Research Article

Extrusion-modulated DnaA activity oscillations coordinate DNA replication with biomass growth

Key Laboratory of Quantitative Synthetic Biology, Shenzhen Institute of Synthetic Biology, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, China
University of Chinese Academy of Sciences, China
NUS Synthetic Biology for Clinical and Technological Innovation and Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore; National Centre for Engineering Biology, Singapore
Faculty of Natural Sciences, Ben-Gurion University of the Negev, Israel
Department of Physics & Department of Molecular Biology, University of California at San Diego, United States

Nov 18, 2025

https://doi.org/10.7554/eLife.107214.3

Open access
Copyright information

Figures
Tables
Additional files

9 figures, 6 tables and 1 additional file

Figures

Figure 1

Download asset Open asset

Coordination of biomass growth and DNA replication through replication initiation and DnaA activity oscillations.

(A) Schematic representation of the discrepancy between biomass accumulation and DNA replication. While biomass grows exponentially, DNA synthesis progresses linearly, necessitating replication initiation events to maintain coordination. (B) Mechanistic model for biomass-DNA coordination in bacteria. A molecular sensor detects deviations between cell mass and DNA content, transmitting this information to regulatory controllers that compensate by either increasing DNA replication or restricting biomass accumulation. (C) Illustration of cyclic DnaA activity oscillations aligning with replication initiation to ensure precise cell cycle control.

Figure 2

Download asset Open asset

Construction and characterization of the *dnaA*-titratable strain.

(A) Schematic of the *dnaA*-titratable strain. A *dnaA* gene under the control of the P_tet promoter was inserted near *oriC* and regulated by a P_tet-*tetR* feedback loop integrated at the *intS* locus, enabling fine-tuned expression control. The native *dnaA* gene was replaced with a kanamycin resistance cassette (*kan^r*). (B–F) Characterization of *dnaA*-titratable cells (circle) and wild-type MG1655 cells (triangle) grown in rich defined medium with glycerol (M6) under varying aTc concentrations. Measured parameters include: (B) *dnaA* mRNA levels; (C) growth rate; (D) population-averaged cellular mass; (E) population-averaged *oriC* numbers; (F) initiation mass (red, left axis); and the initiation to division period (C+D) (blue, right axis). The *dnaA* mRNA levels were normalized to that in wild-type cells. Cellular mass was determined by OD₆₀₀ divided by cell number concentration. *oriC* copy numbers were measured using a run-out assay, and initiation mass was calculated as the ratio of cellular mass to *oriC* numbers. Data represent means ± SD (n = 5 biological replicates). (G) Relationship between relative initiation mass and relative *dnaA* mRNA levels, compared with predictions from the initiation titration model (blue line) and the switch model (purple line). The relative *dnaA* mRNA levels in experiments are compared to relative DnaA expression rate $α_{A}$ in models. Experimental data are overlaid for validation.

Figure 2—source data 1 Source data for Figure 2 showing the physiological characteristics and model predictions of the dnaA-titratable cells under different dnaA expression levels.: https://cdn.elifesciences.org/articles/107214/elife-107214-fig2-data1-v1.xlsx
Download elife-107214-fig2-data1-v1.xlsx

Figure 3 with 1 supplement

Download asset Open asset

Development of a DnaA activity reporter system.

(A) Schematic of promoter design and screening. Sixty-seven synthetic promoters were constructed by inserting various DnaA-boxes around the promoter core to drive *gfp* expression in a *dnaA*-titratable strain, where *dnaA* expression was regulated by aTc concentration. After pre-cultivation, GFP fluorescence per OD₆₀₀ was measured using a microplate reader in cells grown under low (0.5 ng∙ml^–1) or high (50 ng∙ml^–1) aTc concentrations to determine repression fold-change. (B) Repression fold-change of synthetic promoters. P_con (a promoter lacking DnaA-boxes) and P_native (the endogenous *dnaA* promoter) served as negative and positive controls, shown in gray and yellow, respectively. (C) Response curves of three promoters to varying *dnaA* expression levels, with their promoter architectures shown on the right. Promoter activity was assessed by relative *gfp* mRNA levels, normalized to the lowest *dnaA* expression condition. Schematic (D) and response curves (E) of P_syn66 and P_native responses to SeqA in the *seqA*-titratable strain. Promoter activity was quantified from *gfp* transcript levels in *seqA*-titratable cells containing the P_syn66-GFP plasmid, normalized to the lowest *seqA* expression level. All cells were grown in rich defined medium supplemented with glycerol across different aTc concentrations. Data represent mean ± SD from 3 biological replicates (**B, C, E**).

Figure 3—source data 1 Source data for Figure 3 showing the response characteristics of the synthetic promoter under different expression levels of DnaA and SeqA proteins.: https://cdn.elifesciences.org/articles/107214/elife-107214-fig3-data1-v1.xlsx
Download elife-107214-fig3-data1-v1.xlsx

Figure 3—figure supplement 1

Download asset Open asset

Screening a library of synthetic promoters reveals potential candidates to report DnaA activity.

For each synthetic promoter, various combinations of DnaA-boxes were inserted near the promoter core, and their repression fold in response to elevated DnaA expression was measured in *dnaA*-titratable cells grown in 0.5 ng·ml^–1 aTc compared to cells grown in 50 ng·ml^–1 aTc, using a microplate reader. Error bars represent the standard deviation (SD) of three replicates.

Figure 4

Download asset Open asset

DnaA activity oscillations decoupled from *dnaA* transcription fluctuations.

(A) Representative *lacZ* mRNA fluorescence in situ hybridization (FISH) images of MG1655 ∆*lac* cells transformed with *lacZ* expression plasmids driven by P_syn66 (DnaA-boxes around promoter core), P_con (no DnaA-box around promoter core), or P_neg (mutated promoter core). Yellow outlines indicate cell boundaries identified from phase-contrast images. (B) Relative *lacZ* mRNA concentrations driven by P_syn66 (left) and P_con (right) across different cell volumes. Relative concentrations were determined from volume-specific *lacZ* mRNA fluorescence intensities, normalized to the population average. Volume-binned data for P_syn66 ( $[m Z]$ (*P_syn66*)) and P_con ( $[m Z]$ (*P_con*)) are shown as open circles and were used to calculate $k_{s y n 66}$ . (C) Schematic of a strain with autoregulated *dnaA* transcription carrying a DnaA activity reporter plasmid. Cell cycle-dependent fluctuations in relative DnaA activity (D) and relative *dnaA* mRNA concentrations (E) in cells from panel C, grown in rich defined medium supplemented with glucose. Relative DnaA activity ( $k_{s y n 66}^{- 1}$ ), calculated from volume-binned data in panel B, was smoothed and plotted as a red curve (D). Relative *dnaA* mRNA concentrations were determined from volume-specific *dnaA* mRNA fluorescence intensities, normalized to the population average, with volume-binned data shown as open circles (E). Dashed lines indicate the cell volume at peak DnaA activity (D) and the minimum *dnaA* mRNA content (E). (F–H) Same as panels C–E, but for cells with aTc induced *dnaA* transcription, grown in rich defined medium supplemented with glycerol under 2 ng∙ml^–1 aTc induction. More than 8000 cells were analyzed per growth condition, with at least 150 cells per bin; all error bars correspond to standard error of the mean (SEM).

Figure 4—source data 1 Source data for Figure 4 showing the changes in lacZ mRNA concentration driven by the reporter promoter with cell size, and the cell cycle-dependent variations in DnaA activity and dnaA mRNA concentration.: https://cdn.elifesciences.org/articles/107214/elife-107214-fig4-data1-v1.xlsx
Download elife-107214-fig4-data1-v1.xlsx

Figure 5 with 1 supplement

Download asset Open asset

Tight correlation between DnaA activity oscillations and DNA replication initiation.

(A) Cell cycle-dependent DnaA activity oscillations in wild-type cells across various growth conditions. DnaA activity is represented by $k_{s y n 66}^{- 1}$ . Volume-binned DnaA activity (red circles) was smoothed and plotted as a red curve. The representative birth-to-division cell cycle, defined as the cell volume doubling interval containing the majority of cells, is shaded in gray. The vertical line indicates the cell volume at replication initiation ( $V_{i}$ ). (B) Cell cycle-dependent DnaA activity oscillations in *dnaA*-titratable cells grown in M6 medium with varying aTc concentrations. More than 8000 cells were analyzed per growth condition, with at least 150 cells per bin; error bars show the mean ± SEM. (C) Correlation between $V^{*}$ and $V_{i}$ in wild-type (squares) and *dnaA*-titratable (circles) cells. $V^{*}$ represents the cell volume at the peak of DnaA activity within the representative birth-to-division cell cycle. The black line indicates equivalence between $V^{*}$ and $V_{i}$ .

Figure 5—source data 1 Source data for Figure 5 showing DnaA activity oscillations and DNA replication initiation in wild-type cells cultivated under various growth media and in dnaA-titratable cells cultivated under various induction levels.: https://cdn.elifesciences.org/articles/107214/elife-107214-fig5-data1-v1.xlsx
Download elife-107214-fig5-data1-v1.xlsx

Figure 5—figure supplement 1

Download asset Open asset

Determination of cell volume at replication initiation and representative birth-to-division cell cycle.

(A–B) Distribution of cellular *oriC* content (up) and cell volume (low) for cells shown in Figure 4C cultivated in various growth media with noted doubling time (A), and for cells shown in Figure 4F grown in M6 medium with noted aTc concentrations (B). Cellular *ori*C was determined using run-out experiments followed by flow cytometry, and cell volume was obtained from phase-contrast images from mRNA fluorescence in situ hybridization (FISH) experiments. (C) Calculation of the cell volume at replication initiation. Based on panels A and B, the population-averaged cellular *oriC* content ( $\bar{o}$ ) and cell volume ( $\bar{V}$ ) were determined, then the initiation volume can be deduced accordingly. Additionally, the *oriC* number at the initiation time ( $N_{o r i C}^{i n i .}$ ) was calculated based on $\bar{o}$ . Cell volume at the replication initiation was derived by definition. (D) Illustration of the determination of the representative birth-to-division cell cycle for DnaA activity oscillations. The cell volume distribution is analyzed to calculate the number of cells within each volume-doubling range. The range with the most cell counts is defined as the representative birth-to-division cycle, which is shaded in gray.

Figure 6 with 1 supplement

Download asset Open asset

An extrusion model explains DnaA shutdown dynamics.

(A) Genetic circuit of the deactivated CRISPR-Cas system for *dnaA* transcription shutdown. *dnaA* gene is targeted by a constitutively expressed sgRNA, while dUn1Cas12f1 expression is inhibited by TetR repressor. These transcription units are separated by terminators. The cassette was integrated into the chromosome near the *oriC* locus. DnaA shutdown is induced by the addition of aTc. (B) Time course of relative *dnaA* mRNA levels (red line, left axis) and total *oriC* number (green line, right axis) following the addition of 50 ng∙ml^–1 aTc at time 0 (dashed line). *dnaA* mRNA levels were normalized to wild-type levels, and *oriC* numbers were normalized to their initial values. Error bars indicate mean ± SD (n = 3 biologically independent experiments). (C) Predicted increases in total *oriC* number during *dnaA* transcription shutdown based on three models: the titration model, switch model, and extrusion model. Shutdown was simulated by setting *dnaA* transcription to zero at time 0 (dashed line). (D) Schematic of the extrusion model. The model introduces extruder(s) as additional regulators of biomass-DNA coordination, complementing the role of DnaA (left). Increased binding of the extruder to DNA promotes the release of DnaA from DnaA-boxes (right). (E) Comparison of the relationship between relative initiation mass and relative *dnaA* mRNA levels from experimental data (Figure 2F) and predictions of the extrusion model.

Figure 6—source data 1 Source data for Figure 6 showing changes in DNA replication initiation after dnaA shutdown, as well as the extrusion model prediction regarding the relationship between initiation mass and DnaA expression level.: https://cdn.elifesciences.org/articles/107214/elife-107214-fig6-data1-v1.xlsx
Download elife-107214-fig6-data1-v1.xlsx

Figure 6—figure supplement 1

Download asset Open asset

Predictions of the extrusion model.

(A) Dynamics of relative total cell mass and *oriC* number (upper panel), *oriC* concentration (middle panel), and free DnaA concentration (lower panel), predicted by a deterministic version of the extrusion model, without considering cell division. (B) Simulations of DnaA shutdown. DnaA shutdown was simulated by changing the *dnaA* expression level $α_{A}$ to 0 (upper panel). During DnaA shutdown, dynamics of relative *oriC* concentration (middle panel) and free DnaA concentration (lower panel) predicted by the titration model and extrusion model were plotted and compared. (C) Initiation adder phenomenon predicted by the extrusion model. A stochastic version of the extrusion model was simulated. The next initiation mass (upper panel), added mass between successive initiations (middle panel), and added time between successive initiations (lower panel) were plotted against the initiation mass in previous initiation, both normalized to their averages (blue dots, n=820). Mean values were calculated in bins of 0.05 relative initiation mass (red dotted line).

Figure 7 with 2 supplements

Download asset Open asset

Titration of *hns* expression modulates DnaA activity and replication initiation.

(A) Genetic circuit of the *hns*-titratable strain. Expression of *hns* is controlled by a P_tet-*tetR* negative feedback loop integrated at the *attB* site, with the native *hns* coding sequence replaced by a kanamycin resistance gene. The plasmid containing P_syn66-*mcherry* and P_con-*gfp* expression cassettes was used to assess DnaA activity. DnaA activity (B) and initiation mass (C) were characterized in M6 medium with varying *hns* expression levels during steady-state cultivation. (D) mRNA levels of *hns* (green circles) and *dnaA* (blue squares) relative to wild-type levels, along with DnaA activity (orange rhombus), were measured during *hns* shift-up. *hns* shift-up was induced by the addition of 50 ng∙ml^–1 aTc at time 0 (dashed line), followed by steady-state cultivation in M6 medium without aTc. (E) Dynamics of population-averaged *oriC* number (blue rhombus, left axis) and cellular mass (gray rhombus, right axis) during *hns* shift-up. Data represent mean ± SD from 3 biological replicates (**B–E**). (F) Cell cycle-dependent DnaA activity oscillations in *hns*-titratable cells cultivated in M1 and M6 media under varying aTc concentrations. Relative *hns* mRNA levels are indicated for each condition. More than 8000 cells were analyzed for each condition, with at least 150 cells per bin; error bars show the mean ± SEM. (G) Correlation between the volume at maximal DnaA activity ( $V^{*}$ ) and the volume at replication initiation ( $V_{i}$ ) for *hns*-titratable cells grown in M1 (green down-pointing triangle) and M6 (red up-pointing triangle) media with varying *hns* expression levels. Data for *dnaA*-titratable cells (gray circles) and wild-type *dnaA*-autoregulated cells (Figure 5C) are included for comparison.

Figure 7—source data 1 Source data for Figure 7 showing the effect of hns expression level on DnaA activity and the timing of DNA replication initiation.: https://cdn.elifesciences.org/articles/107214/elife-107214-fig7-data1-v1.xlsx
Download elife-107214-fig7-data1-v1.xlsx

Figure 7—figure supplement 1

Download asset Open asset

H-NS promotes the release of DnaA from the *datA* sequence.

Competitive binding between H-NS and DnaA to *datA* fragments. H-NS and DnaA formed distinct complexes with *datA*, resulting in H-NS:*datA* (lane 2) and DnaA:*datA* (lane 3) complexes. Addition of H-NS to preincubated DnaA:*datA* complex resulted in coexistence of both DnaA:*datA* and H-NS:*datA* complexes (lane 4).

Figure 7—figure supplement 2

Download asset Open asset

Basic phenotypic characterization of *hns-*titratable cells harboring a DnaA activity reporting plasmid.

(A) Relative *hns* mRNA levels were measured in steady-state growing cells in rich defined medium supplemented with glycerol at various aTc concentrations. Growth rate (B), population-averaged cellular mass $\bar{m}$ (C), and cellular *oriC* number $\bar{o}$ (D) were characterized as a function of *hns* mRNA levels for these steady-state cultures. Data represent mean ± SD from 3 biological replicates. Relative DnaA activity (represented by free DnaA concentration) (E) and initiation mass (F) as a function of varying extruder concentration as predicted by the extrusion model.

Appendix 1—figure 1

Download asset Open asset

Predictions of the titration-switch model and titration-switch-extrusion model.

(A) Comparison of the titration-switch model predictions and experimental data for the relation between relative initiation mass and *dnaA* mRNA levels. The relative initiation mass was calculated as mass/*oriC* averaged over more than 100 cycles after steady DNA replication initiation was established, while the relative *dnaA* mRNA was achieved by setting various *dnaA* expression rates $α_{A}$ . Dynamics of total *oriC* number during DnaA shutdown predicted by titration-switch model (B) and titration-switch-extrusion model (C), normalized to the value at DnaA shutdown (dash line).

Author response image 1

Download asset Open asset

Tables

Appendix 1—table 1

Parameters used in models.

Parameter	Description	Values	Source
Titration model and extrusion model
$λ$	Biomass growth rate	$1.54 h^{- 1}$	This study (if not specifically defined)
$α_{A}$	DnaA synthesis rate	$300 h^{- 1} μ m^{- 3}$	Fitted in this study
$[A_{f}^{c}]$	Threshold of DnaA concentration	$10 μ m^{- 3}$	Fitted in this study
$α_{H}$	Extruder synthesis rate	$180 h^{- 1} μ m^{- 3}$	Fitted in this study
$η$	Relative noise level of $λ$ and $α_{A}$ in stochastic model	0.1	Fitted in this study
Switch model
${[D]}_{T}$	Concentration of total DnaA protein	$400 μ m^{- 3}$	Berger and Wolde, 2022; LDDR model
$α_{l}$	Activation rate of DnaA-ATP by lipid	$750 h^{- 1}$
$α_{d 1}$	Activation rate of DnaA-ATP by the DARS1 site	$100 h^{- 1}$
$α_{d 2}$	Activation rate of DnaA-ATP by the DARS2 site	$643 h^{- 1}$
$β_{d a t A}$	Deactivation rate of DnaA-ATP by data site	$600 h^{- 1}$
$β_{r i d a}$	Deactivation rate of DnaA-ATP by RIDA system	$500 h^{- 1}$
$K_{D}$	Dissociation constant of DnaA activation and deactivation	$50 μ m^{- 3}$
$K_{D}^{P}$	Dissociation constant of DnaA promoter	$300 μ m^{- 3}$
$f_{C}$	Threshold of DnaA-ATP fraction for DNA replication initiation	0.75
Titration switch model and Titration-switch-extrusion model
$K_{D}^{P}$	Dissociation constant of DnaA promoter	$400 μ m^{- 3}$	Berger and Wolde, 2022; SI table switch-titration model
$n$	Cooperativity of dnaA expression	5	Berger and Wolde, 2022; SI table switch-titration model
$α_{H}$	Extruder synthesis rate	$550 h^{- 1} μ m^{- 3}$	Fitted in this study
$[A_{A T P}^{f c}]$	Threshold of DnaA-ATP concentration for DNA replication initiation	$200 μ m^{- 3}$	Fitted in this study

Appendix 2—table 1

Strains used in this study.

Strain	Relevant genetic marker(s) or features	Source or reference
MG1655	E. coli K12(AMB1655)	Liu et al., 2011
CL1	MG1655 ΔcheZ, Δlac	Liu et al., 2011
MGCL1	MG1655 Δlac	This study
RdnaA1	MG1655 P_dnaA-dnaA::P_kanR-kanR yidA::(bla:P_tet-dnaA)::yidX intS::P_tet-tetR	This study
RdnaA2	RdnaA1 Δlac	This study
RseqA1	MG1655 seqA::kan attB::(bla:P_tet-tetR-seqA)	This study
Rhns1	MG1655 hns::kan attB::(bla:P_tet-tetR-hns)	This study
Rhns2	Rhns1 Δlac	This study
CRidnaA1	MG1655 asnA::(P_J23119-sgRNA_dnaA:P_J23100-tetR:P_tet -dUn1Cas12f1)::viaA	This study

Appendix 2—table 2

Plasmids used in this study.

Plasmid	Relevant genotype	Source or reference
pSIM5	Cm^r, repA101(Ts) ori, λRed	Zheng et al., 2016
plkml	Amp^r, pUC ori, loxp-kan-loxp	Zheng et al., 2016
pMD19-tetR	Amp^r, pUC ori, bla:P_tet-tetR	Zheng et al., 2016
pMD19-hupA-mcherry	Amp^r, pUC ori, bla:P_tet-tetR-hupA-mcherry	This study
pMD19-Rhns	Amp^r, pUC ori, bla:P_tet-tetR-hns	This study
pMD19-RseqA	Amp^r, pUC ori, bla:P_tet-tetR-seqA	This study
pMD19-RdnaA	Amp^r, pUC ori, bla:P_tet-tetR-dnaA	This study
p15A-RdnaA	Kan^r, p15A ori, P_tet-tetR-dnaA	This study
pTargetF	aadA^r, pMB1 ori, sgRNA	Jiang et al., 2015
pEcCas	Kan^r, pSC101 ori, sacB P_araB-λRed P_cas-cas9	Li et al., 2021
pZA31-P_tet-M2-GFP	Cm^r, p15A ori, Ptet-gfp	Liu et al., 2019
CmPcas	Cm^r, pSC101 ori, sacB P_araB-λRed P_cas-cas9	This study
CPP00458	aadA^r, pSC101 ori, P_J23119-sgRNA-T-P_J23100-tetR-T-P_tet-dUn1Cas12f1	Gift from Xiongfei Fu lab
P_CRidnaA1	aadA^r, pSC101 ori, P_J23119-sgRNA_dnaA-T-P_J23100-tetR-T-P_tet-dUn1Cas12f1	This study
pPT	Cm^r, pSC101 ori, BsaI-lacZa-BasI-riboJ-sfgfp	Zong et al., 2017
pPT-RFP	Cm^r, pSC101 ori, BsaI-lacZa-BasI-riboJ-mcherry	This study
pPT-lacZ	Cm^r, pSC101 ori, BsaI-lacZa-BasI-riboJ-lacZ	This study
P_syn66-GFP	Cm^r, pSC101 ori, P_syn66-riboJ-sfgfp	This study
P_con-GFP	Cm^r, pSC101 ori, P_con-riboJ-sfgfp	This study
P_syn66-RFP	Cm^r, pSC101 ori, P_syn66-riboJ-mcherry	This study
P_native-GFP	Cm^r, pSC101 ori, P_native-riboJ-sfgfp	This study
P_syn66-lacZ	Cm^r, pSC101 ori, P_syn66-riboJ-lacZ	This study
P_con-lacZ	Cm^r, pSC101 ori, P_con-riboJ-lacZ	This study
P_sny66-P_con-FPs	Cm^r, pSC101 ori, P_con-riboJ-sfGFP, P_syn66-riboJ-mcherry	This study
pET-28a-DnaA	Kan^r, pUC ori f1 ori, P_lacI-lacI, P_T7/lacO-dnaA-6*his	This study
pET-28a-H-NS	Kan^r, pUC ori f1 ori, P_lacI-lacI, P_T7/lacO-hns-6*his	This study

Appendix 2—table 3

Primer pairs for synthetic reporter.

Primers	Sequence	Use
DP420	cctggtagatagattgacaagagttatccacagtaggatactgagcaca	P_syn1
DP421	agcttgtgctcagtatcctactgtggataactcttgtcaatctatctac	P_syn1
DP422	cctggtagatagattgacacttgttatacacagggcgatactgagcaca	P_syn2
DP423	agcttgtgctcagtatcgccctgtgtataacaagtgtcaatctatctac	P_syn2
DP424	cctggtagatagattgacaatacttttccacaggtagatactgagcaca	P_syn3
DP425	agcttgtgctcagtatctacctgtggaaaagtattgtcaatctatctac	P_syn3
DP426	cctggtagatagattgacaccgatcattcacagttagatactgagcaca	P_syn4
DP427	agcttgtgctcagtatctaactgtgaatgatcggtgtcaatctatctac	P_syn4
DP428	cctggtagatagattgacacttgtgtggataagggcgatactgagcaca	P_syn5
DP429	agcttgtgctcagtatcgcccttatccacacaagtgtcaatctatctac	P_syn5
DP430	cctggtagatagattgacattatccacatagttcccgatactgagcaca	P_syn6
DP431	agcttgtgctcagtatcgggaactatgtggataatgtcaatctatctac	P_syn6
DP432	cctggtagatagattgacacccctgcgatttttcccgatactgagcaca	P_syn7
DP433	agcttgtgctcagtatcgggaaaaatcgcaggggtgtcaatctatctac	P_syn7
DP434	cctgttatccacattgacacccctgcgatagttcccgatactgagcaca	P_syn8
DP435	agcttgtgctcagtatcgggaactatcgcaggggtgtcaatgtggataa	P_syn8
DP436	cctggtagatagattgacacccctgcgatagttcccgatactttatccac	P_syn9
DP437	agctgtggataaagtatcgggaactatcgcaggggtgtcaatctatctac	P_syn9
DP438	cctgacagagttatccacagtagatagattgacaccgatcattcacagttagatactgagcaca	P_syn10
DP439	agcttgtgctcagtatctaactgtgaatgatcggtgtcaatctatctactgtggataactctgt	P_syn10
DP440	cctggaggggttatacacaactcaaagattgacaccgatcattcacagttagatactgagcaca	P_syn11
DP441	agcttgtgctcagtatctaactgtgaatgatcggtgtcaatctttgagttgtgtataacccctc	P_syn11
DP442	cctgccatactgtggaaaaggtagaagattgacaccgatcattcacagttagatactgagcaca	P_syn12
DP443	agcttgtgctcagtatctaactgtgaatgatcggtgtcaatcttctaccttttccacagtatgg	P_syn12
DP444	cctgttatccacattgacacccctgcgatagttcccgatactttatccac	P_syn13
DP445	agctgtggataaagtatcgggaactatcgcaggggtgtcaatgtggataa	P_syn13
DP446	cctgttatccacattgacacccctgcgatttttcccgatactgagcaca	P_syn14
DP447	agcttgtgctcagtatcgggaaaaatcgcaggggtgtcaatgtggataa	P_syn14
DP448	cctgttatccacattgacattatccacatagttcccgatactgagcaca	P_syn15
DP449	agcttgtgctcagtatcgggaactatgtggataatgtcaatgtggataa	P_syn15
DP450	cctggtagatagattgacattatccacatagttcccgatactttatccac	P_syn16
DP451	agctgtggataaagtatcgggaactatgtggataatgtcaatctatctac	P_syn16
DP452	cctggtagatagattgacacccctgcgatttttcccgatactttatccac	P_syn17
DP453	agctgtggataaagtatcgggaaaaatcgcaggggtgtcaatctatctac	P_syn17
DP454	cctggatagattgacatgtggataagtgtggatgatactgagcaca	P_syn18
DP455	agcttgtgctcagtatcatccacacttatccacatgtcaatctatc	P_syn18
DP456	cctggatagattgacattatccacagttttcccgatactgagcaca	P_syn19
DP457	agcttgtgctcagtatcgggaaaactgtggataatgtcaatctatc	P_syn19
DP458	cctggatagattgacattatccacagctttccagatactgagcaca	P_syn20
DP459	agcttgtgctcagtatctggaaagctgtggataatgtcaatctatc	P_syn20
DP460	cctgttatccacattgacacccctgcgatagttcccgatactgtggataa	P_syn21
DP461	agctttatccacagtatcgggaactatcgcaggggtgtcaatgtggataa	P_syn21
DP462	cctgtgtggataattgacacccctgcgatagttcccgatactttatccac	P_syn22
DP463	agctgtggataaagtatcgggaactatcgcaggggtgtcaattatccaca	P_syn22
DP464	cctgtgtggataattgacacccctgcgatagttcccgatactgtggataa	P_syn23
DP465	agctttatccacagtatcgggaactatcgcaggggtgtcaattatccaca	P_syn23
DP466	cctgtgtggataattgacacccctgcgatttttcccgatactgagcaca	P_syn24
DP467	agcttgtgctcagtatcgggaaaaatcgcaggggtgtcaattatccaca	P_syn24
DP468	cctgttatccacattgacatgtggataatagttcccgatactgagcaca	P_syn25
DP469	agcttgtgctcagtatcgggaactattatccacatgtcaatgtggataa	P_syn25
DP470	cctgtgtggataattgacattatccacatagttcccgatactgagcaca	P_syn26
DP471	agcttgtgctcagtatcgggaactatgtggataatgtcaattatccaca	P_syn26
DP472	cctgtgtggataattgacatgtggataatagttcccgatactgagcaca	P_syn27
DP473	agcttgtgctcagtatcgggaactattatccacatgtcaattatccaca	P_syn27
DP474	cctggtagatagattgacattatccacatagttcccgatactgtggataa	P_syn28
DP475	agctttatccacagtatcgggaactatgtggataatgtcaatctatctac	P_syn28
DP476	cctggtagatagattgacatgtggataatagttcccgatactttatccac	P_syn29
DP477	agctgtggataaagtatcgggaactattatccacatgtcaatctatctac	P_syn29
DP478	cctggtagatagattgacatgtggataatagttcccgatactgtggataa	P_syn30
DP479	agctttatccacagtatcgggaactattatccacatgtcaatctatctac	P_syn30
DP480	cctggtagatagattgacacccctgcgatttttcccgatactgtggataa	P_syn31
DP481	agctttatccacagtatcgggaaaaatcgcaggggtgtcaatctatctac	P_syn31
DP482	cctggtagatagattgacatgtggataatttttcccgatactgagcaca	P_syn32
DP483	agcttgtgctcagtatcgggaaaaattatccacatgtcaatctatctac	P_syn32
DP484	cctgtgtggataattgacattatccacatagttcccgatactttatccac	P_syn33
DP485	agctgtggataaagtatcgggaactatgtggataatgtcaattatccaca	P_syn33
DP486	cctgttatccacattgacattatccacatagttcccgatactgtggataa	P_syn34
DP487	agctttatccacagtatcgggaactatgtggataatgtcaatgtggataa	P_syn34
DP488	cctgtgtggataattgacattatccacatagttcccgatactgtggataa	P_syn35
DP489	agctttatccacagtatcgggaactatgtggataatgtcaattatccaca	P_syn35
DP490	cctgttatccacattgacatgtggataatagttcccgatactgtggataa	P_syn36
DP491	agctttatccacagtatcgggaactattatccacatgtcaatgtggataa	P_syn36
DP492	cctgtgtggataattgacatgtggataatagttcccgatactttatccac	P_syn37
DP493	agctgtggataaagtatcgggaactattatccacatgtcaattatccaca	P_syn37
DP494	cctgtgtggataattgacatgtggataatagttcccgatactgtggataa	P_syn38
DP495	agctttatccacagtatcgggaactattatccacatgtcaattatccaca	P_syn38
DP496	cctgttatccacattgacattatccacatagttcccgatactttatccac	P_syn39
DP497	agctgtggataaagtatcgggaactatgtggataatgtcaatgtggataa	P_syn39
DP498	cctgttatccacattgacacccctgcgatttttcccgatactttatccac	P_syn40
DP499	agctgtggataaagtatcgggaaaaatcgcaggggtgtcaatgtggataa	P_syn40
DP500	cctgttatccacattgacattatccacagttttcccgatactgagcaca	P_syn41
DP501	agcttgtgctcagtatcgggaaaactgtggataatgtcaatgtggataa	P_syn41
DP502	cctgttatccacattgacacccctttatccacacccgatactttatccac	P_syn42
DP503	agctgtggataaagtatcgggtgtggataaaggggtgtcaatgtggataa	P_syn42
DP504	cctgttatccacattgacacccctgcgttatccacagatactttatccac	P_syn43
DP505	agctgtggataaagtatctgtggataacgcaggggtgtcaatgtggataa	P_syn43
DP506	cctgttatccacattgacatgtggataatagttcccgatactttatccac	P_syn44
DP507	agctgtggataaagtatcgggaactattatccacatgtcaatgtggataa	P_syn44
DP508	cctgttatccacattgacaccccttgtggataacccgatactttatccac	P_syn45
DP509	agctgtggataaagtatcgggttatccacaaggggtgtcaatgtggataa	P_syn45
DP510	cctgttatccacattgacacccctgcgtgtggataagatactttatccac	P_syn46
DP511	agctgtggataaagtatcttatccacacgcaggggtgtcaatgtggataa	P_syn46
DP512	cctgttatccacattgacattttcccgatagttcccgatactttatccac	P_syn47
DP513	agctgtggataaagtatcgggaactatcgggaaaatgtcaatgtggataa	P_syn47
DP514	cctgttatccacattgacatcgggaaaatagttcccgatactttatccac	P_syn48
DP515	agctgtggataaagtatcgggaactattttcccgatgtcaatgtggataa	P_syn48
DP516	cctgttatccacattgacacccctttttcccgacccgatactttatccac	P_syn49
DP517	agctgtggataaagtatcgggtcgggaaaaaggggtgtcaatgtggataa	P_syn49
DP518	cctgttatccacattgacaccccttcgggaaaacccgatactttatccac	P_syn50
DP519	agctgtggataaagtatcgggttttcccgaaggggtgtcaatgtggataa	P_syn50
DP520	cctgttatccacattgacacccctgcgtcgggaaaagatactttatccac	P_syn51
DP521	agctgtggataaagtatcttttcccgacgcaggggtgtcaatgtggataa	P_syn51
DP522	cctgtgtggataagatagattgacatgtggataagtgtggatgatactgagcaca	P_syn52
DP523	agcttgtgctcagtatcatccacacttatccacatgtcaatctatcttatccaca	P_syn52
DP524	cctgttatccacagatagattgacattatccacagctttccagatactgagcaca	P_syn53
DP525	agcttgtgctcagtatctggaaagctgtggataatgtcaatctatctgtggataa	P_syn53
DP526	cctgttatccacagatagattgacattatccacagttttcccgatactgagcaca	P_syn54
DP527	agcttgtgctcagtatcgggaaaactgtggataatgtcaatctatctgtggataa	P_syn54
DP528	cctgttatccacagatagattgacatgtggataagtgtggatgatactgagcaca	P_syn55
DP529	agcttgtgctcagtatcatccacacttatccacatgtcaatctatctgtggataa	P_syn55
DP530	cctgtgtggataattgacatgtggataagtgtggatgatactgagcaca	P_syn56
DP531	agcttgtgctcagtatcatccacacttatccacatgtcaattatccaca	P_syn56
DP532	cctgttgacattatccacagttttcccgatactttatccac	P_syn57
DP533	agctgtggataaagtatcgggaaaactgtggataatgtcaa	P_syn57
DP534	cctgttatccacattgacatgtggataatttttcccgatactttatccac	P_syn58
DP535	agctgtggataaagtatcgggaaaaattatccacatgtcaatgtggataa	P_syn58
DP536	cctgttatccacattgacattatccacatttttcccgatactgtggataa	P_syn59
DP537	agctttatccacagtatcgggaaaaatgtggataatgtcaatgtggataa	P_syn59
DP538	cctgtgtggataattgacattatccacatttttcccgatactttatccac	P_syn60
DP539	agctgtggataaagtatcgggaaaaatgtggataatgtcaattatccaca	P_syn60
DP540	cctgtgtggataattgacattatccacatttttcccgatactgtggataa	P_syn61
DP541	agctttatccacagtatcgggaaaaatgtggataatgtcaattatccaca	P_syn61
DP542	cctgtgtggataattgacatgtggataatttttcccgatactttatccac	P_syn62
DP543	agctgtggataaagtatcgggaaaaattatccacatgtcaattatccaca	P_syn62
DP544	cctgttatccacattgacatgtggataatttttcccgatactgtggataa	P_syn63
DP545	agctttatccacagtatcgggaaaaattatccacatgtcaatgtggataa	P_syn63
DP546	cctgtgtggataattgacatgtggataatttttcccgatactgtggataa	P_syn64
DP547	agctttatccacagtatcgggaaaaattatccacatgtcaattatccaca	P_syn64
DP548	cctgtgtggataattgacatgtggataagtgtggatgatacttgtggata	P_syn65
DP549	agcttatccacaagtatcatccacacttatccacatgtcaattatccaca	P_syn65
DP550	cctgttatccacattgacattatccacagttttcccgatactttatccac	P_syn66
DP551	agctgtggataaagtatcgggaaaactgtggataatgtcaatgtggataa	P_syn66
DP552	cctgtgtggataattgacatgtggataagtgtggatgatactttatccac	P_syn67
DP553	agctgtggataaagtatcatccacacttatccacatgtcaattatccaca	P_syn67
DP554	cctgttgacacccctgcgatagttcccgatactgagcaca	P_con
DP555	agcttgtgctcagtatcgggaactatcgcaggggtgtcaa	P_con
DP556	cctgttatccacacccgggttatccacagttttcccgagcccttatccac	P_neg
DP557	agctgtggataagggctcgggaaaactgtggataacccgggtgtggataa	P_neg

Appendix 2—table 4

Oligonucleotides for the construction of strains and plasmids and qPCR.

Primers	Sequence	Use
DJP001	gaaagaggagaaatactagatgaccatgattacggattcac	Amplifying lacZ gene from MG1655 genome
DJP002	ttgatgcctggcttatcattatttttgacaccagaccaact	Amplifying lacZ gene from MG1655 genome
DJP003	gaaagaggagaaatactagatggtttccaagggcgagg	Amplifying mCherry gene from pMD19-hupA-mcherry
DJP004	ttgatgcctggcttatcattatttgtagagctcatccatgc	Amplifying mCherry gene from pMD19-hupA-mcherry
DJP005	ccacaaggtctccagctgatcaagatcctgcaaaacgat	Amplifying native dnaA promoter (P_native) from MG1655 genome
DJP006	ccacatggtctcccctgccaatttttgtctatggtcat
DJP007	ctgttttcttgcaagattactagtccatccagtgctcatttgtacagttcatccatacc	Amplifying P_con-gfp cassette from P_con-GFP plasmid
DJP008	ccttagtgactcctgcagtcctgggtgttgacacccctgcgat	Amplifying P_con-gfp cassette from P_con-GFP plasmid
DJP009	cgccatatgtcactttcgctttggca	Amplify dnaA gene from MG1655 genome for the construction of pET-28a-DnaA plasmid
DJP010	cgcaagcttttacgatgacaatgttctga
DJP011	cgccatatgagcgaagcacttaaaat	Amplify hns gene from MG1655 genome for the construction of pET-28a-H-NS plasmid
DJP012	cgcaagcttttattgcttgatcaggaaatc
DJP013	cgatctgcagaaagaggagaaatactaggtgtcactttcgctttggc	Amplifying dnaA gene from MG1655 genome
DJP014	gtgagccggatccttacgatgacaatgttctgatt	Amplifying dnaA gene from MG1655 genome
DJP015	atgcctgcagtcacacaggaaacctactagatgaaaacgattgaagttgatgatg	Amplifying seqA gene from MG1655 genome
DJP016	gtcaggatccttagatagttccgcaaaccttct	Amplifying seqA gene from MG1655 genome
DJP017	cagtaagcttaaagaggagaaatactagatgagcgaagcacttaaaattc	Amplifying hns gene from MG1655 genome
DJP018	gtacggatccttattgcttgatcaggaaatcgtcg	Amplifying hns gene from MG1655 genome
DJP019	tggatcgcgaagaaaggc	Amplifying T3-P_tet-tetR-dnaA cassette from pMD19-RdnaA plasmid
DJP020	tcgatatcaaccatggctgcggcaaaatcgctcgagt
DJP021	cgttttatttgatgggtcgacctgcagggaaagccacgt	Amplifying kanr gene from the plasmid pEcCas
DJP022	ttcttcgcgatccatgctagcagcaaccaattaaccaattc	Amplifying kanr gene from the plasmid pEcCas
DJP023	gcagccatggttgatatcgagctcgcttgga	Amplifying p15A-T₁ fragment from the PZA31-P_tet-M2-GFP plasmid
DJP024	cacatgaagtcgacccatcaaataaaacgaaaggctc
DJP025	tcaacccactgcagcaaccaattaaccaattctgattacgccccgccctgcca	Amplifying Cm^r gene from pZA31-P_tet-M2-GFP plasmid for the construction of CmPcas
DJP026	tgtctgcttacataaacagtaatacaaggggtgttatggagaaaaaaatcactgg
DJP027	ttaaaggtattaaaaacaactttttgtctttttaccttcccgtttcgctccaggaaacagctatgaccatg	Amplifying the T₀-Amp-T₁-P_tet-tetR-hns or T₀-Amp-T₁-P_tet -tetR-seqA cassette, and then assembling to attB locus via λRed recombination system
DJP028	cacaggttgctccgggctatgaaatagaaaaatgaatccgttgaagcctgtgtaaaacgacggccagt
DJP029	tctattattacctcaacaaaccaccccaatataagtttgagattactacaatgattgaacaagatggattgcac	Amplifying kan^r gene from plkml plasmid for the deletion of native hns gene
DJP030	aaaaaatcccgccgctggcgggattttaagcaagtgcaatctacaaaagatcagaagaactcgtcaagaagg
DJP031	ggcctgcacgattgtggattgccattgctttgtcctttgtctgcaacgttctagtgaacctcttcgaggg	Amplifying kan^r gene from plkml plasmid for the deletion of native seqA gene
DJP032	catatactcctggcgacttgtattcagctaagacactgcactggattaaggccgatcatattcaataaccc
DJP033	gagtcatgcacagattcgta	T0-P_tet-tetR-T3 cassette was amplified from plasmid pMD19-tetR with primers DJP035/DJP036, the intS upstream and downstream sequences were amplified from MG1655 genome with primers DJP033/DJP034, and DJP037/DJP038, respectively. Three fragments were ligated via overlap PCR with primers DJP033/DJP038.
DJP034	gatctgaagcgaaccatga
DJP035	tcatggttcgcttcagatcaggttgtgtgttcctcttcattc
DJP036	cctcatagccgatttgtttgaaggaaacagctatgaccatga
DJP037	caaacaaatcggctatgagg
DJP038	agtgtataagggtgttcagc
DJP039	gtacgttagatcgtagacgcttggcgataaagaacgccacttcgcccggccgtgagcatttaggatccggctcaccttca	Amplifying T3-kanr-T1 cassette from p15A-RdnaA plasmid to replace the native P_native-dnaA on the genome
DJP040	gatcgattaagccaatttttgtctatggtcattaaattttccaatatgcggcgtaaatctagggcggcggatttg
DJP041	ttaggcaccccaggctttac	The dnaA-T₃ and T₀-Amp-T₁-P_tet fragments were amplified from the pMD19-RdnaA plasmid using primers DJP041/DJP042 and DJP043/DJP044, respectively. These two fragments were then combined via overlap PCR using primers DJP045/DJP046 to generate a homologous recombination fragment for inserting T₀-Amp -T₁-P_tet-dnaA-T₃ between the yidA and yidX genes.
DJP042	cagtgatagagatactgagcacataagcttaaagaggagaaagactaggtgtcactttcgc
DJP043	gtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggagggactcgag
DJP044	aaaacgacggccagtgaa
DJP045	gatggcgtggcgtttgctattgagaagtatgtgctgaattaatctgtgggcggtcatcttcggctactgtct
DJP046	accgctgcaatttctggttgtatatgcagtaaaccaataatcagtaagcgcaggaaacagctatgaccatg
DJP047	saacttcgagtggagtccgccgtg	Inserting to the CPP00458 backbone to generate P_CRidnaA1 plasmid to shut down dnaA expression
DJP048	cgagcacggcggactccactcgaa
DJP049	aaacgatgaagaccgtctttctcc	Amplifying homologous sequences to asnA gene
DJP050	ttcttagacgtcaggtggcattattacagcagagaagggacg	Amplifying homologous sequences to asnA gene
DJP051	tgccacctgacgtctaagaa	Amplifying P_J23119-sgRNA_dnaA:P_J23100-tetR:P_tet-dUn1Cas12f1 cassette from P_CRidnaA1 plasmid
DJP052	tctagattactgcgcagatggcgacgataatgacagcagccaactcagcttc
DJP053	gccatctgcgcagtaatctagatcgcatcccggtatcaaagc	Amplifying homologous sequences to viaA gene
DJP054	atgaacagtgtgcgaaagcg	Amplifying homologous sequences to viaA gene
DJP055	ccacaaggcatcgaacaagc	Assembling the upper three fragments through overlap PCR
DJP056	gtggaacccggtactggaag	Assembling the upper three fragments through overlap PCR
DJP057	cttctttggtgctgtactca	RT-qPCR primer for rpoA
DJP058	tggttgatatcgagcaagtg	RT-qPCR primer for rpoA
DJP059	cccgattgcaggatgagtt	RT-qPCR primer for dnaA
DJP060	tacccaatcgaggacaaaac	RT-qPCR primer for dnaA
DJP061	cgttatccggaccatatgaa	RT-qPCR primer for gfp
DJP062	cttcaaatttcacttccgca	RT-qPCR primer for gfp
DJP063	aagttaaactgcgtggtact	RT-qPCR primer for mcherry
DJP064	acaggtttcttggctttgta	RT-qPCR primer for mcherry
DJP065	tatgttgaaattttccgccg	RT-qPCR primer for seqA
DJP066	attcatccgaaagcagaagt	RT-qPCR primer for seqA
DJP067	gtattgacccgaacgaactg	RT-qPCR primer for hns
DJP068	agtccaggttttagtttcgc	RT-qPCR primer for hns

Appendix 2—table 5

43 3'-TAMRA probes spanning the whole coding sequence of the dnaA gene.

gccaaagcgaaagtgacacg	agaacgataggtcggttctg	cttcctgagatcgttcttta	cacgaagtcgatggtgatcg
tgcaatcgggcaagacactg	acgtgtgtttgacgtttacg	ggcgttgaaggtgtggaaaa	tgaccagtttttcctgcaat
aattctgtggctggtaactc	cgccagttggttagatttac	atctgttgattaccttccag	ccgtcttctgaatattgtcg
caatgggcgtatccacatac	ggaacaacgggttataggca	atagcgatccgaggtgagaa	cgcgactttgatcttgtagt
agcgtgttatcgctcagttc	atgcagcaggtgagttttac	caacgccgttgatctctttc	atcgacgcttggaaaggaga
cccaatcgaggacaaaacgg	taaaccactttggcattcgg	caaccgaagcgggatttcaa	tgtggttagtcagctctttc
ttattaaggtacttgtcccg	tgaacaaagcgctcggagtg	tttttcatcaggatcgccac	caccaaacgcatcgccaatc
gcagaaactggttagcagtc	tttgcagggctttaaccatg	acgaatgtcgttttcgtcgg	ttacggcaggcatgaagcac
cgacttcaaaacgcagctgt	ttaaactcttcgatcgcgtt	ggcgataaagaacgccactt	ctcttcacgcaactgctcga
gtagaaggcgcagcacgttg	atctacggaacggtagtagc	gtacgttagatcgtagacgc	aatcttctttgatatcgtgg
ggacgttatcccaacctgag	gaatatcgtcgatcagcagt	ggtaaagttggcattggcaa

Additional files

MDAR checklist: https://cdn.elifesciences.org/articles/107214/elife-107214-mdarchecklist1-v1.pdf
Download elife-107214-mdarchecklist1-v1.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Dengjin Li
Hai Zheng
Yang Bai
Zheng Zhang
Hao Cheng
Xiongliang Huang
Ting Wei
Matthew Chang
Arieh Zaritsky
Terence Hwa
Chenli Liu

(2025)

Extrusion-modulated DnaA activity oscillations coordinate DNA replication with biomass growth

eLife 14:RP107214.

https://doi.org/10.7554/eLife.107214.3

Figures

Coordination of biomass growth and DNA replication through replication initiation and DnaA activity oscillations.

Construction and characterization of the dnaA-titratable strain.

Figure 2—source data 1

Development of a DnaA activity reporter system.

Figure 3—source data 1

Screening a library of synthetic promoters reveals potential candidates to report DnaA activity.

DnaA activity oscillations decoupled from dnaA transcription fluctuations.

Figure 4—source data 1

Tight correlation between DnaA activity oscillations and DNA replication initiation.

Figure 5—source data 1

Determination of cell volume at replication initiation and representative birth-to-division cell cycle.

An extrusion model explains DnaA shutdown dynamics.

Figure 6—source data 1

Predictions of the extrusion model.

Titration of hns expression modulates DnaA activity and replication initiation.

Figure 7—source data 1

H-NS promotes the release of DnaA from the datA sequence.

Basic phenotypic characterization of hns-titratable cells harboring a DnaA activity reporting plasmid.

Predictions of the titration-switch model and titration-switch-extrusion model.

Tables

Parameters used in models.

Strains used in this study.

Plasmids used in this study.

Primer pairs for synthetic reporter.

Oligonucleotides for the construction of strains and plasmids and qPCR.

43 3'-TAMRA probes spanning the whole coding sequence of the dnaA gene.

Additional files

MDAR checklist

Download links

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Be the first to read new articles from eLife

Share this article

Cite this article

Coordination of biomass growth and DNA replication through replication initiation and DnaA activity oscillations.

Construction and characterization of the dnaA-titratable strain.

Figure 2—source data 1

Development of a DnaA activity reporter system.

Figure 3—source data 1

Screening a library of synthetic promoters reveals potential candidates to report DnaA activity.

DnaA activity oscillations decoupled from dnaA transcription fluctuations.

Figure 4—source data 1

Tight correlation between DnaA activity oscillations and DNA replication initiation.

Figure 5—source data 1

Determination of cell volume at replication initiation and representative birth-to-division cell cycle.

An extrusion model explains DnaA shutdown dynamics.

Figure 6—source data 1

Predictions of the extrusion model.

Titration of hns expression modulates DnaA activity and replication initiation.

Figure 7—source data 1

H-NS promotes the release of DnaA from the datA sequence.

Basic phenotypic characterization of hns-titratable cells harboring a DnaA activity reporting plasmid.

Predictions of the titration-switch model and titration-switch-extrusion model.

Parameters used in models.

Strains used in this study.

Plasmids used in this study.

Primer pairs for synthetic reporter.

Oligonucleotides for the construction of strains and plasmids and qPCR.

43 3'-TAMRA probes spanning the whole coding sequence of the dnaA gene.

MDAR checklist

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)