1. Microbiology and Infectious Disease

Starvation of the bacterium Vibrio atlanticus induces simultaneous attacks on the dinoflagellate Alexandrium pacificum

  1. Jean-Luc Rolland  Is a corresponding author
  2. Estelle Masseret
  3. Mohamed Laabir
  4. Guillaume Tetreau
  5. Benjamin Gourbal
  6. Anne Thebault
  7. Eric Abadie
  8. Alice Rodrigues-Stien
  9. Carole Veckerle
  10. Elodie Servanne-meunier
  11. Delphine Destoumieux-Garzon
  12. Arnaud Lagorce
  13. Raphael Lami
  1. IHPE, Université Montpellier, CNRS, IFREMER, Université de Perpignan Via Domitia, France
  2. MARBEC, Université Montpellier, IRD, IFREMER, CNRS, France
  3. Agence nationale de sécurité sanitaire de l’alimentation, de l’environnement et du travail (ANSES), ANSES-DER 27-31, France
  4. IFREMER, 9 rue Jean Bertho, France
  5. Sorbonne Université, CNRS, LBBM USR3579, Observatoire Océanologique de Banyuls sur Mer, Avenue Pierre Fabre, France
  6. Sorbonne Université, CNRS, Bio2MAR, Observatoire Océanologique de Banyuls sur Mer, Avenue Pierre Fabre, France
https://doi.org/10.7554/eLife.107221.4
Share this article
Cite this article
  1. Jean-Luc Rolland
  2. Estelle Masseret
  3. Mohamed Laabir
  4. Guillaume Tetreau
  5. Benjamin Gourbal
  6. Anne Thebault
  7. Eric Abadie
  8. Alice Rodrigues-Stien
  9. Carole Veckerle
  10. Elodie Servanne-meunier
  11. Delphine Destoumieux-Garzon
  12. Arnaud Lagorce
  13. Raphael Lami
(2026)
Starvation of the bacterium Vibrio atlanticus induces simultaneous attacks on the dinoflagellate Alexandrium pacificum
eLife 14:RP107221.
https://doi.org/10.7554/eLife.107221.4
  2. Download BibTeX
  3. Download .RIS
5 figures, 5 videos, 3 tables and 2 additional files

Figures

Figure 1
Download asset Open asset
Dynamics of Alexandrium and Vibrio in the environment.

(A) Location of the monitoring station in the Thau Lagoon (southern France). (B) Mean abundance (DNA equiv.) of Vibrio spp. (16 S) and Alexandrium spp. (A. pacificum ACT03+A. tamarense ATT07). Vibrio cells (black line with diamond dot) and degraded Alexandrium cells (grey line with round dot) were detected in the 0.2–0.8 μm fraction (free Vibrio fraction) in spring and autumn 2015. Living Alexandrium cells (grey line with round dot) but no plankton-associated Vibrio spp. (black line with diamond dot) were evident in the 0.8–180 μm in spring and autumn. (C) Results of the Akaike Information Criterion (AICc) test conducted to select a model for explaining the mean value of dead Alexandrium (degraded cells) in spring. (D) Wald test of the AICc model explaining the mean value of dead Alexandrium in spring by free Vibrio.

Figure 2
Download asset Open asset
Incubation of V. atlanticus LGP32 and Alexandrium pacificum ACT03 in enriched natural seawater (ENSW).

(A) A. pacificum ACT03 cultured alone (grey bar) and incubated with V. atlanticus LGP32 (black bar) in ENSW. (B) V. atlanticus LGP32 cultured alone (grey bar) and incubated with A. pacificum ACT03 (black bar) in ENSW. (C) Snapshot of the interaction between V. atlanticus LGP32-GFP cells (60 hour culture) and one cell of A. pacificum ACT03 taken at 8:00 of co-culture. (D) Chronological snapshots of the interaction (70 pictures, one per second). V. atlanticus LGP32 (small green cells) and A. pacificum ACT03 cell (large red cell). All experiments were done in triplicate. Asterisks indicate significant differences in a multiple comparison test (One-way ANOVA with post hoc Tukey test), *p≤0.05.

Figure 3 with 1 supplement
Download asset Open asset
Role of V. atlanticus LGP32 starvation in the interspecific interaction process.

Experiments were conducted by incubating A. pacificum ACT03 with V. atlanticus LGP32 previously grown for 12, 36, 60, and 126 h in Zobell medium. (A) Cumulative percentage of motile A. pacificum ACT03 cells. (B) Cumulative number of cells attacked by V. atlanticus LGP32 and (C) Cumulative cell lysis after 0, 15, 30, 45, and 60 min of interaction. Corresponding pictures showing (A1) Black arrows indicate unhooked and degraded flagellum from A. pacificum ACT03 flagellum, (B1) Chronological sequence of five snapshots showing V. atlanticus LGP32-GFP cells (60 hour culture) and A. pacificum ACT03 cells, during the first hour of their interaction. V. atlanticus LGP32 (small green cells), living A. pacificum ACT03 (large red cells), and dead A. pacificum ACT03 (large green cell). (C1) Black arrow 1 indicates vesicle formation on A. pacificum ACT03 cell and black arrow 2 indicates lysed A. pacificum ACT03 cell. All percentages were determined based on a minimum of 2000 cells of A. pacificum ACT03. All experiments were done in triplicate. Asterisks indicate significant differences in a multiple comparison test (One-way ANOVA with post hoc Tukey test), ***p≤0.001.

Figure 3—figure supplement 1
Download asset Open asset
Time and dose-dependent effects of the V. atlanticus LGP32 culture supernatant on A. pacificum ACT03 motility.

(A) A time dependence experiment was conducted by incubating A. pacificum ACT03 for 1, 5, or 20 hr with 1/1000 v/v (1 µL/mL) of culture supernatant from V. atlanticus LGP32 previously grown for 60 hr in Zobell culture media. (B) A dose-dependence experiment was conducted by incubating A. pacificum ACT03 for 1 hr with 1/1000 to 1/20 v/v (1–50 µL/mL) of culture supernatant from V. atlanticus previously grown for 60 hr in Zobell media. The percentage of motile A. pacificum ACT03 was determined after 1 hr of exposure. All percentages were determined based on a minimum of 2000 cells of A. pacificum ACT03. Error bars represent the standard deviation of the mean of three independent experiments. Asterisks indicate significant differences in a multiple comparison test (One-way ANOVA with post hoc Tukey test), *p≤0.05, ***p≤0.001.

Figure 4 with 2 supplements
Download asset Open asset
Role of quorum sensing and the vibrioferrin iron uptake pathway in the interaction process.

(A) Effect of V. atlanticus LGP32 cell density on the attack process. A. pacificum ACT03 cells (1x103 cells mL–1) were incubated with V. atlanticus LGP32 grown for 60 hr in Zobell medium at concentrations ranging from 5.103 to 5 x 105 cells mL−1 (black bars). For comparison, A. pacificum ACT03 incubated with V. atlanticus LGP32 grown for 12 hr in Zobell medium at concentrations ranging from 5x103–4 x 106 cells mL−1 (grey bars). The image on the bars indicates either unaffected algae (live red algae) or algae attacked by Vibrio (algae covered with green Vibrio cell) during the interaction (B) CqsS, luxM, luxN, luxS, and luxP quorum sensing and PvsA, PvuB, and PvuA2 vibrioferrin pathway genes expression in V. atlanticus LGP32 grown for 12, 36, and 60 hr in Zobell medium. (C) Effect of V. atlanticus LGP32 mutants on the attack process. Experiments were conducted by incubating A. pacificum ACT03 with V. atlanticus LGP32, V. atlanticus LGP32 tagged with GFP, V. atlanticus LGP32 washed with ENSW or V. atlanticus LGP32 mutant ΔPvuB, ΔluxM, ΔluxR, and ΔluxS previously grown 60 hr in Zobell media (control). The percentage of A. pacificum ACT03 attacked was determined during the first 30 min of exposure. (D) Effect of V. atlanticus LGP32 culture media composition on the attack process. Experiments were conducted by incubating A. pacificum ACT03 with V. atlanticus LGP32 grown 60 hr in Zobell media supplemented with boron (H3BO3) or FeCl3. The results were compared with an exposure to V. atlanticus LGP32 grown 60 hr in Zobell media. All percentages were determined based on a minimum of 2000 cells of A. pacificum ACT03. All experiments were done in triplicate. Asterisks indicate significant differences in a multiple comparison test (One-way ANOVA with post hoc Tukey test), **p≤0.01, ***p≤0.001.

Figure 4—figure supplement 1
Download asset Open asset
Quorum sensing (QS) and the vibrioferrin iron uptake pathway in Vibrio.

(A) Putative QS pathways at low and high cell density in Vibrio according to Lami, 2019. (B) Genetic organization of the vibrioferrin utilization gene cluster on V. atlanticus LGP32 chromosome 2. The Pvu and Pvs operons are involved in the secretion and the transport of ferric vibrioferrin and biosynthesis of vibrioferrin, respectively. Arrows indicate the transcriptional directions of the genes. VSII1126, VSII1137, and VSII1129 corresponding to PvuB, PvuA2, and PvsA genes, respectively.

Figure 4—figure supplement 2
Download asset Open asset
V. atlanticus LGP32 proteome analysis following nutrient stress.

(A) Example of 2D gel, the numbers in white on the gel 4–7 correspond to the number and position of the protein spots analyzed. (B) Proteins identified by LC-MS/MS as differentially represented in the 2D gel comparative approach following nutrient stress. ND: Not determined; ENSW (artificial seawater).

Figure 5
Download asset Open asset
Schematic representation of a putative strategy developed by Vibrio spp. to feed on Alexandrium spp. and G. catenatum in the environment.

(A) Vibrio in the environment when subjected to starvation secrete non-protein lytic compounds. (B) Some of these lytic compounds degrade the flagella, immobilizing the alga (immobilization stage). (C) Then Vibrio swims and clusters around its prey (attack stage). (D) Lytic compounds released by Vibrio were able to concentrate around the algal cells, thereby lysing the algae (killing stage). (E) Feeding on the released nutrients, Vibrio multiply and then spread in the environment. Yellow clouds: Lytic compound release by Vibrio, Grey clouds: Algal nutrients released upon lysis.

Videos

Video 1
Download asset
Dynamics of V. atlanticus LGP32-Alexandrium pacificum ACT03 interaction.

GFP-tagged V. atlanticus (small green cells); living A. pacificum (large red cells); lysed A. pacificum (large green cells) filmed under an epifluorescence microscope.

Video 2
Download asset
Second-by-second timing of V. atlanticus LGP32 attacking Alexandrium pacificum ACT03.

GFP-tagged V. atlanticus (small green cells); A. pacificum living cell (large red cells) filmed under an epifluorescence microscope.

Video 3
Download asset
Degradation and disruption of Alexandrium pacificum ACT03 flagella.

Effect of Vibrio supernatant on the first stage of the interaction filmed under a confocal microscope.

Video 4
Download asset
Attacks of V. atlanticus LGP32 on target Alexandrium pacificum ACT03.

This video, recorded under a confocal microscope, shows Vibrios simultaneously attacking a first immobilized Alexandrium cell, then moving on to attack a second cell without ever targeting the other cells present, suggesting active communication between the Vibrio bacteria. V. atlanticus LGP32 (small cells); A. pacificum ACT03 (large cells).

Video 5
Download asset
Vesicle formation and bursting of an Alexandrium pacificum ACT03.

Direct effect of Vibrio supernatant on Alexandrium after 126 hr of culture filmed under a confocal microscope.

Tables

Table 1
Ability of Vibrio strains to attack and to lyse Alexandrium pacificum.

ND: not determined.

Vibrio speciesStrainsVirulence for fish or invertebratesReferencesAttackA. pacificumLyseA. pacificum
Vibrio atlanticus LGP32WTYesGay et al., 2004++
//WT +pSW3654T-GFPYesLe Roux et al., 2007++
//ΔLuxMNDIfremer Institute, France++
//ΔLuxSND//++
//ΔLuxRND//++
//ΔPvuBNDThis work-+
Vibrio tasmaniensisJ5-9YesLemire et al., 2015++
//LMG20012TNoThompson et al., 2003++
Vibrio crassostreaeJ2.9YesLemire et al., 2015++
//J2-8No//++
Vibrio fischeriES114NDMandel et al., 2008++
Vibrio harveyiATCC14126YesLiu et al., 1996++
Vibrio aestuarianusjanv-32YesLabreuche et al., 2010++
Table 2
Ability of V. atlanticus LGP32 to degrade flagella, attack, and lyse the targeted dinoflagellates spp. commonly found in the Mediterranean Sea.

ND not determined.

Dinoflagellates speciesStrainsToxicity for humanReferencesFlagella degradedCells AttackedCells Lysed
Alexandrium pacificumACT03, Thau, FranceYesLaabir et al., 2011+++
Alexandrium catenellaBizerte, TunisiaYesFertouna-Bellakhal et al., 2015+++
//F3-9F, Tarragona, SpainND//+++
//C10-5, Annaba, AlgeriaYesHadjadji et al., 2020+++
Alexandrium tamarenseATT07, Thau, FranceNoRolland et al., 2012+++
Alexandrium spp.Golf of Tunis, TunisiaNDAlgal collection University of Montpellier, France+++
//Bizerte, TunisiaND//+++
//Mediterranean coast, MoroccoND//+++
Prorocentrum limaPLBZT14, Bizerte, TunisiaYesBen-Gharbia et al., 2016---
Coolia monotisCMBZT14, Bizerte, TunisiaND//---
Vulcanodinium rugosumIFR-VRU-01, Ingril, FranceYesAbadie et al., 2015---
Karenia selliformisGolf of Gabes, TunisiaNDAlgal collection University of Montpellier, France---
Scripsiella trochoidaeMellah Lagoon, Algeria-//---
Gyrodinium impudicumGolf of Tunis, Tunisia-//---
Amphidium carteraeSAMS, ScotlandNDSAMS laboratory, Scotland---
Gymnodinium catenatumM'diq Bay, Morocco+Rijal Leblad et al., 2020+++
Table 3
Oligonucleotide sequences of primers used for RNA expression analysis.
SpeciesgenesPrimer SequencesTm (°C)EfficiencyReferences
Alexandrium pacificum (ACT03)18S – 28S rRNA ITS regionTGATATTGTGGGCAACTGTAA54Genovesi et al., 2011
AACATCTGTTAGCTCACGGAA
Alexandrium tamarense (ATT07)18S – 28S rRNA ITS regionTGGTAATTCTTCATTGATTACAATG54//
AACATCTGTTAGCTCACGGAA
Vibrios spp.16 SCGGTGAAATGCGTAGAGAT62Kita-Tsukamoto et al., 1993
TTACTAGCGATTCCGAGTTC
Vibrio atlanticus LGP32LuxN (VS_II0260)CACTTGCTAGTATCATCGC601.92This work
ATCGAGTTAGCAAGAGCAC
//LuxM (VS_II0261)TCCACTTATCACAAACAGG601.91//
ACTGTACTTCCATTTGTCG
//LuxP (VS_II0355)AAGTTCAGGATGAACCTATC601.89//
CAAAGAGATACTTTGCTGAG
//LuxS (VS_2562)ACTCTCGAGCACCTATACG601.85//
GAAGGCGTACCAATCAAGC
//CqsS (VS_1725)GACATCTATTGATGTTATGC601.91//
TCACCCACTTCACGTAACTG
//PvsA (VS_II0355),Vibrioferrin biosynthesis proteinCAGAGCAAGAGCTAGAACC591.91//
TCGTTGAGAACCTGACGAG
//PvuB (VS_II1126), ABC transporter vibrioferrin uptake FecBTAGTGCAACCATGGGAATCG572.01//
TAAACCGTACGTAGACGCTC
//PvuA2 (VS_II1127), Vibrioferrin receptor FecAGGAGCTACAAGCATTCGTTC572.08//
TTCGTCATATGGTCGCTTCG
//Housekeeping gene 1, CcmC (VS_0852)ATTGCCGCCTTTATCGGTTT60Vanhove et al., 2016
CAAGCACCCCACATTGGTTT
//Housekeeping gene 2, 6-phosphofructokinase (VS_2913)GCCGTCACTGTGGTGACCTT60//
TGCTTCTTGCCTTTCGCAAT

Additional files

MDAR checklist
https://cdn.elifesciences.org/articles/107221/elife-107221-mdarchecklist1-v1.docx
Supplementary file 1

Abundance of Alexandrium spp. and Vibrio spp. monitored by qPCR in the Thau Lagoon during spring and autumn 2015.

https://cdn.elifesciences.org/articles/107221/elife-107221-supp1-v1.xlsx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jean-Luc Rolland
  2. Estelle Masseret
  3. Mohamed Laabir
  4. Guillaume Tetreau
  5. Benjamin Gourbal
  6. Anne Thebault
  7. Eric Abadie
  8. Alice Rodrigues-Stien
  9. Carole Veckerle
  10. Elodie Servanne-meunier
  11. Delphine Destoumieux-Garzon
  12. Arnaud Lagorce
  13. Raphael Lami
(2026)
Starvation of the bacterium Vibrio atlanticus induces simultaneous attacks on the dinoflagellate Alexandrium pacificum
eLife 14:RP107221.
https://doi.org/10.7554/eLife.107221.4