Tumors mimic the niche to inhibit neighboring stem cell differentiation
- Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, China
- Nankai International Advanced Research Institute (SHENZHEN FUTIAN), China
Figures
Figure 1 with 3 supplements
bam or bgcn mutant germline tumors inhibit the differentiation of neighboring wild-type GSCs.
(A) Schematic cartoon for early oogenesis. The red dots and branches indicate spectrosomes and fusomes, respectively. TF cell: terminal filament cell; GSC: germline stem cell. (B) Mosaic analysis strategy. The FLP recombinase triggers mitotic recombination by targeting FRT sequences. The nos>FLP method restricts FLP expression to the germline, while the hs-FLP method enables heatshock-inducible FLP expression. (C–F) Representative samples. The asterisks mark cap cells, and the arrows indicate SGCs that have exited the niche and are surrounded by bam or bgcn mutant germline tumors. Vasa, a germ cell marker, should label all germ cells. However, due to poor tumor permeability, staining often fails to detect tumorous germ cells in the central region (see Vasa panels in D–F). (G–I) Representative samples (z-stack projections). In (G), the arrowheads and arrow, respectively, mark two GSCs and one cystoblast, all containing dot-like spectrosomes, while the dotted lines delineate cystocytes with branched fusomes. In (H) and (I), the arrows denote SGCs that also contain dot-like spectrosomes, akin to GSCs and the adjacent GSC-like tumor cells. (J, K) Quantification data. bamBG is a strong loss-of-function allele of bam (Chen and McKearin, 2005). For each experiment, three independent replicates were performed, and data represent mean ± SEM. In (J), over 100 SGCs and germline cysts were quantified per replicate, and statistical significance was determined by one-way ANOVA. n.s. (P > 0.05). In (K), over 100 germaria were quantified per replicate.
Figure 1—figure supplement 1
SGCs appear in egg chambers.
(A, C) Representative samples. The arrows indicate SGCs enclosed within egg chambers. (B) Schematic of the experimental strategy for (C). See also Source data 1.
Figure 1—figure supplement 2
bam mutant germline clones enlarge as flies age.
(A) Representative samples. The dotted lines outline germline clones. All images are of the same magnification. (B) Quantification data. Over 30 germaria were quantified at each time point. Data represent mean ± SEM, and statistical significance was determined by one-way ANOVA. See also Source data 1 and 2.
Figure 1—figure supplement 3
Comparison of SGC phenotypes induced by the nos>FLP/FRT and hs-FLP/FRT systems.
(A) Representative samples. The arrows denote SGCs. All images are of the same magnification. (B) Quantification data. 14-day-old flies were used for the analyses. For each experiment, three independent replicates were performed, and over 100 SGCs and germline cysts were quantified per replicate. Data represent mean ± SEM. See also Source data 1 and 2.
Figure 2
The inhibition of SGC differentiation depends on the lack of Bam expression.
(A) Representative sample. The arrowhead marks a BamC-positive 4-cystocyte germline cyst, while the arrows indicate BamC-negative SGCs. (B) Representative sample. The asterisk denotes cap cells, and the dotted circles outline bamP-GFP-negative GSCs. The solid circle marks a bamP-GFP-positive cystoblast. The arrow and arrowhead point to bamP-GFP-negative and -positive SGCs, respectively. (C) Quantification data. 14-day-old flies were used for the analyses. CBs: cystoblasts. (D) Schematic of the experimental strategy for (E–H). In ‘with hs-bam’ flies (E, G), wild-type germ cells (both bam+/+ and bam+/-) carry the hs-bam transgene, while control ‘without hs-bam’ flies (F) lack this element in their wild-type germ cells. (E–G) Representative samples. The arrows mark SGCs with dot-like spectrosomes, while the arrowhead indicates a 4-cystocyte germline cyst containing branched fusomes. (H) Quantification data. For each experiment, three independent replicates were performed, with over 100 SGCs and germline cysts quantified per replicate. Data represent mean ± SEM, and statistical significance was determined by t test. n.s. (P > 0.05).
Figure 3
SGCs maintain lower BMP signaling levels than GSCs within the niche.
(A, B) Representative samples. The asterisks mark cap cells, arrowheads indicate pMad-positive GSCs, and arrows point to pMad-negative SGCs. (C) Representative samples. The asterisks denote cap cells, arrowheads mark Dad-lacZ-positive GSCs, and arrows highlight Dad-lacZ-positive SGCs. The dotted cycles outline one Dad-lacZ-negative SGC. (D, E) Quantification data. 14-day-old flies were used for the analyses. In (E), data represent mean ± SEM, and statistical significance was determined by t test. (F) Representative sample. The asterisk marks a cap cell, while the arrows indicate a BrdU+ GSC within the niche. (G) Representative sample. The arrow indicates a BrdU+ SGC surrounded by germline tumors. (H) Quantification data. 14-day-old flies were used for the analyses. Statistical significance was determined by chi-squared test.
Figure 4
BMP signaling inhibits SGC differentiation.
(A) Schematic of the experimental strategy for (B–F). Genotypes were unambiguously distinguished using a triple-color system (red, yellow, and green). (B–D) Representative samples. The dotted cycles mark an SGC, while the solid lines outline germline cysts containing differentiating cystocytes. (E, F) Quantification data. 14-day-old flies were used for the analyses. (G) Schematic of the experimental strategy for (H–J). (H, I) Representative samples. The dotted lines mark an SGC, while the solid lines outline a germline cyst containing differentiating cystocytes. (J) Quantification data. 14-day-old flies were used for the analyses. For each experiment, three independent replicates were performed, with over 100 SGCs and germline cysts quantified per replicate. Data represent mean ± SEM, and statistical significance was determined by t test.
Figure 5
Germline tumors secrete Dpp and Gbb.
(A, C) Representative samples. The asterisks denote cap/TF cells. The dotted lines highlight wild-type (WT) cystocytes, while the solid lines outline bam mutant germline tumor cells. The magenta box areas are enlarged below. (B, D) Quantification data for in situ HCR assays. 14-day-old flies were used for the analyses, and over 10 samples were quantified for each genotype. (E, F) Quantification data for RT-qPCR assays. 14-day-old flies were used for the analyses. For each experiment, three independent replicates were performed. Data represent mean ± SEM, and statistical significance in (B, D) was determined by one-way ANOVA and in (E, F) by t test.
Figure 6 with 3 supplements
Dpp and Gbb secreted by germline tumors are required to inhibit SGC differentiation.
(A) Schematic of the experimental strategy for (C–F). (B) Schematic of the experimental strategy for (G–I). (C-E, G, H) Representative samples. The arrows mark SGCs containing dot-like spectrosomes, while the arrowheads denote germline cysts with differentiating cystocytes that possess branched fusomes. (F, I) Quantification data for the SGC phenotype. 14-day-old flies were used for the analyses. For each experiment, three independent replicates were performed, with over 100 SGCs and germline cysts quantified per replicate. Data represent mean ± SEM. Statistical significance in (F) was determined by one-way ANOVA and in (I) by t test.
Figure 6—figure supplement 1
Monoallelic deletion of dpp or gbb does not affect GSC maintenance, germ cell differentiation, and female fly fertility.
(A–D) Representative samples. (E) Quantification data. 14-day-old flies were used for the analyses. GSCs are germ cells that are located within the niche and contain dot-like spectrosomes. Cystoblasts are germ cells that have exited the niche, remain in contact with GSCs, and maintain dot-like spectrosomes. Cystocytes in germline cysts are germ cells that are characterized by branched fusomes. (F) Fertility test. 3-day-old flies were used for the analyses. For each genotype, three independent replicates were performed. Data represent mean ± SEM, and statistical significance was determined by one-way ANOVA. n.s. (P > 0.05). See also Source data 1 and 2.
Figure 6—figure supplement 2
dpp bam or gbb bam double-mutant germline tumor cells divide more slowly than bam single-mutant ones.
(A, B, D, E) Representative samples. The arrows indicate BrdU+ germline tumor cells mutant for bam, dpp bam, or gbb bam. (C, F) Quantification data. 14-day-old flies were used for the analyses. Statistical significance was determined by chi-squared test. See also Source data 1 and 2.
Figure 6—figure supplement 3
The SGC phenotype is unchanged irrespective of the number of surrounding germline tumors.
(A) Representative samples. The arrows denote SGCs. All images are of the same magnification. (B) Quantification data for tumor size. Data represent mean ± SEM. (C) Quantification data for the SGC phenotype. In (B, C), 14-day-old flies were used for the analyses. Statistical significance in (B) was determined by t test and in (C) by chi-squared test. n.s. (P > 0.05). See also Source data 1 and 2.
Figure 7
A working model.
bam or bgcn mutant germline tumors secrete the BMP ligands Dpp and Gbb to activate BMP signaling in out-of-niche GSCs (called SGCs in this study) to inhibit their differentiation (left panel). In contrast, dpp bam and gbb bam double-mutant germline tumors exhibit a significant loss of this differentiation-inhibiting ability (right panel).
Author response image 1
In situ-HCR results of dpp and gbb in wild-type and bam mutant germaria.
Magenta ovals indicate empty areas displaying only background fluorescence. In panel (B), the yellow oval outlines a neighboring germarium, not an empty area (see the DAPI channel below).
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Drosophila melanogaster) | act-GAL4 | FlyBase Reference Report: Tepass, 2016.9.10, P{Act-GAL4.U} insertion. | ||
| Genetic reagent (D. melanogaster) | bamBG (strong loss-of-function allele) | Chen and McKearin, 2005 | ||
| Genetic reagent (D. melanogaster) | bamΔ86 (null allele) | Bloomington Drosophila Stock Center (BDSC) | 5427 | |
| Genetic reagent (D. melanogaster) | bamP-GFP | Chen and McKearin, 2003b | ||
| Genetic reagent (D. melanogaster) | bgcn1 (null allele) | BDSC | 6054 | |
| Genetic reagent (D. melanogaster) | bgcnMI06696 (strong loss-of-function allele) | BDSC | 40815 | |
| Genetic reagent (D. melanogaster) | Canton-S | BDSC | 64349 | |
| Genetic reagent (D. melanogaster) | Dad-lacZ | Kai and Spradling, 2003 | ||
| Genetic reagent (D. melanogaster) | dppd6 (hypomorphic allele) | BDSC | 2062 | |
| Genetic reagent (D. melanogaster) | dppd12 (hypomorphic allele) | BDSC | 2070 | |
| Genetic reagent (D. melanogaster) | EGFP FRT40A | BDSC | 5629 | |
| Genetic reagent (D. melanogaster) | FRT40A | BDSC | 1816 | |
| Genetic reagent (D. melanogaster) | FRT42D | BDSC | 1802 | |
| Genetic reagent (D. melanogaster) | FRT42D EGFP | BDSC | 5626 | |
| Genetic reagent (D. melanogaster) | FRT82B | BDSC | 86313 | |
| Genetic reagent (D. melanogaster) | FRT82B arm-lacZ | BDSC | 7369 | |
| Genetic reagent (D. melanogaster) | FRT82B EGFP | BDSC | 32655 | |
| Genetic reagent (D. melanogaster) | FRT82B RFP | BDSC | 30555 | |
| Genetic reagent (D. melanogaster) | gbb1 (null allele) | BDSC | 98344 | |
| Genetic reagent (D. melanogaster) | hs-bam on chromosome 3R | This paper | Construction information described in the Materials and methods section | |
| Genetic reagent (D. melanogaster) | mad12 (null allele) | BDSC | 51301 | |
| Genetic reagent (D. melanogaster) | med1 (null allele) | BDSC | 9033 | |
| Genetic reagent (D. melanogaster) | nos-GAL4-VP16 | BDSC | 4937 | |
| Genetic reagent (D. melanogaster) | P{bam+} | Zhang et al., 2023b | ||
| Genetic reagent (D. melanogaster) | punt135 (strong loss-of-function allele) | BDSC | 3100 | |
| Genetic reagent (D. melanogaster) | UASp-dpp-RNAi-1 | TsingHua Fly Center (THFC) | TH201500984.S | |
| Genetic reagent (D. melanogaster) | UASp-dpp-RNAi-2 | THFC | THU5880 | |
| Genetic reagent (D. melanogaster) | UASp-FLP | Zhang et al., 2023b | ||
| Genetic reagent (D. melanogaster) | UASp-gbb-RNAi | THFC | THU1480 | |
| Genetic reagent (D. melanogaster) | UASp-GFP | Zhang et al., 2024 | ||
| Genetic reagent (D. melanogaster) | UASp-yellow-RNAi | THFC | TH03150.N | |
| Genetic reagent (D. melanogaster) | UASz-FLP | Zhang et al., 2023b | ||
| Genetic reagent (D. melanogaster) | w1118 | BDSC | 3605 | |
| Antibody | Anti-α-Spectrin (Mouse monoclonal) | Developmental Studies Hybridoma Bank (DSHB) | RRID:AB_528473 | IF (1:100) |
| Antibody | Anti-BamC (Mouse monoclonal) | DSHB | RRID:AB_10570327 | IF (1:5) |
| Antibody | Anti-β-Gal | DSHB | RRID:AB_528101 | IF (1:200) |
| Antibody | Anti-BrdU (Mouse monoclonal) | Sigma | B5002 | IF (1:400) |
| Antibody | Anti-pMad (Rabbit polyclonal) | Zhao et al., 2018 | A gift from Ed Laufer, IF (1:500) | |
| Antibody | Anti-Vasa (Rabbit polyclonal) | Chen et al., 2014 | A gift from Zhaohui Wang, IF (1:2000) | |
| Antibody | Alexa Fluor 546 goat anti-mouse | Invitrogen | Cat# A-11030 | IF (1:1000) |
| Antibody | Alexa Fluor 546 goat anti-rabbit | Invitrogen | Cat# A11035 | IF (1:1000) |
| Antibody | Goat anti-rabbit 488 | Apexbio | K1206 | IF (1:1000) |
| Recombinant DNA reagent | bam cDNA clone | Berkeley Drosophila Genome Project | FI05606 | |
| Recombinant DNA reagent | pCaSpeR-hs | Drosophila Genomics Resource Center | RRID:DGRC_1215 | |
| Recombinant DNA reagent | attB-pCaSpeR-hs-bam | This paper | Construction information described in the Materials and methods section | |
| Sequence-based reagent | The hairpin sequence for in situ HCR | This paper | B1H1-594 | CGTAAAGGAAGACTCTTCCCGTTTGCTGCCCTCCTCGCATTCTTTCTTGAGGAGGGCAGCAAACGGGAAGAG |
| Sequence-based reagent | The hairpin sequence for in situ HCR | This paper | B1H2-594 | GAGGAGGGCAGCAAACGGGAAGAGTCTTCCTTTACGCTCTTCCCGTTTGCTGCCCTCCTCAAGAAAGAATGC |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaAGAGCATGGCCACGCTGTCCAGTTG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GCACCACCGTACTTTGGTCGTTGAGtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaTCGTAGCCCAGAGGCGCCACAATCC | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GGGCACTTCCCGTGGCAGTAATATGtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaTCTCGGCTGCCGCTTGTTCCGGCCG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GTCGTGGTTCTTGCGCCTCGTAGGCtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaGCTGCTTGTGCTGCCACCGCTCGTG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | CGTCGTCCGTGTAGGTGAACAGGAGtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaGGCCGGCTGGACATCGAGGCTCACC | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | CTGCGGACTCGCCAGCCACCGGTCCtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaCACCTGGTAGCGCGTCCGATTCGCC | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | CCCGACGCGCGTGATGTCGTAGACAtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaTGCTCTTCACGTCGAAGTGCAGCCG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | CCGCCTTCAGCTTCTCGTCGGCGGGtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaCCCATGATCTCGGCGTAGAGCTTCT | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GGGATGTTGACCGAGTCGAGCTCGTtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaAGCGCCTCCTTGCTGTAGGTGGACG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GGGTCTGGCTTCAGCTTGTCCTTGAtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaCACGAAGATTGATTCAATCGACGAG | |
| Sequence-based reagent | dpp probe for in situ HCR | This paper | GCGGTCGAGCACCAGCGTCGGCTCCtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaGGTGGTACAGAACGGGTAGTGCTCC | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | TTTTCAGGTTCACATTCTCGTCGTTtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaGCGTTCATGTGCGCATTGAGCGGGA | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | AGGGTCTGGACGATCGCATGGTTCGtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaGTACAGGGTCTGCATCTGGCAGCTG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | ATGCCAGCCCAGATCCTTGAAGTCTtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaTGCTCCTGTGGTGGCTGCTGTGGGC | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GCTTGCGTGGATGGCTGGCGCTTCGtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaATGTCGTCCAGCTTCACCTCGCGGT | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | TCGTCCACCTTGCGGTGGATCAGTCtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaGTTGAGCTCCAACCAGCCCACGTAG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | CAGCCACTCGTGCAGGCCCTCGGTCtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaACTCCCTGTTGGCGGTCAGCCACTT | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | TGCCAATGGCGTATACCGTGATGGTtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaCGACGGCCGTGCTCGTGACGCAGTT | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GGCACGTTGGAGACGTCGAACCACAtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaGTTCTTCTGCTGCTCGCCCTCATCC | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GGCCCGCTTGTCCAGGTCGGTGATGtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | GAGGAGGGCAGCAAACGGaaTGATGCGGTGGTAGACGTCCAGCAG | |
| Sequence-based reagent | gbb probe for in situ HCR | This paper | CCTGATCGCTGAGACCCTCCTCCGCtaGAAGAGTCTTCCTTTACG | |
| Sequence-based reagent | RT-qPCR primer | Huang et al., 2017 | dpp primer-1 | TACCACGCCATCCACTCAAC |
| Sequence-based reagent | RT-qPCR primer | Huang et al., 2017 | dpp primer-2 | GCTCGTTACTCGATACGGCT |
| Sequence-based reagent | RT-qPCR primer | Huang et al., 2017 | gbb primer-1 | CTGGATCATCGCACCAGAGG |
| Sequence-based reagent | RT-qPCR primer | Huang et al., 2017 | gbb primer-2 | GTCTGGACGATCGCATGGTT |
| Sequence-based reagent | RT-qPCR primer | Huang et al., 2017 | rp49 (internal control) primer-1 | CACCGGATTCAAGAAGTTCC |
| Sequence-based reagent | RT-qPCR primer | Huang et al., 2017 | rp49 (internal control) primer-2 | GACAATCTCCTTGCGCTTCT |
| Commercial assay or kit | ChamQ SYBR qPCR Master Mix | Vazyme | Q311 | |
| Commercial assay or kit | HiFiScript cDNA Synthesis Kit | CWBIO | CW2569M | |
| Commercial assay or kit | RNeasy Micro Kit | QIAGEN | 74004 | |
| Software, algorithm | Adobe Photoshop 2025 | San Jose, CA, USA | RRID:SCR_014199 | |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | |
| Software, algorithm | GraphPad Prism | GraphPad Software, Inc | RRID:SCR_002798 |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/108910/elife-108910-mdarchecklist1-v1.docx
-
Source data 1
All genotypes.
- https://cdn.elifesciences.org/articles/108910/elife-108910-data1-v1.xlsx
-
Source data 2
Raw quantification data.
- https://cdn.elifesciences.org/articles/108910/elife-108910-data2-v1.xlsx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Tumors mimic the niche to inhibit neighboring stem cell differentiation
eLife 14:RP108910.
https://doi.org/10.7554/eLife.108910.4
