduced by inhibition of AQP1.
(A) Representative images showing the FITC loading into mouse sciatic nerve bundles in response to 5 min of 30 Hz stimulation in the absence (left) or presence (right) of the AQP1 blocker TC AQP1-1. Brightfield inset shows the presence of the nerve fibre and the arrows in the fluorescence images indicate position of paranodes. Scale bar – 15 μm. (B) Boxplot showing the effect TC AQP1-1 had on FITC loading into mouse Schwann cell paranodes. Each point represents a separate region of interest (ROI) from five different nerves. TC AQP1-1 vs control MW U test: p<0.0001.
-
Figure 8—source data 1
Source data for panel B.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig8-data1-v1.xlsx
TC AQP1-1 does not alter the compound action potential (CAP).
(A) Current voltage input-output curves for the CAP comprising data from all nerves subjected to 80 µM TC AQP1-1. Curves were produced before application of the TC AQP1-1 (green circles), at the end of the pre-incubation with TC AQP1-1 (red circles) and at the end of dye loading (black circles) to show that TC AQP 1–1 had no effect on the amplitude of the CAP. N=5 nerves for each condition. Inset shows averaged CAP during incubation with TC AQP1-1. (B) Boxplots showing the half maximum CAP amplitude for each respective condition in (A). Kruskal-Wallis ANOVA: p=0.2516.
-
Figure 8—figure supplement 1—source data 1
Source data for panels A and B.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig8-figsupp1-data1-v1.xlsx
GDPβS blocks ATP-induced increases in paranodal Ca22+ but does not alter activity dependent FITC loading into the paranode.
(A) Recording of ATP-induced increase in intracellular Ca2+ at the paranode (blue bar). When ATP was applied after 100 µM GDPβS (red bar), no increase in Fluo4 fluorescence was seen. (B) Images of Fluo4 fluorescence showing effect of ATP with and without GDPβS (same recording as A). Scale bar = 5 µm. (C) Boxplots summarizing that GDPβS blocks the change in fluorescence induced by ATP. Each point is a single paranode from a single nerve. (D) Images of FITC loading into sciatic nerve induced by 5 min electrical stimulation with and without 100 µM GDPβS. Arrows point to paranode, insets show corresponding brightfield images. Scale bar 10 µm. (E) Boxplots showing that GDPβS has no effect on activity dependent (30 Hz stimulation) FITC loading. Each point represents a separate region of interest (ROI) from five different nerves.
-
Figure 8—figure supplement 2—source data 1
Source data for panels C and E.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig8-figsupp2-data1-v1.xlsx
NH4Cl does not alter FITC loading into the paranode.
(A) Images of FITC fluorescence in isolated nerves stimulated for 5 min at 30 Hz, in the control (35 mmHg) and after treatment with 100 µM NH4Cl. Arrows indicate paranode. Scale bar 15 µm. (B) Summary graph of FITC fluorescence in nerves in response to 5 min stimulation in each condition. Each point represents a separate region of interest (ROI) from five different nerves.
-
Figure 8—figure supplement 3—source data 1
Source data for panel B.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig8-figsupp3-data1-v1.xlsx
Effects of acetazolamide and NH4Cl on the intracellular pH of Schwann cell paranodes.
(A) Representative trace showing the normalized BCECF fluorescence ΔF/F0 in response to changing pH to 6.5 and 7.15, 100 μM acetazolamide (AZ), and 100 μM NH4Cl. (B) Representative images for the trace for the BCECF fluorescence in each condition. Scale bar = 5 µm. (C) Summary graph of effect of AZ and NH4Cl on intracellular pH. Each point represents a nerve.
-
Figure 8—figure supplement 4—source data 1
Source data for panel C.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig8-figsupp4-data1-v1.xlsx
Activity-dependent dye loading into Schwann cells depends on CO2 binding to connexin32 (Cx32).
(A) Images of single axons dissected from a sciatic nerve transduced with AAV-Mpz-Cx32DN-IRES-mCherry. Axons that do not express Cx32DN do not exhibit mCherry fluorescence and show robust dye loading to 15 Hz stimulation. By contrast, axons that express mCherry are Cx32DN+ve and do not show dye loading during stimulation. Scale bar 15 µm. (B) Summary graph showing the pixel intensity of axons that are Cx32DN+ve versus the control Cx32DN-ve. MW p<0.0001, each circle an individual paranode from n=5 nerves.
-
Figure 9—source data 1
Source data for panel B.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig9-data1-v1.xlsx
Cx32DN coassembles with Cx32WT.
(A) Images of Clover and mRuby2 fluorescence before and after bleaching of the mRuby2 acceptor. The Clover fluorescence becomes brighter following bleaching for the Cx32DN and Cx32WT or Cx32WT and Cx32WT pairs but not for the Cx32WT and Cx43WT pair. (B) Values for the FRET efficiency and a comparison of bleaching efficiency for the different pairings.
-
Figure 9—figure supplement 1—source data 1
Source data for panel B.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig9-figsupp1-data1-v1.xlsx
Cx32DN coassembles with Cx32WT.
The dependence of the FRET efficiency (E) on the acceptor level (A) and donor to acceptor (D–A) ratio. A negative correlation between E and D-A ratio indicates coassembly into hexamers as opposed to random association in the membrane.
-
Figure 9—figure supplement 2—source data 1
Source data.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig9-figsupp2-data1-v1.xlsx
Cx32DN forms functional gap junctions.
(A) Images of cells expressing connexin32DN (Cx32DN) under brightfield (BF), the mCherry tag (red), and NBDG, a fluorescent glucose analogue (green). NBDG is present in the patch pipette and readily diffuses between the cells. Scale bar 20 µm. (B) Changes in NBDG fluorescence over time in the Donor and Recipient cells showing the ready transfer of NBDG via Cx32DN gap junction channels (n=8).
-
Figure 9—figure supplement 3—source data 1
Source data.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig9-figsupp3-data1-v1.xlsx
Simple model of CO2 signaling at the paranode reproduces experimentally observed patterns of activity-dependent FITC loading.
(A) Adaptation of the Matsuda et al model to incorporate CO2 production and metabolism via CAII. Action potentials provide the input to the model as activity variable X, which determines variables Y and Z, which determine ATP production and consumption. CO2 is proportional to ATP production, via the rate constant α. Code for the model is provided in the MATLAB files Source code 1 and Source code 2. (B) Incorporation of the modified Matsuda et al model into a single cell that possesses a K+ leak channel and connexin32 (Cx32) and represents the paranode, albeit including the nodal mitochondria. (C) Outputs from the model to show how the change in [CO2] and the consequent FITC loading evoked by two different durations of stimulation (1 and 5 min) varies with the Vmax of CAII. Reduction from the control value (15 mM/s) to 1 mM/s simulates the effect of acetazolamide, whereas an increase of Vmax to 30 mM/s simulates application of L-Phe. (D) A summary graph showing how FITC loading varies with stimulus duration with the three different values for the VMax of CAII.
Inhibition of carbonic anhydrase increases loading of FITC into paranodes and outer myelin in the absence of electrical stimulation.
The images show the FITC fluorescence in the control and presence of 100 µM acetazolamide (AZ). The boxplot shows quantification of the fluorescence and that the increase in background fluorescence is significant (control vs AZ, MW test, p<0.0001). Each point represents a separate region of interest (ROI) from five different nerves.
-
Figure 10—figure supplement 1—source data 1
Source data.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig10-figsupp1-data1-v1.xlsx
CO2 dependent Ca22+ influxes into Schwann cells are hemichannel dependent.
(A) Representative trace showing change in normalized Fluo4 fluorescence in response to 70 mmHg aCSF (red bar), 35 mmHg aCSF with the non-specific hemichannel blocker carbenoxolone (100 µM, orange bar) and 70 mmHg aCSF plus 100 µM carbenoxolone (blue bar). (B) Representative images showing changes Fluo4 fluorescence in response to hypercapnic aCSF. The circles in the first panel show the measurement region of interests (ROIs) drawn around the paranodes. Scale bar = 10 µm. (C) Boxplot showing the change in normalized fluorescence (ΔF/F0) in Fluo4 loaded Schwann cell paranodes evoked by 70 mmHg aCSF in the presence and absence of 100 µM carbenoxolone (CBX). Each datapoint consists of a paranode, with all the data collected from four sciatic nerves. Control vs CBX, MW test, p=0.0087.
-
Figure 11—source data 1
Source data for panel C.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig11-data1-v1.xlsx
Activity-dependent increase of intracellular Ca22+ in Schwann cell paranodes.
(A) Superimposed brightfield (BF) and fluorescence image of GCaMP8 transduced nerve. To show expression at the paranode. (B) Representative GCaMP8 traces showing change in normalized fluorescence in response to 15 Hz electrical stimulation (red bar) in the presence of acetazolamide (AZ, green bar) or TC-AQP1-1 (purple bar). (C) The fluorescence images show before (Baseline), during stimulation of the nerve (15 Hz), during stimulation in presence of AZ (15+Az) and stimulation in the presence of TC AQP1-1 (15+TC AQP1-1). Scale bar = 5 µm; black dashed line indicates the shape of an individual fibre, white arrow indicates hotspot of GCaMP8 fluorescence at the paranode. (D) Boxplot showing the change in normalized GCaMP8. fluorescence (ΔF/F0) evoked Schwann cell paranodes in response to 15 Hz electrical stimulation in the control, with AZ and with TC AQP1-1. Kruskal-Wallis ANOVA, p<0.0001. Pairwise MW comparisons: control vs AZ, p=0.0142; control vs TC AQP1-1, p<0.0001. Each datapoint consists of a paranode, with all the data collected from four sciatic nerves.
-
Figure 12—source data 1
Source data for panel D.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig12-data1-v1.xlsx
Activity-dependent Ca22+ influxes into Schwann cell paranodes are dependent on CO2.
(A) Representative trace showing change in normalized Fluo4 fluorescence in response to 15 Hz electrical stimulation (red bar) in the presence of 100 µM acetazolamide (blue bar), in control aCSF (green bar), or in the presence of 80 µM TC AQP1-1 (purple bar). (B) Boxplot showing the change in normalized fluorescence (ΔF/F0) evoked in Fluo4 loaded Schwann cell paranodes in response to high frequency electrical stimulation in each condition. Each datapoint consists of a paranode, with all the data collected from four sciatic nerves. Kruskal-Wallis ANOVA, p<0.0001. Pairwise MW comparisons: control vs AZ, p<0.001; control vs TC AQP1-1, p<0.001. (C) Brightfield and fluorescence images showing the activity-dependent Ca2+ increase in a paranode in the presence of acetazolamide (AZ) and the lack of an activity-dependent increase in Ca2+ in the presence of TC AQP1-1.
-
Figure 12—figure supplement 1—source data 1
Source data for panel B.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig12-figsupp1-data1-v1.xlsx
CO2 dependent slowing of conduction velocity following high frequency stimulation.
The compound action potential (CAP) was evoked at 1 Hz and then 10 mins of 30 Hz stimulation was given prior to remeasuring the CAP at 1 Hz stimulation frequency. Representative CAPs from mouse sciatic nerve prior to high frequency stimulation (Black trace), and after (Blue trace) for WT nerves: (A) in the absence of any compound; (B) with 100 µM acetazolamide; (C) with 1 mM L-Phenylalanine; (D) with 80 µM TC AQP1-1. (E) Boxplot showing the change in latency (time to peak of CAP) before and after high frequency stimulation for Control, Acetazolamide (AZ), L-Phe, and TC AQP1-1. Kruskal-Wallis ANOVA p=0.0016. Pairwise MW tests: control vs AZ, p=0.0317; control vs L-Phe, p=0.0159; control vs TC AQP1-1, p=0.0079.
-
Figure 13—source data 1
Source data for panel E.
- https://cdn.elifesciences.org/articles/107085/elife-107085-fig13-data1-v1.xlsx
Model of the compound action potential (CAP) to show how changing conduction velocity alters the rise time, time to peak, and peak amplitude of the CAP.
(A) Shows the profile of an individual action potential (AP, top), the distribution of conduction delays based on the distribution of diameters of fibres in the sciatic nerve (middle), and the CAP arising from summation of 2000 individual APs occurring with different conduction delays (bottom, light blue line) and three different slowing factors. (B) Shows how the rise time, peak time and amplitude vary with the slowing factor. To mimic slowing, every conduction delay is multiplied by the slowing factor, when this is 1.0, no slowing occurs, and when, for example, it is 1.2 each conduction delay is slowed by 20%. MATLAB code for the model is provided in Source code 3.
Tables
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (human) | HeLa DH | UK Health Security Agency | RRID:CVCL_2483 | |
| Chemical compound, drug | DMEM | Merck Life Sciences UK Ltd | CAT# D6046 | |
| Chemical compound, drug | Fetal Bovine Serum | Labtech.com | CAT#FCS-SA | |
| Chemical compound, drug | NEBuilder HiFi DNA assembly Master Mix | New England Biolabs | CAT#FCS-SA | |
| Chemical compound, drug | PEI Prime linear polyethylenimine | Merck Life Sciences UK Ltd | CAT#919012 | |
| Chemical compound, drug | EZ-PCR Mycoplasma detection kit | Sartorius | CAT#20-700-20 | |
| Chemical compound, drug | FITC | Merck Life Sciences UK Ltd | CAT #46950 | |
| Chemical compound, drug | FCCP | APExBIO | CAT #B5004 | |
| Chemical compound, drug | L-Phenylalanine | Merck Life Sciences UK Ltd | CAT #P2126 | |
| Chemical compound, drug | TC AQP1-1 | Tocris | CAT #5412 | |
| Chemical compound, drug | GDPβS | Merck Life Sciences UK Ltd | CAT #G7637 | |
| Chemical compound, drug | ATP | Merck Life Sciences UK Ltd | CAT #A26209 | |
| Chemical compound, drug | Paraformaldehyde | Merck Life Sciences UK Ltd | CAT # 158127 | |
| Chemical compound, drug | Bovine Serum Albumin | Merck Life Sciences UK Ltd | CAT #A7030 | |
| Chemical compound, drug | Fluorshield mounting medium with DAPI | Merck Life Sciences UK Ltd | CAT# F6057 | |
| Chemical compound, drug | Acetazolamide | Merck Life Sciences UK Ltd | CAT# A6011 | |
| Chemical compound, drug | Ammonium chloride | Invitrogen | CAT# A15000.0B | |
| Chemical compound, drug | BCECF-AM | Invitrogen | CAT #B1170 | |
| Chemical compound, drug | Fluo4-AM | Invitrogen | CAT #F14201 | |
| Chemical compound, drug | DMSO | Merck Life Sciences UK Ltd | CAT #D5879 | |
| Chemical compound, drug | Pluronic F-127 | Thermo Fisher Scientific | CAT# P3000MP | |
| Chemical compound, drug | Sylgard–184 | Scientific Lab Supplied Ltd | CAT# 63416.5 S | |
| Sequence-based reagent | Cx31.3 (Gjc3) Forward | IDT | PCR primers | TTTGGCAAAGAATTCGGTACCATGTGTGGCAGGTTCCTGC |
| Sequence-based reagent | Cx31.3 (Gjc3) Reverse | IDT | PCR primers | CCGGTGGATCCCGGGCCCGCGGTACCCCGGCATCTCTGGGTCCAACTG |
| Sequence-based reagent | Cx32 (Gjb1) Forward (for Clover) | IDT | PCR primers | TTTGGCAAAGAATTCGGTACCATGAACTGGACAGGTTTGTACACCTTGCTC |
| Sequence-based reagent | Cx32 (Gjb1) Reverse (for Clover) | IDT | PCR primers | CCATGAATTCGCAGGCCGAGCAGCGGTC |
| Sequence-based reagent | EF Clover Forward | IDT | PCR primers | CTCGGCCTGCGAATTCATGGTGAGCAAG |
| Sequence-based reagent | EF Clover Reverse | IDT | PCR primers | CTTGATACTTACCTGCGGCCTCGAGCTAGCATTTAGGTGACAC |
| Sequence-based reagent | Cx32 (Gjb1) Forward (for Ruby) | IDT | PCR primers | TTTGGCAAAGAATTCGGTACCATGAACTGGACAGGTTTGTACACCTTGCTC |
| Sequence-based reagent | Cx32 (Gjb1) Reverse (for Ruby) | IDT | PCR primers | CCATGAATTCGCAGGCCGAGCAGCGGTC |
| Sequence-based reagent | EF Ruby Forward | IDT | PCR primers | CTCGGCCTGCGAATTCATGGTGTCTAAGG |
| Sequence-based reagent | EF Ruby Reverse | IDT | PCR primers | CTTGATACTTACCTGCGGCCTCGAGTTACTTGTACAGCTCGTC |
| Sequence-based reagent | Cx43 (Gja1) Forward (for Clover) | IDT | PCR primers | TTTGGCAAAGAATTCGGTACCGCGGGCCCGGGATCCACC |
| Sequence-based reagent | Cx43 (Gja1) Reverse (for Clover) | IDT | PCR primers | CCATGAATTCGATCTCCAGGTCATCAGGCCGAGG |
| Sequence-based reagent | EF Clover Forward | IDT | PCR primers | CCTGGAGATCGAATTCATGGTGAGCAAG |
| Sequence-based reagent | EF Clover Reverse | IDT | PCR primers | CTTGATACTTACCTGCGGCCTCGAGCTAGCATTTAGGTGACAC |
| Sequence-based reagent | Cx43 (Gja1) Forward (for Ruby) | IDT | PCR primers | TTTGGCAAAGAATTCGGTACCGCGGGCCCGGGATCCACC |
| Sequence-based reagent | Cx43 (Gja1) Reverse (for Ruby) | IDT | PCR primers | CCATGAATTCGATCTCCAGGTCATCAGGCCGAGG |
| Sequence-based reagent | EF Ruby Forward | IDT | PCR primers | CCTGGAGATCGAATTCATGGTGTCTAAGG |
| Sequence-based reagent | EF Ruby Reverse | IDT | PCR primers | CTTGATACTTACCTGCGGCCTCGAGTTACTTGTACAGCTCGTC |
| Recombinant DNA reagent | pDisplay-GRAB_ATP1.0 | Addgene | Plasmid#167582; RRID:Addgene167582 | |
| Recombinant DNA reagent | AAV9-MPZmini-LCK-GCaMP8 | BrainVTA | This paper | |
| Recombinant DNA reagent | AAV9-MPZmini-dnCx32-IRES-mCherry | BrainVTA | This paper | |
| Software, algorithm | GraphPad Prism | https://www.graphpad.com/features | RRID:SCR_002798 | |
| Software, algorithm | ImageJ/FIJI | https://imagej.net/software/fiji/downloads | RRID:SCR_002285 |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/107085/elife-107085-mdarchecklist1-v1.docx
-
Source code 1
MATLAB code for model of CO2 signaling at the node-paranode.
- https://cdn.elifesciences.org/articles/107085/elife-107085-code1-v1.zip
-
Source code 2
MATLAB code for command line func on to run the CO2 signaling model.
- https://cdn.elifesciences.org/articles/107085/elife-107085-code2-v1.zip
-
Source code 3
MATLAB code for modeling the effect of conduc on velocity slowing on the shape of the compound action potential (CAP).
- https://cdn.elifesciences.org/articles/107085/elife-107085-code3-v1.zip