HEB collaborates with TCR signaling to upregulate Id3 and enable γδT17 cell maturation in the fetal thymus
- Biological Sciences, Sunnybrook Research Institute, Canada
- Department of Immunology, University of Toronto, Canada
- Hospital for Sick Children, Canada
- Department of Molecular Biology, University of California, San Diego, United States
- Blood Cell Development and Function Program, Fox Chase Cancer Center, United States
Figures
Figure 1 with 1 supplement
Partial block in early γδ T cell development and decrease in Vγ4 cells in HEB-deficient mice.
(A) Stages of fetal mouse γδ T cell development. Thymocytes at the DN2 (CD4-CD8-CD44+CD25+) and DN3 (CD4-CD8-CD44-CD25+) stages of T cell development rearrange and express TCRγ, TCRδ, and TCRβ genes. DN3 cells with productive TCRβ chains expressing a pre-TCR are directed into the αβ-T cell lineage, characterized by upregulation of CD4 and CD8. Cells that express a cell surface γδTCR but have not yet committed to the γδ T cell lineage (γδTe, early γδ T cells) can still be diverted into the αβ T cell lineage (dotted line). γδTCR+ cells receiving a strong signal become CD73+γδT1 cell progenitors (γδT1p) that mature into IFNγ-producing γδT1 cells, whereas cells that receive an intermediate signal become γδT17 cell progenitors (γδT17p) that mature into IL-17-producing γδT17 cells. Downregulation of CD24 and CD27, and upregulation of CD44, marks maturation of γδT17 cells, whereas γδT1 cell maturation is characterized by downregulation of CD24 and maintenance of CD73 and CD27 expression. (B) γδ T cell nomenclature. Vγ and Vδ TCR chain genes and proteins can be identified by several different naming systems. Here, we use the Tonegawa nomenclature to refer to the proteins, and the International Immunogenetics Information System (IMGT) for the genes and transcripts. R-Seurat-generated plots use the Mouse Genome Informatics (MGI) nomenclature. The numbering for genes and proteins in these three systems are identical except for the TRDV4 gene, which encodes the Vγ1 protein (highlighted in red). (C) Absolute numbers of cells per thymus in wild-type (WT) (blue) and HEB conditional knockout (cKO) (orange) embryonic day 18 (E18) fetal mice. (D, E) Percentages of γδ T cells in WT and HEB cKO fetal thymus. (F) Absolute number of γδ T cells per thymus in WT and HEB cKO fetal thymus. (G) Flow cytometry plots of Vγ4+ and Vγ1+ cells within the γδ T cell population in WT and HEB cKO fetal thymus. (H) Flow cytometry plot of Vγ5 and Vγ6 (Vγ1-Vγ5-) expression on cells within the Vγ1-Vγ4- population. (I) Percentages of Vγ1+, Vγ4+, Vγ5+, and Vγ6+ cells out of all γδ T cells in the WT and HEB cKO fetal thymus. (J) Absolute numbers of Vγ1+, Vγ4+, Vγ5+, and Vγ6+ cells per WT and HEB cKO fetal thymus. (K) Percentages of immature (CD24+) and mature (CD24-) γδ T cells out of all γδ T cells in each Vγ subset in WT and HEB cKO fetal thymus. (L) Expression of IL-17A protein in γδ T cells from E18 thymus stimulated with PMA/ionomycin as assessed by intracellular staining. Experiments were done two to three times, and results were pooled for analysis. Each biological replicate is depicted as an open circle on the bar graphs. Blue = WT, orange = HEB cKO. Significant differences between WT and HEB cKO subsets were determined using unpaired classic Student’s t-tests. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
Figure 1—figure supplement 1
Defects in αβ T cell development in embryonic day 18 (E18) fetal thymus of HEB conditional knockout (cKO) mice.
Thymocytes were dissected from E18 wild-type (WT) and HEB cKO littermates and subjected to flow cytometry. At E18, very few cells had become CD4 or CD8 single positive cells, with most cells at the double positive (DP) stage in WT mice. The double negative (DN) to immature single positive (ISP) and ISP to DP transitions were severely compromised in the HEB cKO fetal thymus, in agreement with previous reports of HEB-deficient adult mice.
Figure 2 with 1 supplement
Identification of γδ T cell subsets in wild-type (WT) and HEB conditional knockout (cKO) fetal thymus by single-cell RNA sequencing (scRNA-seq).
γδ T cells were sorted from embryonic day 18 (E18) fetal thymuses from WT (3) or HEB cKO (3) mice, pooled according to genotype, and subjected to scRNA-seq and analysis. (A) Uniform manifold approximation and projection (UMAP) plots depicting merged WT and HEB cKO cells in eight clusters (0–7). (B) Grouped UMAP showing the distribution of WT (blue) and HEB cKO (orange) cells across all clusters. (C) Split UMAP plots showing the distribution of cells in WT (left) and HEB cKO (right) clusters; note that cluster 4 is restricted to WT cells, and cluster 1 is heavily biased toward HEB cKO cells. (D) Genes previously identified as signatures for developmental and functional γδ T cell subsets were compiled from previously published reports. The top 10 most differentially expressed genes from this list were visualized as a clustered dot plot, which was used to assign cluster identities. Two clusters corresponding to early γδ T cells were randomly designated as γδTe1 and γδTe2. (E) Numbers of WT (blue) and HEB cKO (orange) cells per cluster. (F) Unbiased clustered dot plot of the top 10 most differentially expressed genes across all clusters. In the clustered dot plots, the percentage of cells expressing the gene in each cluster is depicted by the size of the dot, and the color indicates the relative magnitude of expression across clusters.
-
Figure 2—source data 1
References for curated gene list used to identify differentially expressed genes and assign cluster identities in Figures 2 and 6.
See spreadsheet.
- https://cdn.elifesciences.org/articles/109197/elife-109197-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
TRGV and TRDV expression profiling reveals depletion of TRGV4 and TRDV5 transcripts and overexpression of TRDV4 in the HEB conditional knockout (cKO) fetal γδ T cells.
(A) Violin plots of expression of canonical genes that mark γδ T cell subsets. (B) Violin plots showing expression of TRGV and TRDV genes in wild-type (WT) versus HEB cKO by cluster. WT = blue, HEB cKO = orange. (C) Blended split feature plots showing cells expressing TRGV chains (blue) or TRDV chains (red), and cells co-expressing TRGV and TRDV chains (pink). Co-expression in WT cells is shown on the top panel of each comparison, and HEB cKO cells are shown on the bottom.
Figure 3
The αβ T gene program is expanded, and the γδT17 precursor gene program is lost in HEB conditional knockout (cKO) cells.
γδ T cells sorted from embryonic day 18 (E18) fetal thymuses from wild-type (WT) and HEB cKO mice were subjected to single-cell RNA sequencing (scRNA-seq) and analysis. (A, B) Gene modules were generated from subset-biased genes, and cells were scored for each module. Module scores are depicted as split feature plots, with wild-type (WT) plots on the left and HEB cKO plots on the right. Module scores that characterize γδ T cell subsets are shown in (A), and a module score for the αβ-T lineage is shown in (B). (C–F) Split violin plots of genes that typify different γδ T cell subsets as follows: (C) γδTe/γδT17p cells, (D) αβ T cells, (E) γδT17 cells, (F) γδT1p and γδT1 cells. Blue = WT, orange = HEB cKO.
Figure 4 with 1 supplement
Decreases in T cell effector differentiation and T cell receptor (TCR) signaling genes in γδT17p cells from HEB conditional knockout (cKO) mice.
(A) Volcano plots showing differential gene expression in γδT17p cells from wild-type (WT) versus HEB cKO fetal thymus. Genes expressed at higher levels in HEB cKO cells are on the left, and genes expressed at lower levels in HEB cKO cells are on the right. Significance (pink) was set at log2FC>0.5 and –log10p<1025. (B) Gene ontology analysis of genes significantly reduced in HEB cKO γδT17p cells relative to WT, with significance set at avg log2FC>0.25 and adjusted p-value<0.001. Bar plots show pathway enrichment (fold enrichment) and significance by false discovery rate (FDR) for each functional category defined in the Kyoto Encyclopedia of Genes and Genomics (KEGG) pathway list. Minimum genes for pathway inclusion was set at 5, and FDR cutoff was set at 0.05. (C) Relative expression of genes associated with strong TCR signaling in WT and HEB cKO cells in each cluster. (D) Relative expression of Id3 in immature γδ T cell subsets from WT and HEB cKO mice. (E) Split feature plots showing expression of Id3 across all clusters in WT versus HEB cKO cells. (F) Relative expression of Maf and Rorc in WT versus HEB cKO γδT cell subsets. WT = blue, HEB cKO = orange.
-
Figure 4—source data 1
Differentially expressed genes between wild-type (WT) and HEB conditional knockout (cKO) γδT17 precursor populations from Figure 4A.
See spreadsheet.
- https://cdn.elifesciences.org/articles/109197/elife-109197-fig4-data1-v1.xlsx
-
Figure 4—source data 2
Enriched Kyoto Encyclopedia of Genes and Genomics (KEGG) pathways and gene members between wild-type (WT) and HEB conditional knockout (cKO) γδT17 precursor populations, as shown in Figure 4B.
See spreadsheet.
- https://cdn.elifesciences.org/articles/109197/elife-109197-fig4-data2-v1.xlsx
Figure 4—figure supplement 1
Patterns of E protein and Id protein gene expression during γδ T cell development in wild-type (WT) and HEB conditional knockout (cKO) mice.
(A) Relative expression of Tcf12 (HEB), Tcf3 (E2A), Id3, and Id2 in WT versus HEB cKO cells by cluster. WT = blue, HEB cKO = orange. (B–F) Co-expression of E protein and Id protein transcripts assessed by blended split feature plots, for (B) Tcf12 and Tcf3, (C) Tcf12 and Id3, (D) Tcf3 and Id3, (E) Tcf12 and Id2, and (F) Tcf3 and Id2. Pink = co-expression.
Figure 5 with 1 supplement
Fetal γδ T cells from Id3-KO mice are defective in CD73 upregulation and interleukin-17 (IL-17) production.
(A) Absolute numbers of cells per embryonic day 18 (E18) fetal thymus from wild-type (WT) and Id3-KO littermate mice. (B, C) Quantification (B) and flow cytometry plots (C) of the percentages of γδ T cells out of all thymocytes. (D, E) Flow cytometry plots (D) and quantification (E) of Vγ1+ and Vγ4+ out of all γδ T cells. (F) Percentages of Vγ5+ and Vγ6+ out of all γδ T cells. (G) Flow cytometry plots of CD24 and CD73 expression in γδTCR+ cells. (H) Quantification of mature (CD24-) CD73+ and CD73- γδ T cells out of all γδ T cells. (I) Flow cytometry plots of expression of CD27 and CD73 expression in unstimulated (top) and stimulated (bottom) γδ T cells. (J) Percentages of CD27+CD73+ cells out of all γδ T cells under unstimulated or stimulated conditions. (K, L) Flow cytometry (K) and quantification (L) of the percentages of CD27-CD73-CD24- (primarily mature Vγ6) cells expressing IL-17 in response to stimulation. Experiments were done two to three times, and results were pooled for analysis. Each biological replicate is depicted as an open circle on the bar graphs. Blue = WT, pink = Id3 KO. P/I=phorbol 12-myristate 13-acetate (PMA)+ionomycin. Significant differences between WT and Id3-KO subsets were determined using unpaired classic Student’s t-tests. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
Figure 5—figure supplement 1
CD73 is upregulated during development of Vγ5 and Vγ1 γδ T cells in wild-type (WT) but not Id3-KO fetal thymus.
Flow cytometry plots of CD24 and CD73 expression within the Vγ subsets from WT and Id3-KO embryonic day 18 (E18) fetal thymus.
Figure 6 with 2 supplements
Intact γδ T commitment gene program and impaired γδT17 maturation program in Id3-KO mice.
(A) Flow cytometry plots showing the percentages of cells expressing PLZF and/or MAF in immature (CD24+) Vγ4 and Vγ6 cells, and in mature (CD24-) Vγ6 cells (note that mature Vγ4 cells are not present in the embryonic day 18 [E18] fetal thymus). (B) Quantification of the percentages of cells expressing PLZF and MAF (top), PLZF only (middle), or neither (bottom) within the immature Vγ4 and Vγ6 subsets, and the mature Vγ6 subset. (C) Mean fluorescent intensities of PLZF in the PLZF+MAF+ and PLZF+MAF- populations within the immature and mature Vγ subsets. (D, E) scRNA-seq UMAP plots of γδ T cells as merged (D) or split (E) into wild-type (WT) versus Id3-KO populations. (F) Number of WT and Id3-KO cells per cluster. (G) Clustered dot plot of curated gene sets used to assign γδT17p, γδTe, γδT17, and γδT1 identities. (H) Expression of γδ T cell commitment genes in WT versus Id3-KO cells by cluster. (I) Expression of γδT17 maturation genes in WT versus Id3-KO cells by cluster. Experiments were done two to three times, and results were pooled for analysis. Each biological replicate is depicted as an open circle on the bar graphs. Blue = WT, pink = Id3 KO. Significant differences between WT and Id3-KO subsets were determined using unpaired classic Student’s t-tests. **p<0.01, ***p<0.001, ****p<0.0001.
Figure 6—figure supplement 1
Identification of γδ T cell subsets from embryonic day 18 (E18) wild-type (WT) and Id3-KO double negative (DN) cells using single-cell RNA sequencing (scRNA-seq).
WT and Id3-KO E18 thymocytes were pooled and subjected to magnetic sorting to obtain CD4-CD8- (DN) cells for scRNA-seq. (A) Uniform manifold approximation and projection (UMAP) of merged dataset depicting 11 clusters (0–10). (B) Expression of lineage-defining genes to assign identities to clusters in merged dataset: Cd3e for T lineage, Sox13 for γδT lineage, Maf for myeloid, and γδT17 lineages, and Il2rb and Xcl1 for γδT1 lineage, and Spi1 (encodes PU.1) for myeloid lineage. (C) Expression of genes defining DN subsets: Cpa3 for DN2 and γδ T cells, Il2ra (encodes CD25) for DN2/3 cells, Ptcra (encodes pre-Ta) for DN3 cells, and Id3 for γδ T cells and DN4 cells. Cd8b1 is upregulated transcriptionally before surface expression and marks αβ-T lineage commitment within DN4 cells. Cd4 was undetectable, validating our MACS enrichment strategy. (D) Expression of Rorc in WT versus Id3-KO cells in γδ T cell subsets. (E) Rorc expression in all WT and Id3-KO clusters.
Figure 6—figure supplement 2
γδTCR+ cells from embryonic day 18 (E18) Id3-KO mice include a population of CD4+CD8+ cells, indicating diversion to the αβ-T lineage program.
E18 fetal thymocytes were subjected to flow cytometry. Cells were gated on the TCRγδ+CD3+ population and analyzed for expression of CD4 and CD8 which was quantified in a bar graph depicting the percentage of CD4+CD8+ (DP) cells within the γδTCR+ population. Experiments were done two to three times, and results were pooled for analysis. Each biological replicate is depicted as an open circle on the bar graphs. Significance between WT and Id3-KO subsets was determined using unpaired classic Student’s t-tests. ****p<0.0001.
Figure 7 with 2 supplements
Synergistic upregulation of Id3 by HEB and CD3 signaling.
(A) ChIP-seq data analysis of the binding of HEB, E2A, RNA polymerase, and Egr2, and the extent of H3K27me3 chromatin modification, in DN3 and/or DN4 cells at the Id3 gene locus, obtained from publicly available datasets (see Materials and methods for accession numbers). The cell type and antibody used in each experiment are indicated to the right of the tracks. Peaks bound by HEB, E2A, and/or Egr2 are indicated in boxes. Inset shows the Id3 exons and the adjacent Gm42329 long non-coding RNA. (B) Diagram of experimental design. SCID.adh cells transduced with HEBAlt or control retroviral vectors were cultured for 16 hr in the presence or absence of the anti-TAC antibody, which induces signaling through the CD3 complex. (C, E) Flow cytometry plots (C) and quantification (E) of CD25 upregulation with and without stimulation and/or HEB expression. (D) Id3 mRNA expression relative to β-actin as determined by quantitative RT-PCR. Rag = Rag2-/- mouse thymocytes, which are arrested at the DN3 stage of development. Experiments were done two times, and results were pooled for analysis. Each biological replicate is depicted as an open circle on the bar graphs. Significant differences were determined using unpaired classic Student’s t-tests. **p<0.01, ***p<0.001, ****p<0.0001.
Figure 7—figure supplement 1
Accessibility and occupancy of Id3 locus elements by HEB, E2A, and Egr2 before and after pre-T cell receptor (TCR) or γδTCR signaling.
(A) Rag2-/- DN3 cells were transduced with the KN6 γδTCR (DN3 + γδTCR) or not (DN3) and stimulated with γδTCR ligand, followed by ChIP-seq analysis of HEB (green) and E2A (blue) binding. Peaks in the Id3 locus were aligned to Egr2 ChIP data to locate overlapping sites of binding. These peaks were also aligned to context-specific accessibility peaks obtained from ATAC-seq analysis of Rag2-/- DN3 (pre-selection) cells, and DN3 and DN4 (post-selection) cells from wild-type (WT) and HEB conditional knockout (cKO) mice. Representative traces from one of two replicates are shown. Sites showing overlapping HEB/E2A/Egr2 peaks and decreased accessibility in HEB cKO samples are designated as HE1 and HE2. Circled peaks indicate a lower degree of accessibility in HEB cKO mice. (B) Transcription factor binding motifs for HEB/E2A (E box; blue) and Egr2 (Egr; red) were identified in HE1 and HE2 in close proximity to each other. Colors of sequence bars indicate intensity of ChIP-seq signal, as shown in (A). It should be noted that HEB/E2A binding, but not Egr2 binding, is dampened in post-selection cells, as expected due to the increase in Id3 expression. Ranges of ATAC-seq traces were kept constant to allow direct comparisons.
Figure 7—figure supplement 2
Model for HEB and Id3 requirements in the development and maturation of γδT17 cells.
(A) Strong γδTCR signaling induces high levels of Egr2, which are sufficient to drive Id3 upregulation without HEB, whereas HEB is also required under lower γδTCR signaling conditions. Distinct cytokine signals also participate in Id3 modulation and γδ T cell lineage choice. (B) γδT17 development occurs in two stages, the first of which is HEB-dependent, and the second of which is Id3-dependent. HEB induces Id3 during the first stage, which acts in a negative feedback loop to inhibit HEB activity during the second stage. The absence of Id3 allows higher E protein activity, which inhibits second stage regulators but also results in Id2 upregulation, providing partial compensation for the loss of Id3.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Tcf12 | GenBank | GenBank:NM_011544.3 | Encodes HEB isoforms HEBAlt and HEBCan |
| Gene (Mus musculus) | Id3 | GenBank | GenBank:NM_008321.3 | Encodes Id3 |
| Strain, strain background (Mus musculus, C57BL/6, male and female) | Tcf12fl/fl (HEBfl/fl) | PMID:17442955 | Not commercially available, provided upon request | Conditional Tcf12 floxed allele; bred to Vav-iCre to generate HEB cKO mice |
| Strain, strain background (Mus musculus, C57BL/6, male and female) | Vav-iCre | The Jackson Laboratory | IMSR:JAX:008610; RRID:IMSR_JAX:008610 | B6.Cg-Commd10Tg(Vav1-icre)A2Kio/J; hematopoietic Cre driver |
| Strain, strain background (Mus musculus, C57BL/6, male and female) | Id3-KO (Id3-RFP) | The Jackson Laboratory | IMSR:JAX:010983; RRID:IMSR_JAX:010983 | B6;129S-Id3tm1Pzg/J; backcrossed to C57BL/6 for 8 generations |
| Strain, strain background (Mus musculus, C57BL/6, male and female) | Rag2-KO | The Jackson Laboratory | IMSR:JAX:008449; RRID:IMSR_JAX:008449 | B6.Cg-Rag2tm1.1Cgn/J; lacks mature T and B cells |
| Cell line (Mus musculus) | SCID.adh | PMID:10452996 | Not commercially available, provided upon request | Pro-T cell line derived from SCID mice expressing a hybrid hIL2-CD3e signaling molecule; verified by flow cytometry (CD44+/–, CD25+) and downregulation of CD25 upon stimulation |
| Recombinant DNA reagent | MIGR1-HEBAlt retroviral vector | PMID:20826759 | Not commercially available, provided upon request | MSCV retroviral vector encoding HEBAlt downstream of an IRES-GFP; used to transduce SCID.adh cells; HEBAlt corresponds to Tcf12 transcript variant 4 (GenBank:NM_001253864.1) |
| Antibody | PE anti-CD4 (rat monoclonal, clone GK1.5) | Thermo Fisher Scientific | Cat#:12-0041-82; RRID:AB_465506 | (FACS, 1:200) |
| Antibody | FITC anti-mouse CD8a (rat monoclonal, clone 53–6.7) | BioLegend | Cat# 100705; RRID:AB_312744 | (FACS, 1:200) |
| Antibody | BUV737 anti-CD4 (rat monoclonal, clone GK1.5) | Thermo Fisher Scientific | Cat#:367-0041-82; RRID:AB_2895921 | (FACS, 1:200) |
| Antibody | APC-eFluor 780 anti-mouse CD8a (rat monoclonal, clone 53-6.7) | Thermo Fisher Scientific | Cat#:47-0081-82; RRID:AB_1272185 | (FACS, 1:200) |
| Antibody | PE-Cy7 anti-mouse CD25 (rat monoclonal, clone PC61.5) | BD Biosciences | Cat#:551071; RRID:AB_394031 | (FACS, 1:200) |
| Antibody | Alexa Fluor 700 anti-mouse CD3e (Armenian hamster monoclonal, clone 145-2C11) | BioLegend | Cat#:100236; RRID:AB_2561455 | (FACS, 1:200) |
| Antibody | BV605 anti-mouse CD73 (rat monoclonal, clone TY/11.8) | BD Biosciences | Cat#:752734 | (FACS, 1:200) |
| Antibody | BUV496 anti-mouse CD24 (rat monoclonal, clone M1/69) | BD Biosciences | Cat#:612953 | (FACS, 1:200) |
| Antibody | BUV737 anti-mouse CD27 (hamster monoclonal, clone LG.7F9) | BD Biosciences | Cat#: 612831 | (FACS, 1:200) |
| Antibody | PE anti-mouse PLZF (mouse monoclonal, clone R17-809) | BD Biosciences | Cat#:564850 | (FACS, 1:200) |
| Antibody | eFluor 450 anti-mouse c-Maf (mouse monoclonal, clone sym0F1) | Thermo Fisher Scientific | Cat#:48-9855-42; RRID:AB_2762608 | (FACS, 1:200) |
| Antibody | APC anti-mouse IL-17A (rat monoclonal, clone eBio17B7) | Thermo Fisher Scientific | Cat#:17-7177-81 | (FACS, 1:200) |
| Antibody | PerCP-eFluor 710 anti-mouse TCRgd (Armenian hamster monoclonal, clone GL3) | Thermo Fisher Scientific | Cat#:46-5711-82; RRID:AB_2016707 | (FACS, 1:200) |
| Antibody | BV421 anti-mouse TCRgd (hamster monoclonal, clone GL3) | BD Biosciences | Cat#:562892 | (FACS, 1:200) |
| Antibody | BV711 anti-mouse Vgamma1.1 TCR (Armenian hamster monoclonal, clone 2.11) | BD Biosciences | Cat#:745456 | (FACS, 1:200) |
| Antibody | PE anti-mouse Vgamma3 (rat monoclonal, clone 536) | BioLegend | Cat#:137504; RRID:AB_2562450 | (FACS, 1:200); commercial anti-Vgamma3 is referred to as Vgamma5 in the manuscript |
| Antibody | FITC anti-mouse Vgamma3 (rat monoclonal, clone 536) | BD Biosciences | Cat#:553229; RRID:AB_394747 | (FACS, 1:200); commercial anti-Vgamma3 is referred to as Vgamma5 in the manuscript |
| Antibody | PE-Cy7 anti-mouse Vgamma2 (Armenian hamster monoclonal, clone UC3-10A6) | Thermo Fisher Scientific | Cat#:25-5828-82; RRID:AB_2573474 | (FACS, 1:200); commercial anti-Vgamma2 is referred to as Vgamma4 in the manuscript |
| Antibody | APC anti-mouse Vgamma2 (Armenian hamster monoclonal, clone UC3-10A6) | BioLegend | Cat#:137707; RRID:AB_2563942 | (FACS, 1:200); commercial anti-Vgamma2 is referred to as Vgamma4 in the manuscript |
| Antibody | Anti-TAC/anti-human IL-2R alpha (mouse monoclonal) | PMID:33535043 | Not commercially available, provided by request | Plate-bound at 5 µg/mL; binding to human IL-2Ra on SCID.adh cells mimics pre-TCR signaling |
| Antibody | Anti-E2A (rabbit polyclonal) | PMID:33535043 | Other | (ChIP-seq, 10 µg/IP); affinity-purified rabbit polyclonal sera raised against the last 12 amino acids of the E2A C-terminus; see previously described ChIP-seq methods |
| Antibody | Anti-HEB (rabbit polyclonal) | PMID:33535043 | Other | (ChIP-seq, 10 µg/IP); affinity-purified rabbit polyclonal sera raised against the last 12 amino acids of the HEB C-terminus; see previously described ChIP-seq methods |
| Sequence-based reagent | Id3 qRT-PCR primer set | Integrated DNA Technologies | Other | Forward: CTGTCGGAACGTAGCCTGG; Reverse: GTGGTTCATGTCGTCCAAGAG |
| Sequence-based reagent | Actb (beta-actin) qRT-PCR primer set | Integrated DNA Technologies | Other | Forward: ATGGTGGGAATGGGTCAGAA; Reverse: TCTCCATGTCGTCCCAGTTG |
| Commercial assay or kit | LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation | Thermo Fisher Scientific | Cat#:L34957 | Flow cytometry |
| Commercial assay or kit | SuperScript III First-Strand Synthesis System | Invitrogen | Cat#:18080051 | cDNA synthesis for qRT-PCR |
| Commercial assay or kit | Chromium Next GEM Single Cell 5' Kit v2 (Dual Index) | 10x Genomics | Cat#:PN-1000263 | scRNA-seq |
| Commercial assay or kit | Chromium Next GEM Single Cell 3' Kit v2 (Dual Index) | 10x Genomics | Cat#:PN-1000268 | scRNA-seq |
| Commercial assay or kit | PowerUp SYBR Green Master Mix | Thermo Fisher Scientific | Cat#:A25742 | qRT-PCR |
| Commercial assay or kit | FIX & PERM Cell Permeabilization Kit | Thermo Fisher Scientific | Cat#:88-8824-00 | Catalog number reported in supplied file |
| Commercial assay or kit | Foxp3/Transcription Factor Staining Buffer Set | Thermo Fisher Scientific | Cat#:00-5523-00 | Intracellular flow cytometry |
| Chemical compound, drug | TRIzol Reagent | Invitrogen | Cat#:15596026 | RNA extraction |
| Chemical compound, drug | Brefeldin A Solution (1000×) | Thermo Fisher Scientific | Cat#:00-4506-51 | Inhibition of cytokine secretion |
| Software, algorithm | BD FACSDiva Software | BD Biosciences | RRID:SCR_001456 | Flow cytometry acquisition and analysis |
| Software, algorithm | FlowJo | FlowJo, LLC | RRID:SCR_008520 | Flow cytometry analysis |
| Software, algorithm | STAR (v2.5.2b) | Dobin et al.; SciCrunch | RRID:SCR_004463 | FASTQ alignment to the mm39 genome |
| Software, algorithm | SAMTOOLS (v0.1.19) | HTSlib/SciCrunch | RRID:SCR_002105 | BAM file processing |
| Software, algorithm | BEDTools (v2.25.0) | bedtools/SciCrunch | RRID:SCR_006646 | BED file processing |
| Software, algorithm | Cell Ranger (v1.1.7) | 10x Genomics | RRID:SCR_017344 | Read alignment and matrix generation |
| Software, algorithm | Seurat (v4.4) | Hao et al., 2021; Satija Lab | RRID:SCR_016341 | Single-cell RNA-seq analysis; R markdown files used for downstream analysis |
| Software, algorithm | KEGG | Kanehisa Laboratories; SciCrunch | RRID:SCR_012773 | Pathway analysis |
| Software, algorithm | Cistrome Data Browser | Cistrome | RRID:SCR_000242 | Retrieval of public ChIP-seq and ATAC-seq datasets |
| Software, algorithm | Integrative Genomics Viewer (IGV) | Broad Institute | RRID:SCR_011793 | Visualization of genome-aligned sequencing data |
| Software, algorithm | ShinyGO | ShinyGO | RRID:SCR_019213 | Gene ontology analysis |
| Software, algorithm | Immunological Genome Project (ImmGen) | ImmGen | RRID:SCR_021792 | Immune cell gene expression database |
| Other | Anti-CD4 MicroBeads | Miltenyi Biotec | Cat#:130-117-043 | MACS enrichment |
| Other | Anti-CD8a MicroBeads | Miltenyi Biotec | Cat#:130-117-044 | MACS enrichment |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
HEB collaborates with TCR signaling to upregulate Id3 and enable γδT17 cell maturation in the fetal thymus
eLife 14:RP109197.
https://doi.org/10.7554/eLife.109197.3
