Enterovirus D68 2A protease causes nuclear pore complex dysfunction and independently contributes to motor neuron toxicity

  1. Katrina M Zinn
  2. Mathew W McLaren
  3. Michael T Imai
  4. Malavika M Jayaram
  5. Jeffery D Rothstein
  6. Matthew J Elrick  Is a corresponding author
  1. Hugo W. Moser Research Institute, Michael V. Johnston Center for Developmental Neuroscience, Kennedy Krieger Institute, United States
  2. Department of Neurology, Johns Hopkins School of Medicine, United States
4 figures, 1 table and 1 additional file

Figures

Figure 1 with 1 supplement
Enterovirus D68 proteases cleave several nucleoporins.

(A) HEK cells were transfected with Enterovirus D68 2Apro, Poliovirus 1 2Apro, or empty vector control, and the indicated nucleoporins were quantified by western blot, normalized to control = 100%. EIF4G was included as a non-nucleoporin positive control. Mean ± SD of three independent replicates. Statistical comparison was by multiple t-tests of the EV-D68 2Apro vs control, with multiple comparisons correction by the false discovery rate (FDR) method. Red asterisks represent significance with FDR<10%, blue asterisks represent samples for which a cleavage product was visible on the western blot irrespective of significance. (B) As in A, except transfecting with 3Cpro. The positive control was CREB. (C) Nuclear lysates from HEK cells were incubated at 37°C with recombinant EV-D68 2Apro at a ratio of 1:50 (protease:lysate by mass) for the indicated time. Gray bars represent lysate incubated for 4 hr at 37°C in the absence of protease as a negative control. Mean ± SD of three independent replicates. Statistical comparison was by t-test between the with- and without-protease samples at 4 hr. (D) As in C, except with EV-D68 3Cpro at a ratio of 1:200. *p<0.05, **p<0.01, ***p<0.001.

Figure 1—source data 1

Raw data from quantifications of western blot data by densitometry for Figure 1A–D, reported as percent of control.

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data1-v1.zip
Figure 1—source data 2

Labeled uncropped western blots for Figure 1A–D.

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data2-v1.zip
Figure 1—source data 3

Original western blot images for Figure 1A.

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data3-v1.zip
Figure 1—source data 4

Original western blot images for Figure 1B (part 1).

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data4-v1.zip
Figure 1—source data 5

Original western blot images for Figure 1B (part 2).

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data5-v1.zip
Figure 1—source data 6

Original western blot images for Figure 1B (part 3).

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data6-v1.zip
Figure 1—source data 7

Original western blot images for Figure 1C (part 1).

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data7-v1.zip
Figure 1—source data 8

Original western blot images for Figure 1C (part 2).

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data8-v1.zip
Figure 1—source data 9

Original western blot images for Figure 1C (part 3).

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data9-v1.zip
Figure 1—source data 10

Original western blot images for Figure 1C (part 4).

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data10-v1.zip
Figure 1—source data 11

Original western blot images for Figure 1D (part 1).

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data11-v1.zip
Figure 1—source data 12

Original western blot images for Figure 1D (part 2).

https://cdn.elifesciences.org/articles/108672/elife-108672-fig1-data12-v1.zip
Figure 1—figure supplement 1
Western blots demonstrating evidence of 2Apro and 3Cpro protease activity on well-established substrates following transfection with each of the expression vectors used in this study.
Figure 2 with 2 supplements
Enterovirus D68 2A protease impairs nucleocytoplasmic transport of protein cargoes and disrupts the nuclear pore complex permeability barrier.

(A) tdTomato reporter assay showing nuclear-cytoplasmic ratios at steady state 20 hr after transfection of IRES-GFP, IRES-GFP-2Apro, or IRES-GFP-3Cpro. Mean values of three independent replicates n=29,404 GFP+ cells in total, error bars are SD. Statistical comparison was by two-way ANOVA with Šídák’s multiple comparisons test. (B) Example output of image analysis protocol. In the overlay image, yellow represents the nuclei of transfected cells, defined by the area of expression of H2A-iRFP670 in GFP+ cells only. The surrounding dark blue ring is the perinuclear cytoplasm. The intensity of the reporter construct was measured in the red channel and reported as a ratio of nuclear to perinuclear cytoplasmic signal. (C) Example images from A. Dotted outlines mark the nuclei. (D) Kinetics of nuclear import (left) and export (right) measured by photoinducible LINus and LEXY reporter assays, respectively, in HeLa cells 20 hr after transfection with IRES-GFP, IRES-GFP-2Apro, or IRES-GFP-3Cpro. Mean values of three biologically independent replicates, n=999 GFP+ cells for LINus and 1059 for LEXY in total. Error bars are SEM. Statistical comparison was by two-way ANOVA. (E) Example images from D. Dotted outlines mark GFP+ cells. (F) Dextran exclusion assay was performed in HeLa cells 15 hr after transfection with IRES-iRFP670-H2A, IRES-iRFP670-H2A-(2A)-2Apro, or IRES-iRFP670-H2A-(2A)-3Cpro. n=45–46 cells per group pooled from three biologically independent replicates. Statistical comparison was by two-way ANOVA. (H) Propidium iodide viability assay. Mean values of three independent replicates, n=8042 cells in total. Error bars are SD. Statistical comparison was by one-way ANOVA with Tukey’s multiple comparison test.

Figure 2—figure supplement 1
Source data for Figure 2A, showing individual cell-level data for three independent replicates.

Bars are mean ± SD.

Figure 2—figure supplement 2
Source data for Figure 2D, showing mean ± SD values from three independent replicates for LINus (A) and LEXY (C) nucleocytoplasmic transport reporters, individual cell-level data is also presented at t=10 min for LINus (B) and LEXY (D).

Bars are mean ± SD.

Figure 3 with 1 supplement
Enterovirus D68 proteases do not significantly alter RNA export.

(A) Steady-state mRNA levels were measured by poly-A FISH in HeLa cells 20 hr after transfection with IRES-GFP, IRES-GFP-2Apro, or IRES-GFP-3Cpro. Data represent the mean ± SD of four independent replicates, n=55,177 GFP+ cells in total. Statistical comparison was by one-way ANOVA with Šídák’s multiple comparisons test. (B) Nuclear export of EU-labeled RNAs in HEK cells by 1 hr pulse followed by 0–8 hr chase. EU labeling began 20 hr after transfection with IRES-GFP, IRES-GFP-2Apro, or IRES-GFP-3Cpro. Pulse labeling of total RNA or primarily the products of the listed RNA polymerases was performed in the presence of pairs of combinations of actinomycin D, α-amanitin, and CAS 577784-91-9 as described in Materials and methods. Data represent the mean ± SEM of three independent replicates. n=253,015 GFP+ cells analyzed in total. Statistical comparison was by two-way ANOVA. (C) Representative images from the experiment described in B. (D) Nuclear export of EU-labeled RNAs in RD cells by 1 hr pulse followed by 0–4 hr chase. EU labeling began 24 hr after infections with EV-D68 strains at MOI 5 or mock infection as indicated. Data represent the mean ± SEM of three independent replicates. n=125,401 cells analyzed in total. Statistical comparison was by two-way ANOVA. (E) Representative images from the experiment described in D.

Figure 3—figure supplement 1
Source data for Figure 3A, demonstrating individual cell-level data across four independent replicates.

Bars are mean ± SD.

Figure 4 with 1 supplement
Effects of 2A protease during Enterovirus D68 (EV-D68) infection on nuclear pore complex (NPC) function and motor neuron toxicity.

(A) Western blots of direct-induced motor neuron (diMN) lysates collected 24 hr after infection with the indicated strains of EV-D68 at MOI 5 followed by treatment with telaprevir at 0.3, 1, 3, and 10 µM. Total protein loading control was Bio-Rad stain-free imaging. One representative example out of three biologically independent replicates. (B) tdTomato reporter assays in RD cells showing nuclear-cytoplasmic ratios 24 hr after mock infection or infection with EV-D68 US/MO/2014-18947. Telaprevir was added following infection at the indicated concentrations. Data are mean of three independent replicates, n=11,847 cells in total for NLS-tdTomato and n=8941 for tdTomato-NES. (C) Representative images of tdTomato signal from B. (D) tdTomato reporter assays in diMN showing nuclear-cytoplasmic ratios 24 hr after mock infection or infection with EV-D68 US/MO/2014-18947, treated with DMSO or 3 µM telaprevir. Means of three replicates from independent iPSC lines. n=3388 cells in total for NLS-tdTomato and n=3371 for tdTomato-NES. (E) Representative images from panel D. (F) Survival of diMNs following infection with EV-D68 at MOI 5 with the indicated EV-D68 strains in the presence of varying concentrations of telaprevir or DMSO control. diMNs were generated from four independent iPSC lines. n=8512 and 7046 cells counted for US/MO/2014-18947 and US/MD/2018-23209, respectively. Statistical comparisons were by Cox proportional hazard regression. (G) Representative images of diMNs from the experiment presented in panel F. Note the fragmentation of neurites and loss of cell body shape, signifying cell death following EV-D68 infection, and the relative preservation following treatment with 3 µM telaprevir. (H) Growth curve of EV-D68 in the presence of varying concentrations of telaprevir or DMSO control. Infections were performed with the indicated strains at MOI 0.5, using diMNs generated from four independent iPSC lines for each virus. Error bars are SEM. Statistical comparisons were by two-way ANOVA with Dunnett’s multiple comparisons test between DMSO and telaprevir-treated groups. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Figure 4—figure supplement 1
Source data for Figure 4D, showing individual cell-level data for the nuclear/cytoplasmic ratio of NLS-tdTomato (A) or tdTomato-NES (B) for three independent replicates in direct-induced motor neurons (diMNs) derived from induced pluripotent stem cell (iPSC) lines CS0002, CS0003, and CS88.

Bars are mean ± SD.

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Enterovirus D68)2AGenBankKM851225.1Nucleotides 3280–3720 of genomic cDNA
Gene (Enterovirus D68)3CGenBankKM851225.1Nucleotides 5341–5979 of genomic cDNA
Strain, strain background (Enterovirus D68)US/MO/2014-18947BEI ResourcesNR-49129
Strain, strain background (Enterovirus D68)
US/MD/2018-23209
Gift of Andrew Pekosz, Johns Hopkins School of Public Health
Cell line (Homo sapiens)RDATCCCCL-136
Cell line (Homo sapiens)HEK293TATCCCRL-3216 RRID:CVCL_0063
Cell line (Homo sapiens)HeLaATCCCRM-CCL-2 RRID:CVCL_0030
Cell line (Homo sapiens)iPSCCedars Sinai Biomanufacturing CenterCS0002
Cell line (Homo sapiens)iPSCCedars Sinai Biomanufacturing CenterCS0003
Cell line (Homo sapiens)iPSCCedars Sinai Biomanufacturing CenterCS88
Cell line (Homo sapiens)iPSCCedars Sinai Biomanufacturing CenterCS0YX7
Cell line (Homo sapiens)iPSCCedars Sinai Biomanufacturing CenterCS8VTR
AntibodyAladin
(rabbit polyclonal)
Bethyl LaboratoriesA304-514A RRID:AB_2620708(1:500)
AntibodyCG1 (NUPL2; Nup42)
(rabbit polyclonal)
ThermoPA5-88035 RRID:AB_2804606(1:1000)
AntibodyCREB
(rabbit polyclonal)
Cell Signaling9197 RRID:AB_331277(1:1000)
AntibodyeIF4G
(rabbit polyclonal)
Cell Signaling2498S RRID:AB_2096025(1:1000)
AntibodyELYS
(rabbit polyclonal)
Bethyl LaboratoriesA300-166A RRID:AB_2225879(1:1000)
AntibodyGAPDH
(mouse monoclonal)
Abcamab8245 RRID:AB_2107448(1:10,000)
AntibodyGFP
(mouse monoclonal)
Takara Bio632375 RRID:AB_2756343(1:20,000)
AntibodyGle1
(rabbit polyclonal)
NovusNBP2-47449 RRID:AB_3311113(1:250)
AntibodyGP210
(rabbit polyclonal)
Bethyl LaboratoriesA301-795A RRID:AB_1211450(1:100)
AntibodymAb414
(rabbit polyclonal)
AbcamAb24609 RRID:AB_448181(1:1000)
AntibodyNDC1 (TMEM48) (rabbit polyclonal)Novus BiologicalsNBP1-91603 RRID:AB_11030742(1:1000)
AntibodyNucleolin
(rabbit polyclonal)
Cell Signaling14574S RRID:AB_2798519(1:10,000)
AntibodyNup107
(rabbit polyclonal)
Thermo Fisher Scientific19217-1-AP RRID:AB_10597702(1:1000)
AntibodyNup133
(mouse monoclonal)
Santa Cruzsc-376699 RRID:AB_11149388(1:1000)
AntibodyNup153
(mouse monoclonal)
AbcamAb24700 RRID:AB_2154467(1:1000)
AntibodyNup155
(rabbit polyclonal)
Abcamab199528 RRID:AB_3751167(1:1000)
AntibodyNup160
(rabbit polyclonal)
Bethyl LaboratoriesA301-790A RRID:AB_1211264(1:100)
AntibodyNup188
(rabbit polyclonal)
Bethyl LaboratoriesA302-323A-T RRID:AB_1850233(1:2500)
AntibodyNup205
(rabbit polyclonal)
Abcamab157090 RRID:AB_3751168(1:1000)
AntibodyNup214
(rabbit polyclonal)
Abcamab70497 RRID:AB_1269607(1:1000)
AntibodyNup35 (Nup53) (rabbit polyclonal)Proteintech19819–1-AP RRID:AB_2878611(1:1000)
AntibodyNup37
(rabbit polyclonal)
Thermo Fisher ScientificPA5-66007 RRID:AB_2664134(1:200)
AntibodyNup43
(mouse polyclonal)
Abcamab69447 RRID:AB_1269608(1:1000)
AntibodyNup50
(mouse monoclonal)
Santa Cruzsc-398993 RRID:AB_2941760(1:1000)
AntibodyNup54
(rabbit polyclonal)
Sigma-AldrichHPA035929 RRID:AB_10671236(1:200)
AntibodyNup62
(rabbit polyclonal)
MilliporeMABE1043 RRID:AB_3751169(1:2000)
AntibodyNup85
(rabbit polyclonal)
Proteintech19370–1-AP RRID:AB_10859826(1:100)
AntibodyNup88
(mouse monoclonal)
Santa Cruzsc-365868 RRID:AB_10842170(1:200)
AntibodyNup93
(mouse monoclonal)
Santa Cruzsc-374399 RRID:AB_10990113(1:200)
AntibodyNup96
(rabbit polyclonal)
BethylA301-785A RRID:AB_1211486(1:1000)
AntibodyNup98 (rat polyclonal)Abcamab50610 RRID:AB_881769(1:5000)
AntibodyPOM121
(rabbit polyclonal)
GeneTexGTX102128 RRID:AB_10732546(1:1000)
AntibodyRAE1
(mouse monoclonal)
Santa Cruzsc-393252 RRID:AB_3751170(1:200)
AntibodyRanBP2
(mouse monoclonal)
Santa Cruzsc74518 RRID:AB_2176784(1:200)
AntibodySec13
(rabbit polyclonal)
Proteintech15397–1-AP RRID:AB_2186234(1:1000)
AntibodySNAP29
(rabbit polyclonal)
Abcamab181151 RRID:AB_2687668(1:5000)
AntibodyTPR
(rabbit polyclonal)
Bethyl LaboratoriesA300-828A RRID:AB_597886(1:1000)
AntibodyGoat Anti-Mouse IgG H&L HRPAbcamab205719 RRID:AB_2755049(1:20,000)
AntibodyGoat Anti-Rabbit IgG H&L HRPAbcamab205718 RRID:AB_2819160(1:20,000)
AntibodyGoat Anti-Rat IgG H&L HRPAbcamab205720 RRID:AB_2941939(1:20,000)
AntibodyGoat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488Thermo FisherA32723 RRID:AB_2633275(1:500)
Recombinant DNA reagentpmTurquoise-H2A (plasmid)Addgene (Goedhart et al., 2012)36207
Recombinant DNA reagentFU-MAP2-Gateway (plasmid)Addgene (Addis et al., 2011)43915
Recombinant DNA reagenteBFP2-N1 (plasmid)Addgene (Michael Davidson)54595
Recombinant DNA reagentpDB22 (mCherry-LINus) (plasmid)Addgene (Niopek et al., 2014)61342
Recombinant DNA reagentpDN122 (NLS-mCherry-LEXY) (plasmid)Addgene (Niopek et al., 2016)72655
Recombinant DNA reagentpLenti-DsRed-IRES-GFP (plasmid)Addgene (Rousseaux et al., 2016)92194
Recombinant DNA reagenthMAP2-pGreenZero (plasmid)System BiosciencesSR10047PA-1
Recombinant DNA reagentShuttle-tdTomato (plasmid)Zhang et al., 2015
Recombinant DNA reagentpeSUMOstar (plasmid)LifeSensors, Inc
Recombinant DNA reagentCMV-(EV-D68)2AproThis paperBackbone: NheI/AgeI digest of eBFP2-N1 Insert: Synthetic DNA 1
Recombinant DNA reagentCMV-(EV-D68)3CproThis paperBackbone: NheI/AgeI digest of eBFP2-N1 Insert: Synthetic DNA 7
Recombinant DNA reagentCMV-(PV1)2AproThis paperBackbone: NheI/AgeI digest of eBFP2-N1 Insert: Synthetic DNA 2
Recombinant DNA reagentCMV-(PV1)3CproThis paperBackbone: NheI/AgeI digest of eBFP2-N1 Insert: Synthetic DNA 8
Recombinant DNA reagentpLenti-IRES-GFPThis paperBackbone: PCR amplification of pLenti-DsRed-IRES-GFP (primers MJE_69, MJE_71) Recircularization via In-Fusion Snap Assembly
Recombinant DNA reagentpLenti-IRES-GFP-2AproThis paperBackbone: BsrGI digest of pLenti-IRES-GFP Insert: Synthetic DNA 11
Recombinant DNA reagentpLenti-IRES-GFP-3CproThis paperBackbone: BsrGI digest of pLenti-IRES-GFP Insert: Synthetic DNA 12
Recombinant DNA reagentpLenti-IRES-H2A-iRFPThis paperBackbone: PCR amplification of pLenti-IRES-GFP (primers MTI_1, MTI_7) Insert: PCR amplificaion of H2A-iRFP from MAP2-H2A-iRFP670 with addition of P2A site (primers MTI_5, MTI_13)
Recombinant DNA reagentpLenti-IRES-H2A-iRFP(P2A)2AproThis paperBackbone: PCR amplification of pLenti-IRES-GFP-2A (primers MTI_2, MTI_8) Insert: PCR amplificaion of H2A-iRFP from MAP2-H2A-iRFP670 with addition of P2A site (primers MTI_5, MTI_13)
Recombinant DNA reagentpLenti-IRES-H2A-iRFP(P2A)3CproThis paperBackbone: PCR amplification of pLenti-IRES-GFP-3C (primers MTI_12, MTI_9) Insert: PCR amplificaion of H2A-iRFP from MAP2-H2A-iRFP670 with addition of P2A site (primers MTI_5, MTI_13) Insert: Synthetic DNA 23
Recombinant DNA reagentNLS-tdTomatoThis paperPCR amplification of Shuttle-tdTomato, followed by recircularization (primers MJE_10, MJE_11)
Recombinant DNA reagenttdTomato-NESThis paperPCR amplification of Shuttle-tdTomato, followed by recircularization (primers MJE_8, MJE_53)
Recombinant DNA reagentMAP2-pmTurquoise-H2AThis paperBackbone: PCR amplification of pmTurquoise-H2A (primers KEB_1, KEB_2) Insert: PCR amplification of FU-MAP2-Gateway (primers KEB_3, KEB_4)
Recombinant DNA reagentMAP2-H2A-iRFP670This paperBackbone: AgeI/NotI digest of MAP2-pmTurqoise-H2A Insert: Synthetic DNA 22, digested with AgeI/NotI
Recombinant DNA reagentpeSUMOstar-2AproThis paperBackbone: BsaI digest of peSUMOSTAR Insert: Synthetic DNA 23
Sequence-based reagentKEB_1This paperPCR primersCGGAACTCCATATATGGGCTATGAACTAAT
Sequence-based reagentKEB_2This paperPCR primersGGTTTAGTGAACCGTCAGATCCGCA
Sequence-based reagentKEB_3This paperPCR primersATATATGGAGTTCCGCAGCTGGCCTTTTTGGTTCTCAT
Sequence-based reagentKEB_4This paperPCR primersGGTTTAGTGAACCGTTCGGTTAGAGACAAGCTGAAGAATCTACCG
Sequence-based reagentMJE_10This paperPCR primersCTCGAGCAGAAACTCATCTCAGAAGAGGATC
Sequence-based reagentMJE_11This paperPCR primersTGAGTTTCTGCTCGAGCTGTAGCTTGTACAGCTCGTCCATGC
Sequence-based reagentMJE_53This paperPCR primersCATGCCCCCGCCTCCCATGGTGGCACGCGTCG
Sequence-based reagentMJE_69This paperPCR primersCACCGGCGGCCTAGCCGCCCCTCTC
Sequence-based reagentMJE_70This paperPCR primersCACCGGCGGCCTAGCAACCATGG
Sequence-based reagentMJE_8This paperPCR primersGGAGGCGGGGGCATGGTGAG
Sequence-based reagentMTI_1This paperPCR primersGAGAACCCTGGACCTTCTAGATAACTGATCCTCTCCC
Sequence-based reagentMTI_12This paperPCR primersGAGAACCCTGGACCTGGTCCAGGCTTCGGAGGAGTTTTTG
Sequence-based reagentMTI_13This paperPCR primersAGGTCCAGGGTTCTCCTCCACGTCGCCAGCCTGCTTCAGCAGGCTGAAGTTAGTAGCGCGTTGGTGGTGGG
Sequence-based reagentMTI_2This paperPCR primersGAGAACCCTGGACCTGGTCCAGGCTTCGG
Sequence-based reagentMTI_5This paperPCR primersAATATGGCCACAACCATGTCGGGACGTGGC
Sequence-based reagentMTI_7This paperPCR primersGAGAACCCTGGACCTGGACCAGG
Sequence-based reagentMTI_8This paperPCR primersGAGAACCCTGGACCTGGACCAGGGTTCG
Sequence-based reagentMTI_9This paperPCR primersGAGAACCCTGGACCTGGACCAGGGTTCGATT
Sequence-based reagent1This paperSynthetic DNAGTCAGATCCGCTAGCGCCACCATGGGTCCAGGCTTCGGAGGAGTTTTTGTAGGGTCTTTTAAAATAATCAACTATCACTTGGCCACTACAGAAGAGAGACAGTCAGCTATCTATGTGGATTGGCAATCAGACGTCTTGGTTACCCCCATTGCTGCTCATGGAAGGCACCAAATAGCAAGATGCAAGTGCAACACAGGGGTTTACTATTGTAGGCACAAAAACAGAAGTTACCCGATTTGCTTTGAAGGCCCAGGGATTCAATGGATTGAACAAAATGAATATTACCCAGCAAGGTACCAGACCAATGTACTTTTGGCAGTTGGTCCTGCGGAAGCAGGAGATTGCGGTGGTTTACTAGTTTGTCCACATGGGGTAATCGGTCTTCTTACAGCAGGAGGGGGTGGAATTGTAGCTTTCACTGATATCAGGAATTTGCTATGGTTAGATACTGATGCTATGGAACAATGGGATCCACCGGTCG
Sequence-based reagent2This paperSynthetic DNAGTCAGATCCGCTAGCGCCACCATGGGATTCGGACACCAAAACAAAGCGGTGTACACTGCAGGTTACAAAATTTGCAACTACCACTTGGCCACTCAGGATGATTTGCAAAACGCAGTGAACGTCATGTGGAGTAGAGACCTCTTAGTCACAGAATCAAGAGCCCAGGGCACCGATTCAATCGCAAGGTGCAATTGCAACGCAGGGGTGTACTACTGCGAGTCTAGAAGGAAATACTACCCAGTATCCTTCGTTGGCCCAACGTTCCAGTACATGGAGGCTAATAACTATTACCCAGCTAGGTACCAGTCCCATATGCTCATTGGCCATGGATTCGCATCTCCAGGGGATTGTGGTGGCATACTCAGATGTCACCACGGGGTGATAGGGATCATTACTGCTGGTGGCGAAGGGTTGGTTGCATTTTCAGACATTAGAGACTTGTATGCCTACGAAGAAGAAGCCATGGAACAATGGGATCCACCGGTCG
Sequence-based reagent7This paperSynthetic DNAGTCAGATCCGCTAGCGCCACCATGGGACCAGGGTTCGATTTTGCACAAGCCATAATGAAGAAAAATACCGTCATTGCAAGGACTGAAAAGGGTGAGTTCACCATGCTGGGTGTATATGATAGGGTAGCGGTCATCCCCACACACGCATCTGTTGGAGAAACCATTTACATTAATGATGTAGAGACTAAAGTTTTAGATGCGTGTGCACTTAGAGACTTGACTGATACAAACTTAGAGATAACCATAGTCAAATTAGACCGTAATCAAAAATTTAGAGATATCAGACATTTTCTGCCCAGATATGAGGATGATTACAATGACGCTGTGCTTAGCGTACATACATCAAAATTCCCAAATATGTATATCCCAGTTGGACAAGTCACCAATTATGGCTTCTTGAACCTAGGTGGTACACCGACGCACCGCATTTTAATGTATAACTTCCCAACAAGAGCTGGCCAGTGTGGTGGTGTGGTGACAACTACAGGTAAGGTGATAGGAATACATGTAGGTGGAAATGGAGCTCAAGGATTTGCAGCAATGCTACTACACTCTTACTTTTCCGATACACAAGGTGAGATAGTTAGTAGTGAAAAGAGTGGGGTGTGCATTAACGCACCGGCAAAGACTAAACTCCAACCTAGTGTTTTCCATCAAGTTTTTTAATGGGATCCACCGGTCG
Sequence-based reagent8This paperSynthetic DNAGTCAGATCCGCTAGCGCCACCATGGGACCAGGGTTCGATTACGCAGTGGCTATGGCTAAAAGAAACATTGTTACAGCAACTACTAGCAAGGGAGAGTTCACTATGTTAGGAGTCCACGACAACGTGGCTATTTTACCAACCCACGCTTCACCTGGTGAAAGCATTGTGATCGATGGCAAAGAAGTGGAGATCTTGGATGCCAAAGCGCTCGAAGATCAAGCAGGAACCAATCTTGAAATCACTATAATCACTCTAAAGAGAAATGAAAAGTTCAGAGACATTAGACCACATATACCTACTCAAATCACTGAGACAAATGATGGAGTCTTGATCGTGAACACTAGCAAGTACCCCAATATGTATGTTCCTGTCGGTGCTGTGACTGAACAGGGATATCTAAATCTCGGTGGGCGCCAAACTGCTCGTACTCTAATGTACAACTTTCCAACCAGAGCAGGACAGTGTGGTGGAGTCATCACATGTACTGGGAAAGTCATCGGGATGCATGTTGGTGGGAACGGTTCACACGGGTTTGCAGCGGCCCTGAAGCGATCATACTTCACTCAGAGTCAATAATGGGATCCACCGGTCG
Sequence-based reagent11This paperSynthetic DNAATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCGCGGGCCCGGGTCCAGGCTTCGGAGGAGTTTTTGTAGGGTCTTTTAAAATAATCAACTATCACTTGGCCACTACAGAAGAGAGACAGTCAGCTATCTATGTGGATTGGCAATCAGACGTCTTGGTTACCCCCATTGCTGCTCATGGAAGGCACCAAATAGCAAGATGCAAGTGCAACACAGGGGTTTACTATTGTAGGCACAAAAACAGAAGTTACCCGATTTGCTTTGAAGGCCCAGGGATTCAATGGATTGAACAAAATGAATATTACCCAGCAAGGTACCAGACCAATGTACTTTTGGCAGTTGGTCCTGCGGAAGCAGGAGATTGCGGTGGTTTACTAGTTTGTCCACATGGGGTAATCGGTCTTCTTACAGCAGGAGGGGGTGGAATTGTAGCTTTCACTGATATCAGGAATTTGCTATGGTTAGATACTGATGCTATGGAACAATAAGTACAAGTAATCTAG
Sequence-based reagent12This paperSynthetic DNAATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCGCGGGCCCGGGACCAGGGTTCGATTTTGCACAAGCCATAATGAAGAAAAATACCGTCATTGCAAGGACTGAAAAGGGTGAGTTCACCATGCTGGGTGTATATGATAGGGTAGCGGTCATCCCCACACACGCATCTGTTGGAGAAACCATTTACATTAATGATGTAGAGACTAAAGTTTTAGATGCGTGTGCACTTAGAGACTTGACTGATACAAACTTAGAGATAACCATAGTCAAATTAGACCGTAATCAAAAATTTAGAGATATCAGACATTTTCTGCCCAGATATGAGGATGATTACAATGACGCTGTGCTTAGCGTACATACATCAAAATTCCCAAATATGTATATCCCAGTTGGACAAGTCACCAATTATGGCTTCTTGAACCTAGGTGGTACACCGACGCACCGCATTTTAATGTATAACTTCCCAACAAGAGCTGGCCAGTGTGGTGGTGTGGTGACAACTACAGGTAAGGTGATAGGAATACATGTAGGTGGAAATGGAGCTCAAGGATTTGCAGCAATGCTACTACACTCTTACTTTTCCGATACACAATAAGTACAAGTAATCTAG
Sequence-based reagent22This paperSynthetic DNAATGGCGCGTAAGGTCGATCTCACCTCCTGCGATCGCGAGCCGATCCACATCCCCGGCAGCATTCAGCCGTGCGGCTGCCTGCTAGCCTGCGACGCGCAGGCGGTGCGGATCACGCGCATTACGGAAAATGCCGGCGCGTTCTTTGGACGCGAAACTCCGCGGGTCGGTGAGCTACTCGCCGATTACTTCGGCGAGACCGAAGCCCATGCGCTGCGCAACGCACTGGCGCAGTCCTCCGATCCAAAGCGACCGGCGCTGATCTTCGGTTGGCGCGACGGCCTGACCGGCCGCACCTTCGACATCTCACTGCATCGCCATGACGGTACATCGATCATCGAGTTCGAGCCTGCGGCGGCCGAACAGGCCGACAATCCGCTGCGGCTGACGCGGCAGATCATCGCGCGCACCAAAGAACTGAAGTCGCTCGAAGAGATGGCCGCACGGGTGCCGCGCTATCTGCAGGCGATGCTCGGCTATCACCGCGTGATGTTGTACCGCTTCGCGGACGACGGCTCCGGGATGGTGATCGGCGAGGCGAAGCGCAGCGACCTCGAGAGCTTTCTCGGTCAGCACTTTCCGGCGTCGCTGGTCCCGCAGCAGGCGCGGCTACTGTACTTGAAGAACGCGATCCGCGTGGTCTCGGATTCGCGCGGCATCAGCAGCCGGATCGTGCCCGAGCACGACGCCTCCGGCGCCGCGCTCGATCTGTCGTTCGCGCACCTGCGCAGCATCTCGCCCTGCCATCTCGAATTTCTGCGGAACATGGGCGTCAGCGCCTCGATGTCGCTGTCGATCATCATTGACGGCACGCTATGGGGATTGATCATCTGTCATCATTACGAGCCGCGTGCCGTGCCGATGGCGCAGCGCGTCGCGGCCGAAATGTTCGCCGACTTCTTATCGCTGCACTTCACCGCCGCCCACCACCAACGCTAA
Sequence-based reagent23This paperSynthetic DNAGAACAGATTGGAGGTGGTCCTGGTTTTGGTGGCGTCTTTGTGGGTTCTTTCAAAATAATTAACTACCACCTGGCGACGACAGAGGAACGCCAATCAGCGATTTATGTTGACTGGCAAAGCGATGTCTTGGTTACCCCGATTGCAGCACACGGACGTCACCAAATTGCCCGGTGTAAATGCAATACGGGAGTATATTATTGTAGACATAAGAACCGTAGTTACCCCATTTGTTTTGAAGGACCAGGCATCCAATGGATCGAGCAGAACGAGTACTACCCAGCCAGATACCAAACGAACGTACTGCTGGCGGTGGGTCCTGCGGAAGCTGGCGATTGTGGGGGCTTGTTGGTGTGTCCGCACGGCGTAATTGGATTACTGACTGCCGGGGGTGGTGGTATCGTGGCGTTTACTGATATTCGCAATCTTCTGTGGTTAGATACTGATGCCATGGAACAATGATGACTAGAGGATCCGAAT
OtherComplete Media (CM)Cell culture mediaDulbecco’s modified Eagle medium (Thermo Fisher 11995073) 10% fetal bovine serum (Thermo Fisher 16140071) 1% penicillin/streptomycin (Thermo Fisher 15140122) 2 mM L-glutamine (Thermo Fisher 25030081) 1 mM Sodium Pyruvate (Millipore Sigma S8636)
OtherInfection Media (IM)Cell culture mediaDulbecco’s modified Eagle medium (Thermo Fisher 11995073) 2.5% fetal bovine serum (Thermo Fisher 16140071) 1% penicillin/streptomycin (Thermo Fisher 15140122) 2 mM L-glutamine (Thermo Fisher 25030081) 1 mM Sodium Pyruvate (Millipore Sigma S8636)
OtherStage 1 diMN Media (S1)Li et al., 2021Cell culture media50% Iscove’s Modified Dulbecco’s Medium (IMDM) (Thermo Fisher 12440053) 50% Ham’s F12 nutrient mix (Thermo Fisher 11765062) 1× Non-essential amino acids (Thermo Fisher 11140050) 1× Penicillin-Streptomycin (Thermo Fisher 15140122) 1× B27 Supplement (Thermo Fisher 17504044) 1× N2 Supplement (Thermo Fisher 17502048) 0.2 µM LDN-193189 (Stemgent 04-0074) 10 µM SB431542 (STEMCELL Technologies 72234) 3 µM CHIR99021 (Millipore Sigma SML1046)
OtherStage 2 diMN Media (S2)Li et al., 2021Cell culture media50% IMDM (Thermo Fisher 12440053) 50% Ham’s F12 nutrient mix (Thermo Fisher 11765062) 1× Non-essential amino acids (Thermo Fisher 11140050) 1× Penicillin-Streptomycin (Thermo Fisher 15140122) 1× B27 Supplement (Thermo Fisher 17504044) 1× N2 Supplement (Thermo Fisher 17502048) 0.2 µM LDN-193189 (Stemgent 04-0074) 10 µM SB431542 (STEMCELL Technologies 72234) 3 µM CHIR99021 (Millipore Sigma SML1046) 0.1 µM All-trans retinoic acid (Millipore Sigma R2625) 1 µM SAG (Cayman Chemicals 11914)
OtherStage 3 diMN Media (S3)Li et al., 2021Cell culture media50% IMDM (Thermo Fisher 12440053) 50% Ham’s F12 nutrient mix (Thermo Fisher 11765062) 1× Non-essential amino acids (Thermo Fisher 11140050) 1× Penicillin-Streptomycin (Thermo Fisher 15140122) 1× B27 Supplement (Thermo Fisher 17504044) 1× N2 Supplement (Thermo Fisher 17502048) 0.1 µM Compound E (Millipore Sigma 565790) 2.5 µM DAPT (Millipore Sigma D5942) 0.1 µM db-cAMP (Millipore Sigma 28745) 0.5 µM All-trans retinoic acid (Millipore Sigma R2625) 1 µM SAG (Cayman Chemicals 11914) 200 ng/mL Ascorbic acid (Millipore Sigma A4544) 10 ng/mL Brain-derived neurotrophic factor (PeproTech 450-02) 10 ng/mL Glial cell-derived neurotrophic factor (PeproTech 450-10)
OtherPBS+Cell culture solutionPhosphate-buffered saline (Gibco 10010023) 100 g/L MgCl2 (Sigma) 100 g/L CaCl2 (Sigma)

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Katrina M Zinn
  2. Mathew W McLaren
  3. Michael T Imai
  4. Malavika M Jayaram
  5. Jeffery D Rothstein
  6. Matthew J Elrick
(2026)
Enterovirus D68 2A protease causes nuclear pore complex dysfunction and independently contributes to motor neuron toxicity
eLife 14:RP108672.
https://doi.org/10.7554/eLife.108672.3