Stable excitatory-inhibitory synapse balance despite dynamic turnover
- Department of Pharmacology, Vanderbilt Brain Institute, Vanderbilt University, United States
Figures
Figure 1 with 1 supplement
Characterization of live imaging reporters to simultaneously monitor presynaptic and excitatory postsynaptic compartments.
(A and B) Lentiviral-delivered HaloTag-Syb2 in primary hippocampal neurons labeled with cell-permeant JF646 HaloTag ligand and subsequently immunostained for Syn1/2 (A presynaptic) or Homer1 (B; excitatory postsynaptic). (C) Quantification of Pearson’s correlation coefficient from data in A and B. (D and E) Representative dendrites from primary hippocampal neurons transduced with lentivirus encoding mClover3-Homer1c immunostained for SHANK2 (D; excitatory postsynaptic) or Gephyrin (E; inhibitory postsynaptic). (F) Quantification of Pearson’s correlation coefficient from experiments in D and E. (G) Diagram of experimental strategy to label Schaffer collateral synapses ex vivo. (H) Representative viral labeling in the CA1 region from experiments outlined in G. (I) High-magnification images of the indicated sub-regions of CA1 neurons expressing mClover3-Homer1c and receiving HaloTag-Syb2-positive CA3 Schaffer collateral inputs. (J) Representative live primary hippocampal neuron cultures expressing mClover3-Homer1c, HaloTag-Syb2, and mTagBFP2 before (left) and after (right) a 15-hr imaging period. (K) Visualization of nascent excitatory synapses in primary cultures. Representative HaloTag-Syb2-labeled growth cone forming a co-cluster with a mClover3-Homer1c punctum along a mTagBFP2-filled dendrite. Numerical data are mean ± SEM from four independent biological replicates. Statistical significance was assessed with a two-tailed t-test (***, p<0.001). See Figure 1—video 1 for representative live imaging.
Figure 1—video 1
Representative live neuronal cultures expressing lentiviral mClover3-Homer1c, HaloTag-Syb2, and mTagBFP2.
Imaged at DIV9. Same culture as shown in Figure 1J.
Figure 2 with 4 supplements
Visualization of distinct populations of excitatory synapses.
(A) Live hippocampal cultures expressing mClover3-Homer1c, HaloTag-Syb2, and mTagBFP2 before (left) and after (right) a 15-hr imaging period. Boxes indicate zoomed-in regions shown in panels C and D. (B) Example tracked pre- and postsynaptic HaloTag-Syb2 and mClover3-Homer1c puncta and synapse tracks. Cyan crosshairs mark current object position, while cyan trails indicate previous 30 frames (5 min per frame). Tracks were further classified as indicated in the flow chart. (C) Top, representative puncta tracking of co-clustered HaloTag-Syb2 (magenta) and mClover3-Homer1c (green) with synapse tracks (cyan) over 15 hr. Bottom, synapse categories for the same tracks shown. Trails indicate previous 30 frames (2.5 hr). (D) As in C, with nascent synapses along an extending dendrite. (E) Histogram of synapse track durations with color-coded track categories. (F) Left, data averaged across time and replicate cultures showing total relative abundance of each track type. Right, percentage of each synapse track category at each frame during the imaging session. Each bar represents synapses active at each sampling interval (5 min). N=5 independent cultures. (G) Speed of track motion for Transient, Stable-like, and Stable synapses. One-way RM ANOVA (p=0.0031) with Tukey’s post hoc. N=5 independent cultures. Gray dots are individual track speed; colored points are average track speed per culture. (*, p<0.05). Post hoc test comparisons were made between all groups, but only comparisons where adj p<0.05 are shown. See Figure 2—videos 1; 2 for representative tracking examples and drift correction. See Figure 2—figure supplements 1 and 2 for additional characterization of tracking approaches.
Figure 2—figure supplement 1
Tracking neuron cultures with heterogeneous motion.
(A) Representative images of cultures classified as having moving neurites (top) and still neurites (bottom). Gray and white boxes in moving neurites depict a neurite that moves throughout the imaging session. (B) Duration of puncta in movies binned into moving or still neurites for mClover3-Homer1c, HaloTag-Syb2, or synapse pairs. Two-way ANOVA (Moving-Still, p=0.0074; Puncta-type, p=0.0002; interaction p=0.9) with Tukey’s post hoc. (C) As in B but with puncta speed. Two-way ANOVA (Moving-Still, p=0.0001; Puncta-type, p=0.28; interaction p=0.57) with Tukey’s post hoc. (D) As in B but with net displacement (start to end distance). Two-way ANOVA (Moving-Still, p=<0.0001; Puncta-type, p=0.044; interaction p=0.79) with Tukey’s post hoc. (E) As in B, but with path length (total distance traveled). Two-way ANOVA (Moving-Still, p=0.17; Puncta-type, p≤0.0001; interaction p=0.52) with Tukey’s post hoc.
Figure 2—figure supplement 2
Additional parameters for excitatory synapse dynamics across development, related to Figures 2 and 3.
(A) Example HaloTag-Syb2 (top) and mClover3-Homer1c (bottom) tracks with track categories (as in Figure 2). (B and C) Histogram of track duration for mClover3-Homer1c (B) and HaloTag-Syb2 (C). (D) Histogram of inter-puncta centroid distances for mClover3-Homer1c and HaloTag-Syb2 puncta. (E) Histogram of puncta pairing duration for mClover3-Homer1c (green) and HaloTag-Syb2 (magenta). Tracks were classified as unpaired (pairing duration <5% total time) or paired (pairing duration >75% total time). (F) Pairing analysis of data shown in Figure 3. Counts of paired puncta / the total puncta of that type are shown. For all puncta, this represents all puncta pairs relative to total number of puncta of any type. Two-way ANOVA (DIV, p=0.99; puncta type, p=0.0035; interaction, p=0.98) with Tukey’s post hoc. Mean ± SEM, N=4–5 independent cultures. (G) Total puncta count of all puncta types for mClover3-Homer1c, HaloTag-Syb2, and puncta pairs. Two-way ANOVA (DIV, p=0.55; puncta type, p=0.0019; interaction, p=0.98) with Tukey’s post hoc. Mean ± SEM, N=4–5 independent cultures.
Figure 2—video 1
Comparison of drift corrected to un-stabilized images.
First, drift corrected movie is shown, followed by uncorrected. Finally, side-by-side comparison of corrected and uncorrected on a region of the image. Graph above shows estimated per-frame drift (µm). Lateral jitter can be observed when estimated drift spikes.
Figure 2—video 2
Representative tracking of HaloTag-Syb2, mClover3-Homer1c, and synapse pairs with track categorization.
Crosshairs show current position while trails show previous positions of previous 30 frames. Individual channel tracks followed by track categorization are as described in Figure 2.
Figure 3
Spatiotemporal dynamics of excitatory synapse populations during maturation.
(A) Representative dendrites at DIV8-9 with HaloTag-Syb2 and mClover3-Homer1 with overlayed tracks (left) and track categorizations (right). Track trails indicate previous 30 frames (2.5 hr). (B) Breakdown of synapse category averages per frame at DIV8-9 for synapse tracks, mClover3-Homer1c tracks, and HaloTag-Syb2 tracks. Synapse tracks are reproduced from Figure 2F for comparison. (C) Duration of synapse tracks at DIV8-9, mClover3-Homer1c tracks, and HaloTag-Syb2 tracks. One-way RM ANOVA (p=0.001) with Tukey’s post hoc. N=5 independent cultures. Gray dots are individual track duration; colored points are average track duration per culture. (D) As in A, but with DIV11-14 cultures. (E) As in B, but with DIV11-14 cultures. (F) As in C, but with DIV11-14 cultures. One-way RM ANOVA (p=0.03) with Tukey’s post hoc. N=4 independent cultures. (G) Puncta density of mClover3-Homer1c tracks, HaloTag-Syb2, and paired puncta (synapses) across the imaging period for DIV8-9 cultures. Data are Mean ± SD. (H) As in G, but with DIV11-14 cultures. (I) Average puncta density of DIV8-9 and DIV11-14 cultures. Two-way ANOVA (DIV, p=0.114; Puncta type, p=0.0004; interaction, p=0.74) with Tukey post hoc. (J) Puncta speed of paired and unpaired tracks for HaloTag-Syb2 paired with mClover3-Homer1c. Two-way RM ANOVA (DIV, p=0.31; Pairing, p=0.0116; interaction, p=0.73) with Fisher’s LSD post hoc. N=4–5 independent cultures. Gray dots are individual tracks speed and colored points are average track speed per culture. (K) Track duration of paired and unpaired tracks for HaloTag-Syb2 paired with mClover3-Homer1c. Two-way RM ANOVA (DIV, p=0.78; Pairing, p=0.029; interaction, p=0.82) with Fisher’s LSD post hoc. N=4–5 independent cultures. Gray dots are individual tracks duration and colored points are average track duration per culture. (L) As in J, but for mClover3-Homer1c paired with Syb2. Two-way RM ANOVA (DIV, p=0.41; Pairing, p=0.0462; interaction, p=0.94) with Fisher’s LSD post hoc. N=4–5 independent cultures. (M) As in K, but for mClover3-Homer1c paired with Syb2. Two-way RM ANOVA (DIV, p=0.63; Pairing, p=0.0006; interaction, p=0.49) with Fisher’s LSD post-hoc. N=4–5 independent cultures. Post hoc test comparisons were made between all groups, but only comparisons where adj p<0.05 are shown for brevity (*, p<0.05, ** p<0.01).
Figure 4
Labeling approaches for inhibitory synapses in vitro and ex vivo.
(A) Co-localization of the tdTomato-Gephyrin lentiviral reporter with GABARα1 (inhibitory postsynaptic; left) or Homer1 (excitatory postsynaptic; right). (B) Diagram of experimental strategy to virally label OLM interneuron-CA1 synapses. (C) Representative CA1 neurons expressing tdTomato-Gephyrin and receiving HaloTag-Syb2-positive presynaptic terminals from OLM interneurons. Right, high-magnification image of the stratum lacunosum-moleculare region.
Figure 5 with 2 supplements
Live imaging inhibitory synapse spatiotemporal dynamics.
(A) Representative dendrites at DIV8-9 with HaloTag-Syb2 and tdTomato-Gephyrin with overlayed tracks (left) and track categorizations (right). Track trails indicate previous 30 frames (2.5 hr). (B) Breakdown of synapse category averages per frame across all cultures DIV8-9 for synapse tracks, tdTomato-Gephyrin tracks, and HaloTag-Syb2 tracks. (C) Duration of synapse tracks at DIV8-9, tdTomato-Gephyrin tracks, and HaloTag-Syb2 tracks. One-way RM ANOVA (p=0.0379) with Tukey’s post hoc. N=3 independent cultures. Gray dots are individual tracks duration, and colored points are average track duration per culture. (D) As in A, but with DIV11-14 cultures. (E) As in B, but with DIV11-14 cultures. (F) As in C, but with DIV11-14 cultures. One-way RM ANOVA (p=0.09) with Tukey’s post hoc test. (G) Puncta density of tdTomato-Gephyrin tracks, HaloTag-Syb2, and paired puncta (synapses) across the imaging period for DIV8-9 cultures. Data are Mean ± SD. (H) As in G, but with DIV11-14 cultures. (I) Average puncta density of DIV8-9 and DIV11-14 cultures with tdTomato-Gephyrin and HaloTag-Syb2. Two-way ANOVA (DIV, p=0.39; Puncta type, p<0.0001; interaction, p=0.32) with Tukey post hoc. (J) Puncta speed of paired and unpaired tracks for HaloTag-Syb2 paired with Gephyrin. Two-way RM ANOVA (DIV, p=0.095; Puncta type, p=0.088; interactions, p=0.21). (K) Track duration of paired and unpaired tracks for HaloTag-Syb2 paired with Gephyrin. Two-way RM ANOVA (DIV, p=0.63; Puncta type, p=0.15; interaction, p=0.67). (L) As in J, but for tdTomato-Gephyrin paired with Syb2. Two-way RM ANOVA (DIV, p=0.61, Puncta type, p=0.0592, interaction, p=0.86). (M) As in K, but for tdTomato-Gephyrin paired with Syb2. Two-way RM ANOVA (DIV, p=0.67; Puncta type, p=0.0084; interaction, p=0.42) with Fisher’s LSD post hoc. Post hoc test comparisons were made between all groups, but only comparisons where adj p<0.05 are shown. (*, p<0.05, ** p<0.01, *** p<0.001). See Figure 5—video 1 for representative live imaging data and Figure 5—figure supplement 1 for additional characterization of tracking approaches.
Figure 5—figure supplement 1
Additional parameters for inhibitory synapse dynamics across development, related to Figure 5.
(A) Example HaloTag-Syb2 (top) and tdTomato-Gephyrin (bottom) tracks with track categories (as in Figure 2). (B and C) Histogram of track duration for tdTomato-Gephyrin (B) and HaloTag-Syb2 (C). (D) Histogram of inter-puncta centroid distances for tdTomato-Gephyrin and HaloTag-Syb2 puncta. (E) Histogram of puncta pairing duration for tdTomato-Gephyrin (green) and HaloTag-Syb2 (magenta). Tracks were classified as unpaired (pairing duration <5% total time) or paired (pairing duration >75% total time). (F) Pairing analysis of data shown in Figure 5. Counts of paired puncta/the total puncta of that type are shown. For all puncta, this represents all puncta pairs relative to the total number of puncta of any type. Two-way ANOVA (DIV, p=0.50; puncta type, p<0.0001; interaction, p=0.98) with Tukey’s post hoc. Mean ± SEM, N=4–5 independent cultures. (G) Total puncta count of all puncta types for tdTomato-Gephyrin, HaloTag-Syb2, and puncta pairs. Two-way ANOVA (DIV, p=0.51; puncta type, p=0.0008; interaction, p=0.94) with Tukey’s post hoc. Mean ± SEM, N=4–5 independent cultures.
Figure 5—video 1
Representative live neuronal cultures expressing lentiviral tdTomato-Gephyrin, HaloTag-Syb2, and mTagBFP2.
Imaged at DIV12.
Figure 6 with 3 supplements
Characterization of TKIT CRISPR/Cas9-based reporters to label endogenous pre- or postsynaptic compartments.
(A–E) Characterization of CRISPR/Cas9 tagging strategy for endogenous presynaptic Bassoon. (A) Diagram of TKIT CRISPR/Cas9 approach to tag endogenous Bassoon via AAV-mediated delivery of TKIT CRISPR components. (B) Example neurons transduced with AAVs encoding an HA-Bassoon DNA donor, sgRNAs, without (left) or with (right) Cas9. Neurons were co-stained for HA, endogenous Bassoon, and the somatodendritic marker MAP2. (C–E) Co-localization of HA-tagged Bassoon with endogenous Bassoon (C), another presynaptic marker Syn1/2 (D), and the excitatory postsynaptic marker Homer1 (E). (F–J) TKIT tagging of endogenous postsynaptic excitatory Homer1c. (F) Diagram of the CRISPR/Cas9-mediated tagging strategy for endogenous Homer1c. (G) Example primary hippocampal neurons transduced with AAVs encoding the HA-Homer1c DNA donor and sgRNAs without (left) or with (right) Cas9. Neurons were co-stained for HA tag, endogenous Homer1, and MAP2. (H–J) Co-localization of HA-tagged Homer1c with endogenous Homer1 (H), another excitatory postsynaptic marker SHANK2 (I), and the inhibitory postsynaptic marker Gephyrin (J). (K–O) Validation of TKIT-based tagging of endogenous inhibitory postsynaptic Gephyrin. (K) Diagram of endogenous Gephyrin tagging via TKIT CRISPR/Cas9. (L) Example primary hippocampal neurons transduced with AAVs encoding the Gephyrin tagging donor and sgRNAs without (left) or with (right) Cas9. Neurons were co-stained for GFP, endogenous Gephyrin, and MAP2. (M–O) Immunostaining for GFP-tagged Gephyrin together with endogenous Gephyrin (M), another inhibitory postsynaptic component GABARα1 (N), and the excitatory postsynaptic marker Homer1 (O). (P–R) TKIT-mediated Gephyrin tagging in the CA1 region. (P) Diagram of experimental strategy to label endogenous Gephyrin in CA1 neurons. (Q) GFP tagging of endogenous Gephyrin in the CA1 region. mTagBFP2 was used as an injection site marker. (R) Representative CA1 neuron dendrite labeled with GFP-tagged endogenous Gephyrin. See Figure 6—figure supplements 1–3 for additional characterization of TKIT CRISPR/Cas9 tagging approaches.
Figure 6—figure supplement 1
CRISPR/Cas9 tagging of endogenous GluA2 using the TKIT approach.
(A and B) Example of the efficacy of the TKIT tagging approach with the SEP-GluA2 tagging constructs from Fang et al., 2021 (Chanda et al., 2017). (A) Low-magnification overviews illustrating the prevalence of SEP-tagged GluA2 neurons across a neuronal culture. (B) High-magnification representative dendritic stretches of endogenously tagged GluA2. Cells were co-labeled for GFP together with excitatory presynaptic vGLUT1 and the somatodendritic marker MAP2.
Figure 6—figure supplement 2
Additional characterization of CRISPR/Cas9 TKIT-mediated approach to label endogenous pre- and postsynaptic markers.
(A–C) Quantification of Pearson’s correlation coefficient from results in Figure 6. (A) Pearson’s correlation coefficient measurements of HA-tagged endogenous presynaptic Bassoon co-immunostained for indicated synaptic markers. (B) Similar to (A), except for the HA-tagged Homer1c TKIT. (C) Similar to (A), except for GFP-tagged Gephyrin. (D) Example TKIT tagging of both Gephyrin and Homer1c. (E–H) RT-qPCR analysis of CRISPR/Cas9 tagging efficiency. (E) qPCR probes detecting the HA-tagged Bassoon transcript are only amplified when neurons are co-transduced with AAVs encoding the DNA donor/sgRNAs, and Cas9. Copy numbers were calculated via standard curve qPCR using a plasmid containing the tagged sequence. (F) Similar to (E), except for HA-tagged Homer1c transcript. (G) Similar to (E), except for GFP-tagged Gephyrin transcript. (H) Efficiency estimates based on standard curve qPCR with primers detecting tagged Homer1c or Gephyrin transcript specifically, or primers detecting both tagged and non-tagged transcripts. Numerical data are mean ± SEM from three to four independent culture replicates indicated as open circles. Statistical significance was assessed via two-tailed t-test or one-way ANOVA with post hoc Tukey tests (*, p<0.05; ***, p<0.001).
Figure 6—figure supplement 3
Analysis of TKIT off-target effects.
(A) Chromatogram depicting HA insertion into the 5’ of endogenous Homer1c. (B) Homer1c sgRNA1 sequence compared to the top two predicted off-target sites. Chromatograms depict sequencing of off-target sites. (C) Similar to B, except for Homer1c sgRNA2. (D) Chromatogram depicting GFP insertion into the 5’ of endogenous Gephyrin. (E) Gephyrin sgRNA1 sequence compared to the top two predicted off-target sites. Chromatograms depict sequencing of off-target sites. (F) Similar to E, except for Gephyrin sgRNA2. (G) Chromatogram depicting HA insertion into the 5’ of endogenous Bassoon. (H) Bassoon sgRNA1 sequence compared to the top two predicted off-target sites. Chromatograms depict sequencing of off-target sites. (I) Similar to (H), except for Bassoon sgRNA2. Data depicts representative chromatograms from three independent experiments.
Figure 7 with 2 supplements
Long-term imaging of endogenous inhibitory postsynaptic Gephyrin.
(A) Example primary hippocampal neuron harboring tdTomato-tagged endogenous Gephyrin before and after a 15 hr imaging period. (B) Example dendrite with tdTomato-labeled endogenous Gephyrin and lentiviral expressed HaloTag-Syb2 time-lapse imaged over a 15-hr period, with overlayed tracks (left) and track categorizations (right). (C) Breakdown of synapse category averages per frame across all cultures DIV8-9 for synapse tracks, tdTomato-Gephyrin tracks, and HaloTag-Syb2 tracks. (D) Duration of synapse tracks, tdTomato-Gephyrin tracks, and HaloTag-Syb2 tracks. One-way RM ANOVA (p=0.1213). N=5 independent cultures. Gray dots are individual tracks duration and colored points are average track duration per culture. (E) Puncta density of endogenous tdTomato-Gephyrin tracks, HaloTag-Syb2, and paired puncta (synapses) across the imaging period. Data are Mean ± SD. (F) Average puncta density of cultures with endogenously labeled tdTomato-Gephyrin and lentiviral HaloTag-Syb2. One-way ANOVA (p=0.01) with Tukey’s post hoc. (G) Puncta speed (left) and track duration (right) of paired and unpaired tracks for HaloTag-Syb2 paired with endogenous Gephyrin. Paired t-tests, N=5 independent cultures. (H) As in G, with endogenous tdTomato-Gephyrin paired with HaloTag-Syb2. Paired t-tests, N=5 independent cultures. Post hoc test comparisons were made between all groups, but only comparisons where adj p<0.05 are shown. (**, p<0.01). See Figure 7—video 1 for representative live imaging data and Figure 7—figure supplement 1 for additional characterization of tracking approach.
Figure 7—figure supplement 1
Additional parameters for tracking endogenous Gephyrin, related to Figure 7.
(A) Histogram of inter-puncta centroid distances for endogenous tdTomato-Gephyrin and HaloTag-Syb2 puncta. (B) Histogram of puncta pairing duration for endogenous tdTomato-Gephyrin (green) and HaloTag-Syb2 (magenta). Tracks were classified as unpaired (pairing duration <5% total time) or paired (pairing duration >75% total time). (C) Pairing analysis of data shown in Figure 7. Counts of the number of paired puncta / the total puncta of that type are shown. For all puncta, this represents all puncta pairs relative to total number of puncta of any type. One-way ANOVA (p=0.013) with Tukey’s post hoc. Mean ± SEM, N=5 independent cultures. (D) Total puncta counts of all puncta for endogenous tdTomato-Gephyrin, HaloTag-Syb2, and puncta pairs. Kruskall-Wallis test (p=0.07). Mean ± SEM, N=5 independent cultures.
Figure 7—video 1
Representative live neuronal cultures expressing endogenous (TKIT CRISPR/Cas9-labeled) tdTomato-Gephyrin, lentiviral HaloTag-Syb2, and mTagBFP2.
Imaged at DIV13.
Figure 8
Monitoring excitatory and inhibitory synapse ratios and functional maturation during synaptogenesis.
(A) Representative primary hippocampal neurons expressing lentiviral-delivered mClover3-Homer1c, tdTomato-Gephyrin, HaloTag-Syb2, and mTagBFP2. (B) Puncta density of Homer1c:Syb2 and Gephyrin:Syb2 pairs at indicated timepoints. Two-way ANOVA (DIV, 0.66; puncta type, 0.0027; interaction, 0.74) with Fisher’s LSD post hoc. Mean ± SEM, N=3 cultures. (C) Excitatory/inhibitory ratios calculated from same cultures. Welch’s t-test (p=0.62). Mean ± SEM, N=3 cultures. (D) Representative traces for mEPSC/mIPSC ratio measurements recorded from DIV6, 10, and 16 primary hippocampal neurons. (E and F) cell capacitance (E) and membrane resistance (F) from recordings at indicated timepoints. (G) Cumulative probability plot of mEPSC amplitude measurements. (H) Cumulative probability plot of mEPSC inter-event intervals. (I and J) similar to G and H except for mIPSC measurements. (K) Average mEPSC/mIPSC amplitudes at indicated timepoints. (L) Average ratio of mEPSC/mIPSC amplitudes. One-way ANOVA with Tukey post hoc (ns – not significant). (M and N) Similar to K and L except for mEPSC/mIPSC frequency measurements. One-way ANOVA with Tukey post hoc (ns – not significant).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | HA-Tag (C29F4) rabbit mAb | Cell Signaling Technologies | Cat# 3724, RRID:AB_1549585 | ICC, IHC (1:1000) |
| Antibody | GFP polyclonal antibody rabbit | Life Technologies | Cat# A11122, RRID:AB_221569 | ICC, IHC (1:1000) |
| Antibody | Anti-Bassoon mouse monoclonal antibody L124/59 | AbCam | Cat# L124-59, RRID:AB_2716712 | ICC, IHC (1:1000) |
| Antibody | Polyclonal anti-Homer 1 rabbit | Synaptic Systems | Cat# 160003, RRID:AB_887730 | ICC, IHC (1:5000) |
| Antibody | Microtubule associated protein 2, chicken polyclonal | Encor | Cat# CPCA-MAP2, RRID:AB_2138173 | ICC, IHC (1:5000) |
| Antibody | Polyclonal anti-Shank 2 guinea pig | Synaptic Systems | Cat# 162204, RRID:AB_2619861 | ICC, IHC (1:2000) |
| Antibody | Polyclonal anti-Syn1/2 rabbit | Synaptic Systems | Cat# 106002, RRID:AB_887804 | ICC, IHC (1:5000) |
| Antibody | Monoclonal anti-Gephyrin mouse | Synaptic Systems | Cat# 147111, RRID:AB_2619837 | ICC, IHC (1:2000) |
| Antibody | Polyclonal anti-GABARα1 rabbit | Synaptic Systems | Cat# 224203, RRID:AB_2232180 | ICC, IHC (1:1000) |
| Antibody | Anti-vesicular glutamate transporter 1 (VGLUT1) Polyclonal guinea pig | Millipore | Cat# AB5905, RRID:AB_2301751 | ICC, IHC (1:1000) |
| Antibody | Goat anti-mouse Alexa Fluor 488 | Thermo Fisher | Cat# A11001, RRID:AB_2534069 | ICC, IHC (1:1000) |
| Antibody | Goat anti-mouse Alexa Fluor 546 | Thermo Fisher | Cat# A11003, RRID:AB_141370 | ICC, IHC (1:1000) |
| Antibody | Goat anti-mouse Alexa Fluor 647 | Thermo Fisher | Cat# A21236, RRID:AB_2535805 | ICC, IHC (1:1000) |
| Antibody | Goat anti-rabbit Alexa Fluor 488 | Thermo Fisher | Cat# A11034, RRID:AB_2576217 | ICC, IHC (1:1000) |
| Antibody | Goat anti-rabbit Alexa Fluor 546 | Thermo Fisher | Cat# A11010, RRID:AB_2534077 | ICC, IHC (1:1000) |
| Antibody | Goat anti-rabbit Alexa Fluor 647 | Thermo Fisher | Cat# A21245, RRID:AB_2535813 | ICC, IHC (1:1000) |
| Antibody | Goat anti-chicken Alexa Fluor 647 | Thermo Fisher | Cat# A21449, RRID:AB_2535866 | ICC, IHC (1:1000) |
| Antibody | Goat anti-guinea pig Alexa Fluor 647 | Thermo Fisher | Cat# A21450, RRID:AB_2535867 | ICC, IHC (1:1000) |
| Antibody | HaloTag ligand JF646 | Promega | Cat# GA1120 | 0.2 µM |
| Biological sample (Mus musculus) | Primary murine C57BL/6 J hippocampal cultures, ex vivo brain slices | Jackson Laboratories | Cat# 664, RRID:IMSR_JAX:000664 | Freshly isolated from Mus musculus |
| Biological sample (Mus musculus) | Ex vivo brain slices, Chrna2-Cre | Add Leão et al., 2012 and Nichol et al., 2018, Garbett et al., 2024 | Freshly isolated from Mus musculus | |
| Cell line (Homo sapiens) | HEK293T | ATCC | CRL-11268, RRID:CVCL_1926 | See Methods, Cell lines |
| Strain, strain background (Escherichia coli) | DH10β | Thermo Fisher | 18297010 | Competent cells |
| Strain, strain background (Escherichia coli) | HST08 | Takara | 636767 | Competent cells |
| Commercial kit | Superscript IV reverse transcriptase | Invitrogen | 18091050 | See Methods, RT-qPCR |
| Commercial kit | In-fusion assembly system | Takara | 638948 | See Methods, Plasmids |
| Commercial kit | MycoStrip2.0 | Invivogen | rep-mysv2-10 | See Methods, Cell lines |
| Other | Bovine serum albumin fraction V | Roche | 10735086001 | See Methods, Immunocytochemistry |
| Other | Normal goat serum | Jackson Immunoresearch | 5000121 | See Methods, Immunocytochemistry |
| Other | DAPI | Roche | 10236276001 | See Methods, Immunocytochemistry |
| Other | DMEM | Gibco | 11995065 | See Methods, Cell lines |
| Other | FBS | Gibco | 16000044 | See Methods, Cell lines |
| Other | Hanks’ balanced salt solution | Gibco | 14175095 | See Methods, Primary hippocampal cultures |
| Other | HEPES | Sigma | H3375 | See Methods, AAV production |
| Other | Matrigel membrane matrix | ThermoFisher | CB-40234 | See Methods, Primary hippocampal cultures |
| Other | Poly-D-lysine | Gibco | A38904-01 | See Methods, Primary hippocampal cultures |
| Other | MEM non-essential amino acid solution | Sigma | M7145 | See Methods, Primary hippocampal cultures |
| Other | Papain | Worthington Biochemical Corporation | LS003126 | See Methods, Primary hippocampal cultures |
| Other | Opti-MEM | Gibco | 31985070 | See Methods, Primary hippocampal cultures |
| Other | Paraformaldehyde | Electron Microscopy Science | 15714 | See Methods, Immunocytochemistry |
| Other | Penicillin/streptomycin | Corning | MT30002Cl | See Methods, Cell lines |
| Other | B-27 supplement | Gibco | 17504044 | See Methods, Primary hippocampal cultures |
| Other | Neurobasal A | Gibco | 10888022 | See Methods, Primary hippocampal cultures |
| Other | Cytosine β-D-arabinofuranoside | Sigma | C6645 | See Methods, Primary hippocampal cultures |
| other | Versene | Gibco | 15040066 | See Methods, AAV production |
| Other | FuGENE6 | Promega | E2691 | See Methods, Lentivirus production |
| Other | Benzonase nuclease | Sigma | E1014 | See Methods, AAV production |
| Other | Cesium gluconate | HelloBio | HB4822 | See Methods, Electrophysiology |
| Other | Cesium chloride | Sigma | 289329 | See Methods, Electrophysiology |
| Other | Adenosine 5'-Triphosphate magnesium | Sigma | A9187 | See Methods, Electrophysiology |
| other | Guanosine 5'-Triphosphate sodium | Sigma | G8877 | See Methods, Electrophysiology |
| Other | Phosphocreatine disodium hydrate | Sigma | P7936 | See Methods, Electrophysiology |
| Other | Tetrodotoxin citrate | HelloBio | HB10351MG | See Methods, Electrophysiology |
| Other | PowerUp SYBR Green Master Mix | Applied Biosystems | A25742 | See Methods, RT-qPCR |
| Other | Prolong gold antifade reagent | Invitrogen | P36930 | See Methods, Immunocytochemistry |
| Recombinant DNA reagent | L202 rSyn mClover3-Homer1c (plasmid) | This paper | See Methods, Plasmids | |
| Recombinant DNA reagent | L202 rSyn mTagBFP2 (plasmid) | This paper | See Methods, Plasmids | |
| Recombinant DNA reagent | L202 rSyn HaloTag-Syb2 (plasmid) | This paper | See Methods, Plasmids | |
| Recombinant DNA reagent | L202 rSyn tdTomato-Gephyrin (plasmid) | This paper | See Methods, Plasmids | |
| Recombinant DNA reagent | pAAV rSyn DIO HaloTag-Syb2 (plasmid) | Garbett et al., 2024 | ||
| Recombinant DNA reagent | pAAV rSyn tdTomato-Gephyrin (plasmid) | This paper | See Methods, Plasmids | |
| Recombinant DNA reagent | pAAV rSyn FLAG-CRE (plasmid) | This paper | See Methods, Plasmids | |
| Recombinant DNA reagent | pAAV rSyn mTagBFP2 (plasmid) | This paper | See Methods, Plasmids | |
| Recombinant DNA reagent | pAAV rSyn DIO mClover3-Homer1 (plasmid) | This paper | See Methods, Plasmids | |
| Recombinant DNA reagent | pAAV nEF spCas9 (plasmid) | This paper | See Methods, CRISPR Tag Knockin Design | |
| Recombinant DNA reagent | pAAV SEP-GluA2 TKIT (plasmid) | Fang et al., 2021 | RRID:Addgene_169442 | |
| Recombinant DNA reagent | pAAV HA-Homer1c TKIT (plasmid) | This paper | See Methods, CRISPR Tag Knockin Design | |
| Recombinant DNA reagent | pAAV HA-Bassoon TKIT (plasmid) | This paper | See Methods, CRISPR Tag Knockin Design | |
| Recombinant DNA reagent | pAAV GFP-Gephyrin TKIT (plasmid) | This paper | See Methods, CRISPR Tag Knockin Design | |
| Recombinant DNA reagent | pAAV tdTomato-Gephyrin TKIT (plasmid) | This paper | See Methods, CRISPR Tag Knockin Design | |
| Software | SnapGene | GSL Biotech | RRID:SCR_015052 | |
| Software | NIS-Elements AR | Nikon | RRID:SCR_027181 | |
| Software | ImageJ | National Institutes of Health | RRID:SCR_003070 | |
| Software | Adobe Photoshop | Adobe | RRID:SCR_014199 | |
| Software | Adobe Illustrator | Adobe | RRID:SCR_010279 | |
| Software | GraphPad Prism 8.0, 9.0 | GraphPad | RRID:SCR_002798 |
Table 1
CRISPR KI sequences, AAV and Lenti titering primers, and primers for estimating the tagging efficiency of the TKIT method.
| Purpose | Sequence 5’–3’ |
|---|---|
| Homer1c KI sgRNA1 | TATTCAAGTGCACGTCGCGT |
| Homer1c KI sgRNA2 | TTATTGTAGAGCGACACCAG |
| Gephyrin KI sgRNA1 | TGCAACTCGTGGAGAGTGAG |
| Gephyrin KI sgRNA2 | GAGAAACCTCCAGCAAGTCG |
| Bassoon KI sgRNA1 | TGCGTGGACACGAGTCTTCG |
| Bassoon KI sgRNA2 | TGGTCAAGGTGGGCAACCCT |
| AAV genomic titering forward | GGAACCCCTAGTGATGGAGTT |
| AAV genomic titering reverse | CGGCCTCAGTGAGCGA |
| Lenti genomic titering forward | CCACTGCTGTGCCTTGGAATGC |
| Lenti genomic titering reverse | AATTTCTCTGTCCCACTCCATCCAG |
| Homer1 WT TKIT F for tagging efficiency | GAGTTGCCTCCGGAAAAGATCTCGG |
| Homer1 WT TKIT R for tagging efficiency | CATGAGCTCGAGTGCTGAAGATAGG |
| Homer1 HA TKIT F for tagging efficiency | CCATACGATGTTCCAGATTACGCTG |
| Gphn WT TKIT F for tagging efficiency | TCCTGGCTCCTGTCAGTGCGGTG |
| Gphn WT TKIT R for tagging efficiency | GCAAGATTCCTGAAGCAGCTATCAC |
| Gphn GFP TKIT F for tagging efficiency | CTCTCGGCATGGACGAGCTGTAC |
| Bsn WT TKIT F for tagging efficiency | CAACGAGGCCAGCCTGGAGG |
| Bsn WT TKIT R for tagging efficiency | GGCCAGGAGCAGTAGCAGATGC |
| Bsn HA TKIT F for tagging efficiency | CCATACGATGTTCCAGATTACGCTG |
| GAPDH | PrimeTime, IDT #MM.PT.39a.1 |
Table 2
Primers sequences for analysis of CRISPR/CAS9 off-target modifications.
| Targeted Site | Primer Sequence 5’–3’ |
|---|---|
| Homer1 gRNA1 chr7 F | CAAGGTTCATCAGTTCTGCTAGGTAG |
| Homer1 gRNA1 chr7 R | GGTGACATCCTTATAACCTGGGtg |
| Homer1 gRNA1 chr8 F | CTTACTGAACAGGTAGACGGGAGG |
| Homer1 gRNA1 chr8 R | TTCTTTGGTATGTACACACGCGTAC |
| Homer1 gRNA2 chr5 F | TCACGACCCTCATCATCTTTGTC |
| Homer1 gRNA2 chr5 R | GCCCAGGTGAAATAAGCCATCTAC |
| Homer1 gRNA2 chr12 F | CCTACACTCAGGCCAGCTAG |
| Homer1 gRNA2 chr12 R | CATTGTCATCGGCACCACTG |
| Gphn gRNA1 chr5 F | TAGTGGGGCAGACTGTGAAGg |
| Gphn gRNA1 chr5 R | CAAACAGGGTTACAGGGTGCag |
| Gphn gRNA1 chr2 F | GGCATCATTGAATCAGGAGAGG |
| Gphn gRNA1 chr2 R | TGAGTAAGTGAGACCATGACCC |
| Gphn gRNA2 chr14 F | TACCATGCGTGCTTCTAATGAGaac |
| Gphn gRNA2 chr14 R | GCTTGAATGTGGTACTGCAAACaag |
| Gphn gRNA2 chr2 F | AACTGTTTGGGTTAAGGGCAAGc |
| Gphn gRNA2 chr2 R | GCTCAAATTGCCCAGATTCCTC |
| Bsn gRNA1 chr1 F | ACTATGTAGCCGAGGATTCCAC |
| Bsn gRNA1 chr1 R | AGGCCTATGTCACTGGATGTTC |
| Bsn gRNA1 chr8 F | CGCTAGATTTGGTCCACAGCTTC |
| Bsn gRNA1 chr8 R | TTGCTCCTAACAGAAACACGTCTG |
| Bsn gRNA2 chr14 F | CAAGAGAAGAGTGCAGGTAAGC |
| Bsn gRNA2 chr14 R | CTACTCTCTCCTCTAGCAGTGCC |
| Bsn gRNA2 chr4 F | GCTGTGTGATCTGAATGAAGGCC |
| Bsn gRNA2 chr4 R | TGACACTGGGCAGACTCTATCAC |
| Homer1 HA F | CGTCAACCAAACCTAAGATGGC |
| Homer1 HA R | GAGTTGCCTCCGGAAAAGATCTCGG |
| Gphn GFP F | TAAGCCACCTCTAGGTTCTCCG |
| Gphn GFP R | gccgtaggtggcatcgccctcg |
| Bsn HA F | CCGGCCTTCATTCAACACCC |
| Bsn HA R | CGAACCTGCTGTCCACTAGATCG |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Stable excitatory-inhibitory synapse balance despite dynamic turnover
eLife 14:RP107635.
https://doi.org/10.7554/eLife.107635.3
