Sex-biased expression of enteroendocrine cell-derived hormones contributes to higher fat storage in Drosophila females

  1. Puja Biswas
  2. Elizabeth J Rideout  Is a corresponding author
  1. Department of Cellular and Physiological Sciences, Life Sciences Institute, The University of British Columbia, Canada

eLife Assessment

This useful study provides a systematic comparison of sex-biased enteroendocrine hormone expression in Drosophila and suggests that gut-derived peptides may contribute to female-biased triglyceride levels. The revised manuscript includes helpful textual clarifications and an integrative model, but the evidence remains incomplete, because the proposed role of Tk is still over-interpreted relative to authors' stated criterion for statistical significance against both parental controls. The work will be of interest to researchers studying sex differences in metabolism, but the central mechanistic claims require either stronger experimental support or more careful qualification.

https://doi.org/10.7554/eLife.109426.3.sa0

Abstract

Enteroendocrine (EE) cells in the Drosophila gut produce and release multiple factors, including Allatostatin A (AstA), Allatostatin C (AstC), neuropeptide F (NPF), tachykinin (Tk), Diuretic hormone 31 (Dh31), Bursicon, CCHamide 1, CCHamide 2, and short neuropeptide F. Collectively, these peptides ensure that physiology (e.g., fat storage, fluid balance) and behavior (e.g., feeding, sleep) are coordinated with environmental factors such as nutrient quantity and quality. Despite notable sex differences in physiology and behavior, it remains unclear whether the regulation and function of these EE cell-derived factors are shared between males and females. Given that recent data identified sex-biased physiological effects of two EE cell-derived hormones on Drosophila food intake and energy mobilization, we performed a detailed characterization of these hormones in male and female flies. Despite an overall male bias in mRNA levels of AstA, AstC, Tk, NPF, and Dh31 in whole-body and head samples, we observed a strong female bias in mRNA levels of AstC, Tk, and NPF in the gut. To determine whether this sex-biased regulation was physiologically significant, we monitored triglyceride levels in flies with gut-specific knock-down of EE cell-derived hormones. In 5-day-old flies, knock-down of EE cell-derived AstC significantly reduced fat storage in females with no effect in males, whereas knock-down of EE cell-derived Tk produced a non-significant trend toward reduced fat storage in females. These female-specific effects on fat storage were reproduced in flies with neuron-specific knock-down of the AstC (AstC-R2) and Tk receptors (TkR99D). Together, these data uncover strongly sex-biased regulation of EE cell-derived hormones and show that gut-specific knock-down of at least one of these hormones had a female-specific effect on body fat.

Introduction

In Drosophila, females store more fat than males (De Groef et al., 2021; Lease and Wolf, 2011; Parisi et al., 2011; Schwasinger-Schmidt et al., 2012; Sieber and Spradling, 2015; Wat et al., 2020; Wat et al., 2021). Greater female fat storage has been observed in both mated and unmated females compared with age-matched males (De Groef et al., 2021; Parisi et al., 2011; Schwasinger-Schmidt et al., 2012; Sieber and Spradling, 2015; Wat et al., 2020; Wat et al., 2021). In flies, as in other animals, triglyceride is the main form of stored fat. Although triglyceride is present in many cell types and organs (e.g., oenocytes, glia, neurons, and gut) (Sieber and Spradling, 2015; Wat et al., 2020; Chao et al., 2024; Gutierrez et al., 2007; Kis et al., 2015; Kühnlein, 2011; Kühnlein, 2012; Sieber and Thummel, 2009; Villanueva et al., 2019), the majority of triglyceride is stored in an organ called the fat body (Parisi et al., 2011; Kühnlein, 2011; Arrese and Soulages, 2010).

In females, high levels of triglyceride in the fat body play a key role in supporting reproduction and physiology (Sieber and Spradling, 2015; Buszczak et al., 2002). Indeed, triglyceride from the fat body is a key energy source for the developing embryo (Matsuoka et al., 2017). Increased fat storage in adult females also supports prolonged survival during nutrient deprivation compared with males (Schwasinger-Schmidt et al., 2012; Wat et al., 2020). Despite these clear benefits of greater fat storage for female fertility, excess fat accumulation in males adversely affects their reproductive output. Specifically, males carrying a mutation that promotes excess triglyceride accumulation show reduced testis size, defects consistent with delays in spermatogenesis, and ultimately a reduction in sperm number (Chao et al., 2024). The sex difference in fat storage therefore likely reflects the fact that males and females differ in how much whole-body triglyceride storage supports optimal fertility.

Recent studies have identified genes and pathways that contribute to sex differences in fat storage (Sieber and Spradling, 2015; Wat et al., 2020; Wat et al., 2021; Biswas et al., 2025). In mated females, the steroid hormone ecdysone acts on neurons to promote food intake, which is associated with increased body fat (Sieber and Spradling, 2015). In unmated adult females, the insulin/insulin-like growth factor signaling pathway (IIS) plays a key role in maintaining an elevated level of triglyceride storage compared with adult males (Biswas et al., 2025). Specifically, adult females have higher production of Drosophila insulin-like peptide 3 (Dilp3) and greater insulin sensitivity, leading to higher IIS activity. This elevated IIS activity is important for females to store more triglyceride than males, as adult-specific ablation of the insulin-producing cells (IPCs) reduces body fat in females but not males (Biswas et al., 2025).

In males, body fat levels are maintained by higher expression and activity of two catabolic pathways that promote fat breakdown. One pathway is regulated by triglyceride lipase brummer (bmm), where males show higher bmm mRNA levels compared with females (Wat et al., 2020). This elevated bmm expression contributes to the sex difference in fat storage by restricting triglyceride accumulation in males. Similarly, males have higher production and secretion of Adipokinetic hormone (Akh), a key lipolytic hormone in insects (Wat et al., 2021). As with bmm, high levels of Akh in males contribute to the sex difference in fat storage by limiting fat accumulation in males (Wat et al., 2021). Together, these studies have defined a model of the sex difference in fat storage in which females maintain higher levels of fat storage in part due to a higher relative activity level for anabolic pathway IIS, whereas males have lower fat storage due to higher relative activity of catabolic effectors such as bmm and Akh. While some progress has been made in revealing the mechanisms underlying the sex-specific regulation of Akh and IIS (Wat et al., 2021; Biswas et al., 2025), we do not have a complete understanding of the factors that determine the sex-biased regulation and function of these key metabolic factors.

Recent clues into the regulation of Akh, bmm, and IIS have emerged from studies on peptide hormone function (Birse et al., 2011; Hentze et al., 2015; Kapan et al., 2012; Kubrak et al., 2022; Kubrak et al., 2024; Kubrak et al., 2016; Nässel et al., 2008; Oh et al., 2019; Sano et al., 2015; Scopelliti et al., 2019; Yoshinari et al., 2021; Zandawala et al., 2018), as several hormones influence physiology via effects on Akh- and Dilp-producing cells (Birse et al., 2011; Hentze et al., 2015; Kapan et al., 2012; Kubrak et al., 2022; Kubrak et al., 2016; Nässel et al., 2008; Oh et al., 2019; Sano et al., 2015; Scopelliti et al., 2019; Yoshinari et al., 2021; Zandawala et al., 2018; Nässel and Vanden Broeck, 2016; Nässel and Zandawala, 2019; Toprak, 2020). In particular, recent studies have illuminated an important role for hormones produced by the enteroendocrine (EE) cells of the gut (Nässel and Zandawala, 2019; Miguel-Aliaga et al., 2018; Wegener and Veenstra, 2015; Zhou et al., 2020). Adult Drosophila EE cells produce and release hormones such as Allatostatin A (AstA), Allatostatin C (AstC), neuropeptide F (NPF), tachykinin (Tk), Diuretic hormone 31 (Dh31), Bursicon, CCHamide 1 (CCHa1), and CCHamide 2 (CCHa2), and short neuropeptide F (sNPF) (Chen et al., 2016; Hung et al., 2020; Reiher et al., 2011; Veenstra, 2009; Veenstra et al., 2008).

EE cells are identified by expression of the homeodomain protein Prospero in adults (Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006), where EE cells that produce distinct hormones are present in anatomically defined regions of the adult gut (Ohlstein and Spradling, 2006). For example, AstA- and Dh31-producing EE cells are located in the posterior midgut, whereas EE cells that produce AstC and Tk are found along the entire length of the midgut (Chen et al., 2016). NPF-producing cells are found in the anterior and middle midgut (Veenstra et al., 2008). Supporting a role for EE cell-derived hormones in regulating Akh/IIS, in fed conditions studies show EE cell-derived hormones such as Bursicon inhibit Akh secretion (Scopelliti et al., 2019), whereas NPF enhances Dilp secretion from the IPCs (Yoshinari et al., 2021). During starvation, AstC promotes Akh release from Akh-producing cells (APCs) to enable lipid mobilization (Kubrak et al., 2022). While some EE cell-derived hormones have been shown to have sex-biased effects on food intake and energy mobilization (Kubrak et al., 2022; Malita et al., 2022; Kubrak et al., 2026), sex differences in the regulation and function of most of these hormones remain unclear. Defining potential differences in EE cells is an important task, as prior studies have revealed profound differences in gut biology between males and females.

For example, males and females differ in overall gut size and shape (Ahmed et al., 2020; Blackie et al., 2024) and in the number of intestinal stem cell divisions (Ahmed et al., 2020; Hudry et al., 2016; Regan et al., 2016; Zipper et al., 2020). The absorptive lining of the gut also shows sex differences during aging (Regan et al., 2016; Regan et al., 2022). After mating, females also show pronounced changes to gut size, function, and gene expression (Ahmed et al., 2020; Cognigni et al., 2011; Hadjieconomou et al., 2020; Reiff et al., 2015; White et al., 2021). While sex differences in intestinal stem cells and enterocytes play a key role in mediating these differences in gut biology, we know less about male–female differences in EE cells. We therefore aimed to perform a detailed characterization of EE cell-derived hormones in males and females, and to determine the contribution of these hormones to physiology in each sex. We reveal profound sex-biased regulation of EE cell-expressed hormones AstC, Tk, and NPF: females show higher mRNA levels of these hormones in the gut than males. For at least one EE cell-derived hormone, this sex-biased regulation was physiologically significant, as knock-down of AstC in the gut reduced fat storage in females with no effect in males. Knock-down of Tk in the gut produced a trend toward reduced female fat storage. Female-specific fat storage defects were also observed following knock-down of AstC and Tk receptors in neurons and/or neuropeptide-producing cells. While the specific cell type targeted by these EE cell-derived hormones to influence fat storage remains unclear, this reveals a female-specific contribution of one EE cell-derived hormone in regulating body fat.

Results

Sex differences in expression of gut-derived peptide hormones

Given that several EE cell-derived hormones such as AstA (FBgn0015591), AstC (FBgn0032336), Tk (FBgn0037976), NPF (FBgn0027109), and Dh31 (FBgn0032048) are expressed in cells outside the gut (Hentze et al., 2015; Abruzzi et al., 2017; Asahina et al., 2014; Beshel et al., 2017; Chung et al., 2017; Díaz et al., 2019; Hergarden et al., 2012; Kunst et al., 2014; Kurogi et al., 2023; Lee et al., 2006; Lee et al., 2021; Luan et al., 2006; Mendive et al., 2005; Qi et al., 2021; Winther et al., 2006; Zhang et al., 2021), we used quantitative real-time PCR (qPCR) to assess whole-body mRNA levels of genes encoding EE cell-expressed hormones. In particular, we focused on hormones known to influence whole-body fat metabolism (Hentze et al., 2015; Kubrak et al., 2022; Yoshinari et al., 2021; Malita et al., 2022; Song et al., 2023; Song et al., 2014). In 5-day-old w1118 unmated adult males and females, we found that whole-body mRNA levels of AstA, AstC, Tk, NPF, and Dh31 were significantly higher in males than in females (Figure 1A–E). To gain further insight into this sex-biased expression, we analyzed mRNA levels of these factors from isolated heads and intestines, as these are the main sites of AstA, AstC, Tk, NPF, and Dh31 production (Wegener and Veenstra, 2015; Chen et al., 2016). A significant male bias in mRNA levels was found in the head for AstA, AstC, Tk, NPF, and Dh31 (Figure 1F–J). In contrast, mRNA levels of AstC, Tk, and NPF in isolated intestines showed a strong female bias (Figure 1L–N). No sex bias in the expression of AstA or Dh31 was observed in the gut (Figure 1K, O).

Figure 1 with 1 supplement see all
Sex differences in expression of gut-derived peptide hormones.

mRNA levels of AstA (p < 0.0001; Student’s t-test) (A), AstC (p = 0.0002; Mann–Whitney test) (B), Tk (p < 0.0001; Student’s t-test) (C), NPF (p = 0.0001; Student’s t-test) (D), and Dh31 (p = 0.0002; Mann–Whitney test) (E) in whole-body were significantly higher in 5-day-old w1118 males compared to females. n = 7–8 biological replicates. mRNA levels of AstA (p < 0.0001; Student’s t-test) (F), AstC (p = 0.001; Student’s t-test) (G), Tk (p < 0.0001; Student’s t-test) (H), NPF (p = 0.0015; Student’s t-test) (I), and Dh31 (p < 0.0001; Student’s t-test) (J) in heads were significantly higher in 5-day-old w1118 males compared to females. n = 8–10 biological replicates. (K) mRNA levels of AstA (p = 0.5039; Student’s t-test) in guts were not significantly different between 5-day-old w1118 females and males. n = 7 biological replicates. mRNA levels of AstC (p = 0.0002; Student’s t-test) (L), Tk (p < 0.0001; Student’s t-test) (M), and NPF (p = 0.0006; Mann–Whitney test) (N) in guts were significantly higher in 5-day-old w1118 females compared to males. n = 7 biological replicates. (O) mRNA levels of Dh31 (p = 0.7517; Student’s t-test) in guts were not significantly different between 5-day-old w1118 females and males. n = 7 biological replicates. All data plotted as mean ± SEM. ns indicates not significant with p > 0.05; **p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure 1—figure supplement 1.

Building on the sex bias in mRNA levels, we next examined mRNA levels of receptors that correspond to EE cell-expressed hormones with sex-biased expression in whole-body, fat body, and head samples. Whole-body mRNA levels of the receptors for AstA (AstA-R2), AstC (AstC-R2), Tk (TkR99D), NPF (NPFR), and Dh31 (Dh31-R) were significantly higher in 5-day-old w1118 males compared with age-matched females (Figure 1—figure supplement 1A–E). For most peptides, the male bias was due to a higher mRNA level in the head and not the fat body (Figure 1—figure supplement 1A–E); however, TkR99D mRNA levels were higher in male fat bodies with no difference in head mRNA levels (Figure 1—figure supplement 1C). We therefore cannot rule out a contribution of additional anatomical sites to the male bias in expression of EE cell-expressed hormones, which is an interesting area for future investigation. Taken together with our data on peptide mRNA levels, our data suggest sex differences exist in both the expression of EE cell-derived hormones and in the ability of tissues to respond to available peptide.

Sex determination gene transformer does not regulate sex differences in EE cell-derived peptide mRNA levels

To determine the mechanism by which these differences in mRNA levels are established, we tested a role for sex determination gene transformer (tra). Normally, a functional Tra protein is only expressed in females, where Tra specifies most aspects of female sexual development and behavior (Camara et al., 2008; McKeown et al., 1988; Oliver, 2002; Sturtevant, 1945). Indeed, ectopic Tra expression in males is sufficient to specify many aspects of female sexual development and physiology (Wat et al., 2021; Hudry et al., 2016; Regan et al., 2016; McKeown et al., 1988; Billeter et al., 2006; Rideout et al., 2015). Because tra mRNA is detected in the gut, specifically in ISC and EE cells (Hudry et al., 2016; Hérault et al., 2024), we asked whether broad overexpression of Tra in neurons and/or EE cells contributes to the sex difference in mRNA levels of EE cell-expressed hormones. For these data, cell-type-specific Tra overexpression was considered to have a significant effect on EE cell-expressed hormones only if the experimental genotype (e.g., tissue-GAL4>UAS-traF) significantly differed from both parental strains (e.g., tissue-GAL4>+ and +>UAS-traF) with the same direction of effect. We found that sex differences in mRNA levels of AstA, AstC, Tk, NPF, and Dh31 were unaffected when we used either voila-GAL4 (Figure 2A–J), which expresses in EE and sensory cells, or elav-GAL4 (Figure 2K–T), which expresses in neurons and neuropeptide-producing cells, to drive Tra expression in these cells. However, we note that Tra expression in EE cells further augments the male bias in head Tk mRNA levels (Figure 2H), whereas Tra expression in female neurons paradoxically decreases NPF mRNA levels in the head (Figure 2S). Tra expression in neurons similarly had no effect on mRNA levels of AstC-R2, TkR99D, or Dh31-R in the head (Figure 2—figure supplement 1A–C). Thus, sex determination tra does not establish sex differences in levels of the mRNAs that encode either EE cell-derived hormones or their receptors.

Figure 2 with 1 supplement see all
Sex determination gene transformer does not regulate sex differences in enteroendocrine (EE) cell-derived peptide mRNA levels.

For all data, cell-type-specific RNAi was considered to have a significant effect only if the experimental genotype (e.g., tissue-GAL4>UAS-RNAi) significantly differed from both parental strains (e.g., tissue-GAL4>+ and +>UAS-RNAi) with the same direction of effect. mRNA levels of AstA (A), AstC (B), Tk (C), NPF (D), and Dh31 (E) in the gut were measured in voila-GAL4>UAS-traF flies and respective genetic controls (voila-GAL4>+ and +>UAS-traF) in females and males. Tra expression did not alter AstA (female: pGAL4 > 0.9999 and pUAS > 0.9999; male: pGAL4 > 0.9999 and pUAS = 0.0084), AstC (female: pGAL4 = 0.6814 and pUAS = 1.0; male: pGAL4 = 0.9965 and pUAS = 0.0463), Tk (female: pGAL4 = 0.2258 and pUAS > 0.9999; male: pGAL4 = 0.0006 and pUAS = 0.0004), NPF (female: pGAL4 = 0.1579 and pUAS = 0.3389; male: pGAL4 = 0.6639 and pUAS = 0.9043), or Dh31 (female: pGAL4 = 0.0439 and pUAS = 0.9745; male: pGAL4 = 0.9953 and pUAS = 0.1370) levels in either sex. Sex:genotype interaction: AstA (p < 0.0001), AstC (p = 0.1078), Tk (p = 0.0004), NPF (p = 0.1655), and Dh31 (p = 0.1945). Data were analyzed by two-way ANOVA with Bonferroni or Tukey’s HSD post hoc tests as appropriate (aligned rank transform applied for non-parametric data in B and E); n = 5 biological replicates. mRNA levels of AstA (F), AstC (G), Tk (H), NPF (I), and Dh31 (J) in the head were measured in voila-GAL4>UAS-traF flies and respective genetic controls (voila-GAL4>+ and +>UAS-traF) in females and males. Tra expression did not alter AstA (female: pGAL4 > 0.9999 and pUAS = 0.3344; male: pGAL4 > 0.9999 and pUAS > 0.9999), AstC (female: pGAL4 > 0.9999 and pUAS < 0.0001; male: pGAL4 = 0.6687 and pUAS = 0.0236), NPF (female: pGAL4 > 0.9999 and pUAS = 0.0006; male: pGAL4 = 0.5030 and pUAS = 0.6158), or Dh31 (female: pGAL4 > 0.9999 and pUAS = 0.0003; male: pGAL4 > 0.9999 and pUAS > 0.9999) levels in either sex. In females, Tk (pGAL4 > 0.9999 and pUAS = 0.0044) levels did not alter, but in males, Tk was increased compared with both controls (pGAL4 = 0.0120 and pUAS = 0.0156). Sex:genotype interaction: AstA (p = 0.2471), AstC (p = 0.0189), Tk (p = 0.0003), NPF (p = 0.1408), and Dh31 (p = 0.0403). Data were analyzed by two-way ANOVA with Bonferroni post hoc tests; n = 8 biological replicates. mRNA levels of AstA (K), AstC (L), Tk (M), NPF (N), and Dh31 (O) in the gut were measured in elav-GAL4>UAS-traF flies and respective genetic controls (elav-GAL4>+ and +>UAS-traF) in females and males. Neuronal Tra expression did not alter AstA (female: pGAL4 > 0.9999 and pUAS = 0.0534; male: pGAL4 = 0.5496 and pUAS = 0.1858), AstC (female: pGAL4 = 0.5948 and pUAS = 0.0878; male: pGAL4 = 0.1745 and pUAS = 0.1745), Tk (female: pGAL4 > 0.9999 and pUAS = 0.0269; male: pGAL4 > 0.9999 and pUAS = 0.2110), NPF (female: pGAL4 > 0.9999 and pUAS = 0.1158; male: pGAL4 > 0.9999 and pUAS = 0.6652), or Dh31 (female: pGAL4 = 0.5442 and pUAS = 0.8086; male: pGAL4 = 0.1650 and pUAS = 0.5258) levels in either sex. Sex:genotype interaction: AstA (p = 0.6125), AstC (p = 0.4992), Tk (p = 0.5212), NPF (p = 0.6546), and Dh31 (p = 0.9566). Data were analyzed by two-way ANOVA with Bonferroni or Tukey’s HSD post hoc tests as appropriate (aligned rank transform applied for non-parametric data in L and O); n = 6 biological replicates. mRNA levels of AstA (P), AstC (Q), Tk (R), NPF (S), and Dh31 (T) in the head were measured in elav-GAL4>UAS-traF flies and respective genetic controls (elav-GAL4>+ and +>UAS-traF) in females and males. Neuronal Tra expression did not alter AstA (female: pGAL4 = 0.9843 and pUAS = 0.7086; male: pGAL4 = 0.0628 and pUAS = 0.9936), AstC (female: pGAL4 = 0.1253 and pUAS = 0.8540; male: pGAL4 = 0.9086 and pUAS = 0.0188), Tk (female: pGAL4 = 0.6051 and pUAS = 0.9999; male: pGAL4 = 0.3600 and pUAS = 0.2760), or Dh31 (female: pGAL4 > 0.9999 and pUAS > 0.9999; male: pGAL4 = 0.2918 and pUAS = 0.5990) levels in either sex. NPF was reduced in females compared with both controls (pGAL4 = 0.0347 and pUAS = 0.0273) but was unchanged in males (pGAL4 = 0.0656 and pUAS = 0.6253). Sex:genotype interaction: AstA (p = 0.0171), AstC (p = 0.0198), Tk (p = 0.2324), NPF (p = 0.6872), and Dh31 (p = 0.4360). Data were analyzed by two-way ANOVA with Tukey’s HSD or Bonferroni post hoc tests as appropriate (aligned rank transform applied for non-parametric data in P, Q, R, S); n = 5–6 biological replicates. All data plotted as mean ± SEM. ns indicates not significant with p > 0.05; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure 2—figure supplement 1.

Gut-derived Allatostatin C promotes female fat storage

Given that EE cell-derived AstC, NPF, and Tk regulate fat storage and phenotypes associated with fat storage (e.g., starvation resistance) in single- and mixed-sex animal groups (Kubrak et al., 2022; Yoshinari et al., 2021; Malita et al., 2022; Song et al., 2014), we wanted to assess whether these hormones contribute to the sex difference in fat storage. We used RNAi to knock-down levels of AstC, Tk, and NPF with GAL4 drivers targeting these specific EE populations (AstC-GAL4, Tk-GAL4, and NPF-GAL4, respectively). Importantly, GAL4 activity for each driver line was restricted to the gut using R57C10-GAL80, a validated approach to target only the gut cells that produce these hormones (Kubrak et al., 2022; Malita et al., 2022; Kubrak et al., 2026). For all fat storage data, cell-type-specific RNAi was considered to have a significant effect on fat storage only if the experimental genotype (e.g., tissue-GAL4>UAS-RNAi) significantly differed from both parental strains (e.g., tissue-GAL4>+ and +>UAS-RNAi) with the same direction of effect. We found gut-specific knock-down of AstC (genotype AstC-GAL4>UAS-AstC-RNAi, R57C10-GAL80) caused a significant reduction in body fat in females with no effect in males (Figure 3A). Gut-specific knock-down of Tk (genotype Tk-GAL4>UAS-Tk-RNAi, R57C10-GAL80) similarly showed a trend toward a female-specific decrease in fat storage (pGAL4 = 0.1109; pUAS = 0.0118), with no significant effect on male body fat (Figure 3B). This suggests a role for gut-derived AstC and a potential role for gut-derived Tk in regulating female body fat, whereas gut-derived AstC or Tk do not play a role in regulating male body fat. In contrast, gut-specific knock-down of NPF (NPF-GAL4>UAS-NPF-RNAi, R57C10-GAL80) did not significantly alter whole-body fat storage in either males or females (Figure 3C). Together, these data indicate that female-biased expression of AstC in the gut contributes to the regulation of fat storage in females and suggest a possible role for Tk in this process.

Gut-derived Allatostatin C promotes female fat storage.

For all data, cell-type-specific RNAi was considered to have a significant effect only if the experimental genotype (e.g., tissue-GAL4>UAS-RNAi) significantly differed from both parental strains (e.g., tissue-GAL4>+ and +>UAS-RNAi) with the same direction of effect. (A) Whole-body triglyceride levels were significantly lower in AstC-GAL4>UAS-AstC-RNAi,R57C10-GAL80 females compared with AstC-GAL4>+,R57C10-GAL80 and +>UAS-AstC-RNAi control females (pGAL4 < 0.0001 and pUAS < 0.0001), an effect that was not observed in males (pGAL4 = 0.4527 and pUAS = 0.1056) (sex:genotype interaction p < 0.0001). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. (B) Whole-body triglyceride levels were not significantly different in Tk-GAL4>UAS-Tk-RNAi,R57C10-GAL80 females and males compared with controls (female: pGAL4 = 0.1109 and pUAS = 0.0118; male: pGAL4 < 0.0001 and pUAS = 0.5704) (sex:genotype interaction p < 0.0001) though we note a trend toward lower body fat in females. Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. (C) Whole-body triglyceride levels were not significantly different in NPF-GAL4>UAS-NPF-RNAi,R57C10-GAL80 females and males compared with controls (female: pGAL4 > 0.9999 and pUAS > 0.9999; male: pGAL4 > 0.9999 and pUAS = 0.4134) (sex:genotype interaction p = 0.2890). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. All data plotted as mean ± SEM. ns indicates not significant with p > 0.05; **p < 0.01, ****p < 0.0001.

Allatostatin C receptor and Tachykinin receptor in neurons promote fat storage in females but not males

Neurons and neuropeptide-producing cells are key cell types upon which AstC, Tk, and NPF act to influence physiology (Kubrak et al., 2022; Yoshinari et al., 2021; Nässel and Zandawala, 2019; Song et al., 2014; Chopra et al., 2022; Guo et al., 2022). Based on our findings with EE cell-specific knock-down of AstC and Tk, we therefore predicted that knock-down of AstC-R2 and TkR99D in these cells may reproduce the reduced fat storage we observed in females with knock-down of EE cell-derived AstC, and the trend toward lower body fat with knock-down of EE cell-derived Tk. To test this, we used elav-GAL4 to knock-down AstC-R2 and TkR99D in post-mitotic neurons and neuropeptide-producing cells. Importantly, we cannot fully rule out effects of Tk and AstC mediated by other receptors as we did not test these additional receptors (Kreienkamp et al., 2002; Poels et al., 2009). In females, knock-down of AstC-R2 in neurons and neuropeptide-producing cells caused a significant decrease in body fat, with no effect in males (Figure 4A). This reproduced the body fat phenotype caused by knock-down of gut AstC. A female-specific reduction in fat storage was also observed with knock-down of TkR99D in neurons and neuropeptide-producing cells (Figure 4B). In line with the lack of body fat effect due to knock-down of gut-derived NPF, we saw no significant change in fat storage in either males or females with knock-down of NPFR in neurons and neuropeptide-producing cells (Figure 4C). Together, these data suggest that AstC promotes whole-body fat storage in females via effects on neurons and neuropeptide-producing cells. While EE cell-derived Tk may play a similar role, more work will be needed to test this in future studies.

Allatostatin C and Tachykinin receptors in neurons promote fat storage in females but not males.

For all data, cell-type-specific RNAi was considered to have a significant effect only if the experimental genotype (e.g., tissue-GAL4>UAS-RNAi) significantly differed from both parental strains (e.g., tissue-GAL4>+ and +>UAS-RNAi) with the same direction of effect. Whole-body triglyceride levels were measured in elav-GAL4>UAS-RNAi flies targeting AstC-R2 (A), TkR99D (B), and NPFR (C), along with respective genetic controls (elav-GAL4>+ and +>UAS-RNAi) in females and males. Knock-down of AstC-R2 (female: pGAL4 = 0.0001 and pUAS = 0.0013; male: pGAL4 = 0.0564 and pUAS > 0.9999; sex:genotype interaction p = 0.0631) and TkR99D (female: pGAL4 < 0.0001 and pUAS < 0.0001; male: pGAL4 > 0.9999 and pUAS > 0.9999; sex:genotype interaction p < 0.0001) significantly reduced triglyceride levels in females compared with no significant differences in males. Knock-down of NPFR did not change triglyceride levels in either females or males compared with controls (female: pGAL4 < 0.0001 and pUAS > 0.9999; male: pGAL4 < 0.0001 and pUAS > 0.9999; sex:genotype interaction p = 0.2470). Data were analyzed by two-way ANOVA followed by Bonferroni post hoc tests; n = 8 biological replicates. (D) Whole-body triglyceride levels were not significantly different in dilp2-GAL4>UAS-AstC-R2-RNAi females and males compared with controls (female: pGAL4 < 0.0001 and pUAS > 0.9999; male: pGAL4 = 0.0156 and pUAS = 0.3419; sex:genotype interaction p < 0.0001). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. (E) Whole-body triglyceride levels were not significantly different in dilp2-GAL4>UAS-TkR99D-RNAi females compared with controls (pGAL4 = 0.0321 and pUAS = 0.0724). Whole-body triglyceride levels were significantly higher in dilp2-GAL4>UAS-TkR99D-RNAi males compared with dilp2-GAL4>+ and +>UAS-TkR99D-RNAi control males (pGAL4 < 0.0001 and pUAS = 0.0003; sex:genotype interaction p < 0.0001). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. (F) Whole-body triglyceride levels were not significantly different in Akh-GAL4>UAS-AstC-R2-RNAi females and males compared with controls (female: pGAL4 = 0.3817 and pUAS = 0.0181; male: pGAL4 = 0.1229 and pUAS > 0.9999; sex:genotype interaction p = 0.0241). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. (G) Whole-body triglyceride levels were not significantly different in Akh-GAL4>UAS-TkR99D-RNAi females and males compared with controls (female: pGAL4 = 0.4601 and pUAS > 0.9999; male: pGAL4 > 0.9999 and pUAS = 0.8744; sex:genotype interaction p = 0.0595). Two-way ANOVA followed by Bonferroni post hoc test; n = 8 biological replicates. All data plotted as mean ± SEM. ns indicates not significant with p > 0.05; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

To narrow down the neurons and neuropeptide-producing cells in which AstC-R2 and TkR99D act to mediate their effects on female fat storage, we used cell-type-specific GAL4 drivers to overexpress RNAi transgenes directed at these genes. Given that these gut-derived peptides have been shown to influence metabolic homeostasis and feeding via effects on the IPCs and the APCs (Birse et al., 2011; Kubrak et al., 2022; Qi et al., 2021), we first knocked down AstC-R2 and TkR99D in these cells. We used dilp2-GAL4 to drive expression of UAS-Astc-R2-RNAi and UAS-TkR99D-RNAi in the IPCs, and Akh-GAL4 to drive expression of these transgenes in the APCs. Knock-down of AstC-R2 in the IPC had no significant effect on fat storage in either males or females compared with sex-matched controls (Figure 4D). IPC-specific knock-down of TkR99D, on the other hand, caused a significant increase in whole-body fat storage in males (Figure 4E) with no change in females. In the APC, knock-down of neither receptor altered fat storage in males or females (Figure 4F, G). These findings are interesting for several reasons. For example, in males, knock-down of EE cell-derived Tk and knock-down of TkR99D across neurons had no effect on fat storage, in contrast to the greater fat storage observed with IPC-specific TkR99D knock-down. This suggests that Tk derived from outside of the gut, and likely in the head, regulates fat storage via effects on TkR99D in the IPC. Further studies will be needed to understand why IPC but not pan-neuronal knock-down of TkR99D causes an effect on male body fat. Possible explanations include greater knock-down in the IPC using Dilp2-GAL4, or that Tk mediates opposing effects on body fat via effects on TkR99D in multiple neuron groups.

Discussion

EE cell-derived hormones regulate body fat in single- and mixed-sex animal groups; however, it has been unclear whether the regulation and function of these peptides differ between the sexes. The goal of our study was to perform a detailed comparison of EE cell-derived hormones between the sexes, and to test if these hormones contribute to the sex difference in fat storage. Our assessment revealed profound female-biased expression of EE cell-expressed hormones within the gut. For one hormone, AstC, this differential expression was physiologically significant, as we showed that EE cell-derived AstC promotes female fat storage. Interestingly, these effects were not mediated by the IPC or APC, cells that we have previously shown contribute to the sex difference in fat storage. Taken together, our data provide additional insight into the highly complex mechanism(s) by which unmated female flies achieve higher fat storage than male flies (Figure 5).

Model of sex differences in fat storage.

Schematic representation of complex mechanisms that promote higher fat storage in Drosophila females. Profound female-biased EE cell-derived Tk and AstC promote female fat storage, an effect mediated by neurons but independent of the IPC or APC. EE cell-derived factors therefore act alongside a greater insulin/insulin-like growth factor signaling pathway activity, lower Adipokinetic hormone (Akh) signaling, and lower expression of triglyceride lipase brummer (bmm) to specify higher adiposity in female flies. In males, we detected no contribution of gut-derived factors to fat storage, which we previously showed is kept at a lower level than in females by higher bmm expression and Akh signaling. Thus, multiple complex mechanisms specify higher fat storage in unmated female flies compared with males. IPCs: insulin-producing cells; APCs: adipokinetic hormone-producing cells; CNS: central nervous system; bmm: brummer; EC: enterocyte; EB: enteroblast; EE: enteroendocrine; ISC: intestinal stem cells; AstC: Allatostatin C; Tk: Tachykinin; Dilps: Drosophila insulin-like peptides; Akh: Adipokinetic hormones. Created with BioRender.com.

While it was not the main goal of our study, our survey of EE cell-expressed hormones in Drosophila revealed that the sex bias in expression was not uniform across tissues. In the gut, mRNA levels of AstC, Tk, and NPF were higher in females than in males. In the brain, mRNA levels of these hormones showed a significant male bias, in line with data from previous reports on Tk (Asahina et al., 2014) and NPF (Lee et al., 2006). While it remains unclear whether the tissue-specific sex bias in expression is physiologically significant, peptides derived from the gut and the brain have been shown to mediate distinct effects on physiology and/or behavior. For example, EE cell-derived AstC regulates energy homeostasis and food-seeking behaviors in adult females (Kubrak et al., 2022), whereas neuron-derived AstC is involved in regulating locomotion in adult males (Díaz et al., 2019) and the circadian regulation of oogenesis in adult females (Zhang et al., 2021). Neuron-derived Tk similarly regulates locomotion (Lee et al., 2021; Winther et al., 2006), food consumption (Qi et al., 2021), Dilp secretion (Birse et al., 2011), and aggression (Asahina et al., 2014), whereas gut-derived Tk regulates intestinal lipogenesis (Song et al., 2014) and stem cell divisions in the midgut (Amcheslavsky et al., 2014; Foronda et al., 2014; O’Brien et al., 2011). Supporting a potential sex-specific role for peptides derived from different anatomical sites in regulating physiology, gut-derived AstC stimulates fat breakdown during starvation through the Akh pathway in mated females with no effect in males (Kubrak et al., 2022). Future studies are therefore needed to determine whether there are sex differences in whether the effects of EE cell-derived hormones are primarily mediated by local or systemic mechanisms.

Another important task for future studies will be to elucidate how sex differences in neuropeptide expression are established. The first step in understanding these mechanisms will be to determine which factors specify the sex bias in neuropeptide mRNA levels. Because our data show that sex determination gene tra does not regulate the sex bias in neuropeptide expression in either the brain or the gut, the role of other factors that influence sexual identity and sexual differentiation must be assessed. One strong candidate is the steroid hormone ecdysone, as virgin females have higher ecdysone titers than males (Bownes et al., 1984; Harshman et al., 1999; Schwedes and Carney, 2012). Ecdysone plays a role in regulating sexual differentiation and development (Sieber and Spradling, 2015; Li et al., 2014; Riddiford et al., 2000), and contributes to male–female differences in multiple aspects of intestinal physiology (e.g., intestinal stem cell proliferation) (Ahmed et al., 2020; Zipper et al., 2020) and brain development (Dalton et al., 2009; Zhang et al., 2018). Another candidate is juvenile hormone, which has been shown to regulate sexual maturation in Drosophila and other insects (Argue et al., 2013; Barth and Lester, 1973; Bilen et al., 2013; Flatt et al., 2005; Raikhel et al., 2005; Wijesekera et al., 2016; Wyatt and Davey, 1996). While it remains unclear whether juvenile hormone titers differ between virgin males and females, juvenile hormone regulates many aspects of gut physiology in mated females (e.g., intestinal lipid accumulation, intestinal stem cell proliferation) (Reiff et al., 2015; Rahman et al., 2017) and influences brain development (Liu et al., 2024). Other than hormones, it is possible that the sex determination gene Sex-lethal plays a role in regulating the sex difference in mRNA levels of EE cell-derived hormones, as tra-independent effects of Sex-lethal have been described in the brain (Evans and Cline, 2013). While sex differences in the expression of EE cell-derived hormones do not involve tra, and are therefore unlikely to involve known tra targets such as fruitless (Heinrichs et al., 1998; Ryner et al., 1996), without further experiments we cannot fully rule out these additional sex determination pathway members.

In parallel to identifying the factor(s) responsible for establishing the sex difference in EE cell-expressed hormones, it will be important to reveal the cellular basis for this differential expression. For example, a sex difference in the number of EE cells and neuropeptide-expressing cells in the brain could explain the differences in expression. Supporting this, gut length, overall brain size, and neuron number have been shown to differ between males and females (Miguel-Aliaga et al., 2018; Hudry et al., 2016; Asahina, 2018; Cachero et al., 2010; Jiao et al., 2022; Kimura et al., 2005; Nojima et al., 2021; Ren et al., 2016; Sanders and Arbeitman, 2008; Sato and Yamamoto, 2023). In the gut, the difference in length is at least partially due to a sex difference in the proliferation of intestinal stem cells (Ahmed et al., 2020; Hudry et al., 2016; Regan et al., 2016), which undergo asymmetric divisions and subsequent differentiation to generate all gut cell types, including EE cells (Miguel-Aliaga et al., 2018; Micchelli and Perrimon, 2006; Buchon and Osman, 2015; Driver and Ohlstein, 2014; Jiang and Edgar, 2011; Lemaitre and Miguel-Aliaga, 2013; Schonhoff et al., 2004).

In the brain, males and females differ in the number of neurons found within many identified clusters (Asahina, 2018; Cachero et al., 2010; Kimura et al., 2005; Nojima et al., 2021; Ren et al., 2016; Sanders and Arbeitman, 2008; Sato and Yamamoto, 2023; Kimura, 2011), including the cells that produce NPF (Lee et al., 2006) and Tk (Asahina et al., 2014). Differences in neuron number have been primarily attributed to sex-specific programmed cell death (Sanders and Arbeitman, 2008; Kimura, 2011; Garner et al., 2018; Kimura et al., 2008; Nojima et al., 2010); however, sex differences in neuroblast cell death and/or proliferation may also play a role (Ren et al., 2016; Ghosh et al., 2019; Taylor and Truman, 1992; Truman and Bate, 1988).

Beyond the effects of cell number, sex differences in EE cell-derived hormone mRNA levels may also be due to differential gene and/or protein expression of these factors, which have been reported for other peptide hormones (Wat et al., 2021; Biswas et al., 2025; Lee et al., 2006). Because sex differences in the activity of peptide hormone-producing cells have also been previously described (Wat et al., 2021), it is clear that a detailed examination of sex differences in EE cells, and more generally in neuropeptide-producing cells, is needed to gain a comprehensive picture of how these cells differ between males and females. Benefits of such a detailed study include gaining insight into potential mechanisms underlying sex differences in other aspects of physiology and behavior. For example, EE cells regulate ISC homeostasis (Amcheslavsky et al., 2014; Scopelliti et al., 2014), and EE cell-derived hormones act locally and systemically to regulate appetite, food ingestion, food digestion, gut motility, and immune responses (Wegener and Veenstra, 2015; Guo et al., 2022; Kamareddine et al., 2018; Ren et al., 2015). Importantly, male–female differences in many of these phenotypes have been reported (Cognigni et al., 2011; Hadjieconomou et al., 2020; Belmonte et al., 2019; Duneau et al., 2017; Peng et al., 2025; Shahrestani et al., 2018).

Overall, our findings identify EE cell-derived hormones AstC as an important factor that promotes higher fat storage in Drosophila adult virgin females. This builds on a recent paper identifying a key role for IIS in promoting higher levels of fat storage in unmated females but not males (Biswas et al., 2025), advancing knowledge of the factors that establish an optimal level of stored fat in each sex.

Materials and methods

Fly strains

Request a detailed protocol

The following fly strains from the Bloomington Drosophila Stock Center were used: w1118 (RRID:BDSC_3605), voila-GAL4 (RRID:BDSC_80572), dilp2-GAL4 (IPCs) (RRID:BDSC_37516), UAS-traF (RRID:BDSC_4590), UAS-NPF-RNAi (RRID:BDSC_27237), UAS-TkR99D-RNAi (RRID:BDSC_27513), UAS-AstC-RNAi (RRID:BDSC_25868), UAS-NPFR-RNAi (RRID:BDSC_25939), UAS-AstC-R2-RNAi (RRID:BDSC_36888), UAS-Tk-RNAi (RRID:BDSC_25800), and elav-GAL4 (RRID:BDSC_458). We obtained R57C10-GAL80; NPF-GAL4, R57C10-GAL80; Tk-GAL4, and R57C10-GAL80; AstC-GAL4 as kind gifts from Dr. Kim Rewitz at the University of Copenhagen, and Akh-GAL4 was a kind gift from Dr. Mike Gordon at The University of British Columbia. We acknowledge FlyBase as an essential resource providing genetic, genomic, and functional data and tools that supported this study (Öztürk-Çolak et al., 2024).

Fly husbandry

Request a detailed protocol

Fly media was prepared with the following ingredients: 20.5 g/l sucrose, 70.9 g/l D-glucose, 48.5 g/l cornmeal, 45.3 g/l yeast, 4.55 g/l agar, 0.5 g/l CaCl2·2H2O, 0.5 g/l MgSO4·7H2O, and 11.77 ml/l acid mix (propionic acid/phosphoric acid). For all experiments, we allowed female flies to lay eggs on grape juice agar plates for 12 hr. At 24 hr after egg laying, 50 larvae were picked into vials containing 10 ml of food and reared at 22°C. Males and females were distinguished by the presence of sex combs in the late pupal period and placed into single-sex vials to eclose. After eclosion, adult flies were maintained at a density of 20 flies per vial in single-sex groups. Unless otherwise stated, all experiments used 5- to 7-day-old unmated flies. We used unmated flies to identify genetic factors that regulate the sex difference in body fat; mated females were not used to avoid mating-induced changes in physiology mediated by additional factors (e.g., Sex-peptide) and behavioral changes due to altered food preferences.

Adult weight

Request a detailed protocol

Groups of 10 flies were placed in pre-weighed 1.5 ml microcentrifuge tubes (Diamed Lab Supplies, DIATEC610-2550) and weighed on an analytical balance (Mettler-Toledo, ME104).

Whole-body triglyceride measurements

Request a detailed protocol

Triglyceride is the main form of stored fat in the body, with very little in the circulation (Palm et al., 2012). We therefore refer to whole-body triglyceride as ‘fat storage’ or ‘body fat’. One biological replicate consisted of five flies. Flies were collected in a 1.5-ml tube and homogenized in 350 μl of 0.1% Tween (Amresco, 0777-1L) in 1X phosphate-buffered saline (Sigma-Aldrich, P5493) using 50 μl of glass beads (Sigma-Aldrich, Z250473) that were agitated at 8 m/s for 5 s (OMNI International BeadRuptor 24). Triglyceride concentration was measured using the Stanbio Triglyceride Liquid Reagent (FT7610, BD386a/d, BD386b) according to the manufacturer’s instructions and as described previously (Sieber and Thummel, 2009; Biswas et al., 2025) with minor modifications. Briefly, 10 μl of either homogenate or triglyceride standard (FT7610) was added to 190 μl of activated triglyceride reagent (Enzymatic Triglyceride Reagent, BD386a/d; Triglyceride Activator, Cat. No. BD386b) in a 96-well plate. After a 15-min incubation at room temperature, the absorbance was read at 540 nm (Thermo Scientific – Multiskan FC Microplate Photometer).

RNA extraction, cDNA synthesis, and qPCR

Request a detailed protocol

One biological replicate consisted of 3–5 adult fly guts, or 10 adult fly heads, or 5 whole-body adult flies. Samples were homogenized in 500 μl Trizol (Thermo Fisher Scientific; 15596018). Chloroform was added to Trizol to separate the mixture into aqueous and organic phases, and isopropanol was added to the aqueous phase (in a fresh tube) to precipitate the RNA. RNA was resuspended in either 20–25 μl (for guts and heads) or 200 μl (for whole-body) of molecular biology grade water (Corning, 46-000-CV). RNA was stored at –80°C until use. Each experiment contained 5–10 biological replicates per sex and per genotype; each experiment was repeated twice.

For genomic DNA elimination and cDNA synthesis, an equal amount of RNA per reaction was DNase-treated and reverse transcribed according to the manufacturer’s instructions using the QuantiTect Reverse Transcription Kit (QIAGEN, 205314). Relative mRNA transcript levels were quantified using qPCR as described previously (Wat et al., 2020). Data were normalized to the average fold change of Actin5C and β-tubulin. For a full primer list, refer to Table 1.

Table 1
List of primers.
Gene nameForward (5′–3′)Reverse (5′–3′)
Beta tubulinATCATCACACACGGACAGGAGAGCTGGATGATGGGGAGTA
Actin5CTTGTCTGGGCAAGAGGATCAGACCACTCGCACTTGCACTTTC
AstATTTAGTCCGCGGAACCTCTGGCTGCTGCTACTGAGCGAAT
AstCTACGGCCTACTCCTCACCCGCTGGCATATCGTAGCCACC
TkTGGCAAGAAGAGCGATCTGGCCTACTCGAAAAGTGCTGGC
NPFGGCTGATGCCTACAAGTTCCTCTCATTAAAACCGCGAGCAAATTC
Dh31TCTCAAAGCGGTGCAGTCAGTGCGGCTGTCTCCCTTTTTC
AstA-R2CGAACACCCTCACCAAGCTAGGAGCAGTTAACGGCCTTGT
AstC-R2ACTGAATCTGGCTATCGCGGTGCTCACCATGTAGGCCTTG
TkR99DGATGAATTCGCGCTTTCGCTATTCGATGCGACTTGGGTGA
NPFRTTTGCATGCTCCAAACGTCGCAGCCAGAGTGTTTCCCGAT
Dh31-RCCACTCAGGTCTCGTTCTTTTGCTGCTGATCCGTGGACAACT

Statistical analysis

Request a detailed protocol

Statistical analyses and data presentation were completed using GraphPad Prism 9 (GraphPad Software, San Diego, CA, USA). All data were tested for normality using the Shapiro–Wilk test. Normally distributed data were subjected to parametric tests as appropriate, including Student’s t-test and two-way ANOVA followed by Bonferroni post hoc test. For non-normally distributed data, we used the Mann–Whitney test. For two-way ANOVA involving data that do not satisfy the normality assumption, aligned rank transformation was first applied using the art() function from the ARTool R package (Wobbrock et al., 2011). Then, ANOVA was performed on the transformed data with the base R anova() function. Finally, the art.con() function from the ARTool package was used to extract the main as well as the interaction effects. Default parameters were used in each step of the analysis. For all statistical analyses, differences were considered significant if p < 0.05.

Data availability

Source data 1 contains raw data with calculations. Source data 2 contains the statistics for all data.

References

  1. Book
    1. Raikhel AS
    2. Brown MR
    3. Belles X
    (2005) 3.9 - hormonal control of reproductive processes
    In: Gilbert LI, editors. Comprehensive Molecular Insect Science. Amsterdam: Elsevier. pp. 433–491.
    https://doi.org/10.1016/B0-44-451924-6/00040-5
  2. Conference
    1. Wobbrock JO
    2. Findlater L
    3. Gergle D
    4. Higgins JJ
    (2011) The aligned rank transform for nonparametric factorial analyses using only ANOVA procedures
    CHI '11: Proceedings of the SIGCHI Conference on Human Factors in Computing Systems. pp. 143–146.
    https://doi.org/10.1145/1978942.1978963

Article and author information

Author details

  1. Puja Biswas

    Department of Cellular and Physiological Sciences, Life Sciences Institute, The University of British Columbia, Vancouver, Canada
    Present address
    Department of Pediatrics, BC Children’s Hospital Research Institute, The University of British Columbia, Vancouver, Canada
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6808-6662
  2. Elizabeth J Rideout

    Department of Cellular and Physiological Sciences, Life Sciences Institute, The University of British Columbia, Vancouver, Canada
    Contribution
    Conceptualization, Resources, Supervision, Funding acquisition, Methodology, Writing – original draft, Writing – review and editing, Project administration
    For correspondence
    elizabeth.rideout@ubc.ca
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0012-2828

Funding

Canadian Institutes of Health Research (GS4-171365)

  • Elizabeth J Rideout

Michael Smith Health Research BC (16876)

  • Elizabeth J Rideout

Canada Foundation for Innovation (JELF-34879)

  • Elizabeth J Rideout

Canadian Institutes of Health Research (PJT-183786)

  • Elizabeth J Rideout

Canadian Institutes of Health Research (PJT-153072)

  • Elizabeth J Rideout

The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Acknowledgements

The authors thank FlyBase, which is supported by a grant from the National Human Genome Research Institute at the U.S. National Institutes of Health (U41 HG000739) and by the British Medical Research Council (MR/N030117/1). Stocks obtained from the Bloomington Drosophila Stock Center (NIHP40OD018537) were used in this study. The authors thank the TRiP at Harvard Medical School (NIH/NIGMS R01-GM084947) for providing transgenic RNAi fly stocks and/or plasmid vectors used in this study. The funders had no role in study design, data collection, and analysis, decision to publish, or preparation of the manuscript. We thank members of the Rideout lab for valuable feedback. We acknowledge that our research takes place on the traditional, ancestral, and unceded territory of the Musqueam people; a privilege for which we are grateful. This study was supported by operating grants to EJR from the Canadian Institutes for Health Research (PJT-153072 and PJT-183786), CIHR Sex and Gender Science Chair program (GS4-171365), Michael Smith Foundation for Health Research (16876), and the Canada Foundation for Innovation (JELF-34879). PB was supported by a 4-year CELL fellowship from UBC.

Version history

  1. Preprint posted:
  2. Sent for peer review:
  3. Reviewed Preprint version 1:
  4. Reviewed Preprint version 2:
  5. Version of Record published:

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.109426. This DOI represents all versions, and will always resolve to the latest one.

Copyright

© 2025, Biswas and Rideout

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 551
    views
  • 29
    downloads
  • 2
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Citations by DOI

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Puja Biswas
  2. Elizabeth J Rideout
(2026)
Sex-biased expression of enteroendocrine cell-derived hormones contributes to higher fat storage in Drosophila females
eLife 14:RP109426.
https://doi.org/10.7554/eLife.109426.3

Share this article

https://doi.org/10.7554/eLife.109426