Patient-specific midbrain organoids with CRISPR correction recapitulate neuronopathic Gaucher disease phenotypes and enable evaluation of novel therapies
- Division of Human Genetics, Cincinnati Children’s Hospital Medical Center, United States
- Department of Pediatrics, University of Cincinnati College of Medicine, United States
- Pluripotent Stem Cell Facility and Developmental Biology, Cincinnati Children’s Hospital Medical Center, United States
- Division of Infectious Diseases, Cincinnati Children’s Hospital Medical Center, United States
- Transgenic Animal and Genome Editing Facility, Cincinnati Children’s Hospital Medical Center, United States
- Division of Developmental Biology, Cincinnati Children’s Hospital Medical Center, United States
- Division of Pathology and Laboratory Medicine, Cincinnati Children’s Hospital Medical Center, United States
- Division of Hematology/Oncology, Department of Internal Medicine, University of Cincinnati, College of Medicine, United States
- Department of Microbiology and Immunology, University of Maryland School of Medicine, United States
Figures
Figure 1
Generation and characterization of midbrain-like organoids (MLOs) from healthy human (h) iPSCs (WT-75.1 hiPSCs).
(A) A schematic overview of the procedures for generating MLOs from healthy WT-75.1 hiPSCs. (B) Representative confocal images showing architectural structure of week (Wk) 8 MLOs containing new-born neurons (Tuj1/NeuN), astrocytes (GFAP), dopaminergic neurons (FOXA2/TH), and neural progenitor cells (SOX2/Ki67). Merge images show the distribution of those cell markers. (C) FOXG1 expression in MLO and cerebral organoid (CO). Transcription factor FOXG1 (forebrain marker) was enriched in CO at Wk8 of differentiation but absent in MLO. Pan-neurons (NeuN) were both present in MLO and CO, as shown by NeuN immunostaining (neuronal marker). (D) Quantitative analysis of cell type specific genes expression for midbrain/dopaminergic neuron (FOXA2/ASCL1/LXM1A/PLZF/TH), glial cells (GLAST/S100B), and multipotent stem cells (SOX2/NANOG/OCT4) in Wk3 and Wk8 MLOs by qRT-PCR. Data are presented as mean ± SEM (n = 3 MLOs pooled for each group). (E) Immunoblot of Sox2, Tuj1, MAP2, TH, GFAP, and S100B in WT-75.1 hiPSCs and its derived MLO (Wk8, n = 3 MLOs pooled for each group) lysate. β-Actin was used as a loading control.
-
Figure 1—source data 1
Original files for western blot analysis are shown in Figure 1E.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig1-data1-v1.zip
-
Figure 1—source data 2
PDF file containing original western blots Figure 1E, including the relevant bands and sample conditions.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig1-data2-v1.zip
Figure 2 with 1 supplement
GCase deficiency drives glycosphingolipid accumulation and transcriptomic alteration in GD MLOs.
The GD MLOs were generated as in Figure 1A. (A) Reduced GCase protein in GD MLO (GD2-1260). Wk8 MLOs (n = 3) were pooled as a biological sample. GAPDH was used as a loading control. (B) GCase activity in hiPSCs and MLOs (>3 MLOs were pooled for each group). Data were normalized to WT-75.1 control. (C) Representative images of WT-75.1 and GD2-1260 MLOs at Wks 4, 8, and 15 of differentiation. (D) MLO size was measured based on the area of MLO spheres and normalized to WT-75.1 control at each indicated time point. N ≥ 10 MLOs were quantified per group. (E, F) Measurement of total glucosylceramide (GluCer) and GluCer species in Wk15 MLO. (A, B, D, E–G) Data are presented as mean ± SEM. *p < 0.05, ***p < 0.001, ns, not significant, unpaired Student’s t-test. (G) Glucosylsphingosine (GluSph) levels in Wk15 and Wk28 MLOs (3~5 MLOs were pooled for each group). GluCer and GluSph levels in the organoids were measured by LC–MS/MS and normalized by corresponding total protein of MLO tissue lysate. (H) 3D principal component analysis (PCA) of bulk RNA sequencing (RNA-seq) data. The Euclidean distance of the normalized gene expression among healthy control (WT-75.1) and GD (GD2-1260) MLOs was used for sample clustering. Ellipsoids around each group indicate the distribution and spread of the samples within the sample group. Wk8 MLOs (n = 3) were pooled as one biological sample, and three samples were profiled in each group. (I) MA plot showing the distinct genes differentially expressed in GD MLOs. Statistically significant differentially expressed genes (DEGs; |fold change| ≥1, p-adj ≤0.05 and base mean ≥50) were highlighted in red. The number of DEGs downregulated and upregulated in GD2-1260 MLO against WT-75.1 MLO was shown. FC, fold change. Dysregulated pathways in GD MLOs analyzed by GO (gene ontology) (J) and Kyoto Encyclopedia of Genes and Genomes (KEGG) (K) enrichment of DEGs. Both gene counts and level of significance (−log10 of p-value) were shown as stacked columns for each category. (L–O) Heatmaps of dysregulated pathways or biological functions in GD MLO. Specifically, aberrant expressions of genes involved in WNT signaling (L), anterior-posterior brain specification (M), neuronal function (N), and lysosome–phagosome (O) were shown.
-
Figure 2—source data 1
Original files for western blot analysis are shown in Figure 2A.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig2-data1-v1.zip
-
Figure 2—source data 2
PDF file containing original western blots Figure 2A, including the relevant bands and MLO sample names.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig2-data2-v1.zip
Figure 2—figure supplement 1
Representative UHPLC–MS/MS chromatograms of GluSph and GluCer species in WT-75.1 and GD2-1260 MLOs.
Tissues from Wk28 MLOs were tested.
Figure 3
Skewed specification of midbrain patterning and dopaminergic neuron differentiation in GD MLOs.
(A) Gene expression of FOXP1, FOXG1, and PAX6 in week 8 WT-75.1 and GD2-1260 MLOs. Data were plotted using RNA sequencing counts. ***p < 0.001, unpaired Student’s t-test. (B, C) Aberrant expression of FOXP1/FOXG1 transcription machinery for forebrain/midbrain patterning in GD MLOs. Representative confocal images (B) and quantification of Wk8 WT-75.1 and GD2-1260 MLOs, immunostained for FOXP1 (red) and FOXG1 (green), with DAPI (blue) labeling nuclei. Yellow arrows indicate FOXP1+FOXG1+ cells. Scale bar, 50 µm. Data are presented as mean ± SEM. *p < 0.05, **p < 0.01, unpaired Student’s t-test. (D) Confocal images of Wk6 MLOs, immunostained for midbrain patterning markers FOXA2 (green) or TH (red), with DAPI (blue) labeling nuclei. Scale bar, 200 µm. (E) Representative images of differentiating DA neurons in MLOs derived from WT-75.1 and GD2-1260 hiPSCs. TH (red), FOXA2 (green) were co-stained, with DAPI (blue) labeling nuclei. Yellow arrows indicate TH+FOXA2+ cells. Scale bar, 50 µm. (F) Quantification of midbrain progenitor markers ASCL1, TH, LMX1A, and PLZF expression in WT-75.1 and GD2-1260 MLOs at Wk3 and Wk8, measured by qRT-PCR and normalized to WT-75.1 hiPSC cells. Data are presented as mean ± SEM (n = 3–4 MLOs per group). *p < 0.05, **p < 0.01. (G) Immunoblot analysis of midbrain/dopaminergic neuron markers TH, FOXA2, and MAP2 in Wk16 MLOs. Protein samples were extracted from n = 3 MLOs from each group. β-Actin was used as a loading control. (H) Relative protein levels of TH, FOXA2, and MAP2 in Wk8 GD2-1260 MLOs compared to WT-75.1. Data are presented as mean ± SEM (n = 4 per group). *p < 0.05, **p < 0.01, unpaired Student’s t-test. (I) Dopamine levels in MLO culture medium assay by ELISA. Culture medium from four GD2-1260 MLOs or WT-75.1 MLOs at Wk12 cultured in 3 ml BGM medium for 72 hr was assayed. Data are presented as mean ± SEM (n = 5 per group). ***p < 0.001, unpaired Student’s t-test.
-
Figure 3—source data 1
Original files for western blot analysis are shown in Figure 3G.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig3-data1-v1.zip
-
Figure 3—source data 2
PDF file containing original western blots Figure 3G, including the relevant bands and MLO sample names.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig3-data2-v1.zip
Figure 4 with 2 supplements
Mutation correction significantly rescued disease phenotypes in GD MLOs.
(A) Schematic overview of CRISPR/Cas9-mediated mutation correction of the GBA1 L444P mutation in GD2-1260 hiPSCs, converting the L444P (L444P/P415R) mutation (Proline, P to Leucine, L) to the wild-type sequence (WT-P415R), generating isogenic iso-GD2-1260 hiPSCs. The mutated base C in amino acid code ‘CCG’ for proline (P) was corrected to T to decode leucine (L, CTG), which was confirmed by genome sequencing of GBA1 locus. (B, C) Immunoblot analysis of GCase protein and quantification in week 16 MLOs derived from WT-75.1, GD2-1260, and iso-GD2-1260 hiPSCs. β-Actin was used as a loading control. Data are presented as mean ± SEM (n = 2 pooled, and 3 biological replicates per group). ***p < 0.001, unpaired Student’s t-test. (D) Relative GCase activity in GD2-1260 and iso-GD2-1260 hiPSCs and Wk8 MLOs, normalized to WT-75.1 controls. Data are presented as mean ± SEM (2 MLOs pooled, n = 3 per group). ***p < 0.001, unpaired Student’s t-test. (E) Measurement of GluSph levels in WT-75.1, GD2-1260, and iso-GD2-1260 MLOs at Wk15 and Wk28 and their culture medium at Wk15, quantified by LC–MS/MS and normalized to total protein of tissue lysate. Data are presented as mean ± SEM. For GluSph in MLO, three MLOs were pooled and n = 3 per group. For MLO secreted GluSph, MLO culture medium in wells containing four MLOs were collected, n = 3 per group. **p < 0.01; ns, not significant. One-way ANOVA test. (F) Representative bright-field images of WT-75.1, GD2-1260, and iso-GD2-1260 MLOs at day 2, Wks 4, 8, and 15 of differentiation. Scale bar, 1 mm. For side-by-side comparison, images for WT-75.1 and GD2-1260 at Wks 4, 8, and 15 were taken from Figure 2C. (G) MLO size quantification for WT-75.1, GD2-1260, and iso-GD2-1260 MLOs at Wks 4, 8, and 15. MLOs size was analyzed by NIS elements and presented as the area (µm2) of MLO at indicated time point. N ≥ 10 MLOs were quantified per group. Data are presented as mean ± SEM. One-way ANOVA. ns, not significant. Immunoblot analysis of midbrain/dopaminergic neuron markers TH and FOXA2 (H) and their relative quantification (I) in Wk8 MLOs. Protein samples were extracted from n = 3 MLOs from each group. GAPDH was used as a loading control. Data are presented as mean ± SEM. One-way ANOVA test with Tukey’s test; *p < 0.05, ***p < 0.001. (J) Dopamine levels in the culture medium of Wk12 MLOs derived from WT-75.1, GD2-1260, and iso-GD2-1260 hiPSCs, measured after 72 hr in BGM medium (n = 4 MLOs per samples, 3 biological replicates). Data are presented as mean ± SEM (n = 5 per group). One-way ANOVA test with Tukey’s test; *p < 0.05, ***p < 0.001. (K, L) Immunoblot analysis of autophagy–lysosomal pathway markers LAMP1 and Cathepsin D (K) and quantification (L) in Wk16 MLOs. GAPDH was used as a loading control. Data are presented as mean ± SEM. One-way ANOVA test with Tukey’s test; *p < 0.05, ***p < 0.001, ns, not significant. Immunoblot analysis of LC3-I and LC3-II (M) and quantification (N) in Wk16 MLOs. Protein samples were extracted from n = 3 MLOs for each group. GAPDH was used as a loading control. Data are presented as mean ± SEM. One-way ANOVA test with Tukey’s test; **p < 0.01, ***p < 0.001; ns, not significant. (O) Immunoblot analysis of mTOR signaling pathway components [4E-BP1, P-4E-BP1(THR37/46), S6, and P-S6 (Ser235/236)] in Wk16 MLOs. β-Actin was used as a loading control. (P) Quantification of protein levels of mTOR signaling pathway components. Data are normalized to WT-75.1 and presented as mean ± SEM. Immunoblot analysis for panels H and I and K–P was performed using the lysate from 3 MLOs pooled per group, 3 repeated experiments. One-way ANOVA test with Tukey’s test. ***p < 0.001; ns, not significant.
-
Figure 4—source data 1
Original files for western blot analysis are shown in Figure 4B, H, K, M, O.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig4-data1-v1.zip
-
Figure 4—source data 2
PDF file containing original western blots Figure 4B, H, K, M, O, including the relevant bands for immunoblotted targets and MLO samples.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig4-data2-v1.zip
Figure 4—figure supplement 1
Correct L444P mutation in nGD iPSC by CRISPR–Cas9.
(A) Single-stranded oligonucleotide design. Silent mutations in upper case. Phosphorothioate modified bases (*). (B) Genomic sequence of mutant, wild type, and corrected GBA1. Mutated codon highlighted in red. T insertion for point mutation correction highlighted in yellow. PAM highlighted in gray. sgRNA target sequence underlined. (C) DNA electrophoresis gels showing genome editing and clone screening for iso-GD2-1260 (clone #9). (D) Karyotyping of GD2-1260 and CRISPR/Cas9 corrected iso-GD2-1260 hiPSCs. Normal karyotypes were observed in both hiPSC lines. (E) Relative mRNA expression of genes (OCT4, NANOG, and SOX2) required for generating and maintaining hiPSCs pluripotency by quantitative RT-PCR (mean ± SEM; n = 3). ns, not significant by one-way ANOVA analysis.
-
Figure 4—figure supplement 1—source data 1
Original DNA electrophoresis gel images corresponding to Figure 4—figure supplement 1C.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig4-figsupp1-data1-v1.zip
-
Figure 4—figure supplement 1—source data 2
PDF file containing original DNA electrophoresis gel images corresponding to Figure 4—figure supplement 1C.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig4-figsupp1-data2-v1.zip
Figure 4—figure supplement 2
Neural rosette formation during MLO maturation was not affected by GBA1 mutation.
(A) Cryosections of Wk6 MLOs derived from WT-75.1, GD2-1260, and isogenic control iso-GD2-1260 hiPSC cells. Sections were stained with antibodies against Ki67 and Sox2, and nuclei were costained with DAPI. Scale bar, 100 µm. (B) Quantification of the Sox2+, Ki67+, and Sox2+/Ki67+ cells (mean ± SEM; n = 3). ns, not significant by one-way ANOVA analysis.
Figure 5 with 2 supplements
Delivery of GCase to MLOs via SapC-DOPS nanoparticles corrects GD phenotypes.
(A) Schematic illustration of SapC-DOPS nanoparticle-mediated delivery of recombinant GCase (fGCase) to MLOs. SapC-DOPS nanoparticles carrying fGCase or fluorescent label CVM were co-cultured with MLOs, followed by short-term (48 hr) or 2-week treatment period before analysis. (B) Confocal images of untreated and SapC-DOPS-CVM-treated MLOs, showing uptake of CVM (magenta) with DAPI (blue) labeling nuclei. Scale bars: 200 µm (left panel), 50 µm (right panels, magnified regions a and b). (C) GCase activity in WT-75.1 and GD2-1260 MLOs following a 48-hr treatment with SapC-DOPS-fGCase. Data are presented as mean ± SEM (3 MLOs pooled, n = 3 per group). ***p < 0.001, one-way ANOVA test. (D) Confocal images of WT-75.1, GD2-1260, and GD2-10-257 MLOs treated with SapC-DOPS or SapC-DOPS-fGCase for 2 weeks, immunostained for GCase (green) with DAPI (blue) labeling nuclei. Scale bar, 200 µm. (E–G) GCase activity and protein in WT-75.1 and GD (GD2-1260, GD2-10-257) MLOs treated with SapC-DOPS or SapC-DOPS-fGCase for 2 weeks, measured by enzymatic assay and immunoblot. Data are presented as mean ± SEM (3 MLOs pooled, n = 3–4 per group). ***p < 0.001; ns, not significant. One-way ANOVA test. Protein samples were extracted from n = 3 MLOs for each group. (H, I) GluSph levels in WT-75.1 and GD (GD2-1260, GD2-10-257) MLOs treated with SapC-DOPS or SapC-DOPS-fGCase for 2 weeks, quantified by LC–MS/MS and normalized to total protein. Data are presented as mean ± SEM (3 MLOs pooled, n = 3–4 per group). ***p < 0.001; **p < 0.01; ns, not significant. One-way ANOVA test. (J) Immunoblot analysis of autophagy–lysosomal and mTOR pathway proteins in SapC-DOPS or SapC-DOPS-fGCase treated GD2-1260 MLOs. GAPDH was used as a loading control. Protein samples were extracted from n = 3 MLOs for each group. Protein levels are normalized to WT-75.1 untreated controls (set to 1.0).
-
Figure 5—source data 1
Original files for western blot analysis are shown in Figure 5E, F, G, J.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig5-data1-v1.zip
-
Figure 5—source data 2
PDF file containing original western blots Figure 5E, F, G, J, including the relevant bands for immunoblotted targets, MLO sample and experimental conditions.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig5-data2-v1.zip
Figure 5—figure supplement 1
Restoration of GCase expression in dopaminergic neurons and astrocytes in SapC-DOPS-fGCase treated nGD MLOs.
Representative confocal images of GD2-1260 (A) and GD2-10-257 MLOs (B) treated with SapC-DOPS-fGCase for 2 weeks, immunostained for GCase (green) and dopaminergic neurons (TH, red) with DAPI (blue) labeling nuclei. Representative immunostaining images for GCase (green) and astrocytes (GFAP, red) in GD2-1260 (C) and GD2-10-257 MLOs (D) treated with SapC-DOPS-fGCase. Scale bar, 50 µm. Yellow arrows indicate colocalized GCase in TH+ cells. (E) Immunoblot of TH in Wk16 and Wk28 GD2-10-257 MLOs.
-
Figure 5—figure supplement 1—source data 1
Original files for western blot analysis are shown in Figure 5—figure supplement 1E.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig5-figsupp1-data1-v1.zip
-
Figure 5—figure supplement 1—source data 2
PDF file containing original western blots Figure 5—figure supplement 1E, including the relevant bands for immunoblotted targets and MLO samples.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig5-figsupp1-data2-v1.zip
Figure 5—figure supplement 2
Restoration of GCase expression in lysosomal and autophagosomal compartments in SapC-DOPS-fGCase treated nGD MLOs.
Representative confocal images of GD2-1260 (A) and GD2-10-257 MLOs (B) treated with SapC-DOPS-fGCase for 2 weeks, immunostained for GCase (green) and lysosomal marker LAMP1 (red) with DAPI (blue) labeling nuclei. Yellow arrows indicate colocalized GCase in LAMP1+ compartments. Scale bar, 50 µm. Representative confocal images of GD2-1260 (C) and GD2-10-257 MLOs (D) treated with SapC-DOPS-fGCase for 2 weeks, immunostained for GCase (green) and autophagosomal marker LC3B (red) with DAPI (blue) labeling nuclei. Yellow arrows indicate colocalized GCase in LC3B+ compartments. Scale bar, 50 µm.
Figure 6
AAV9-GBA1 gene therapy mitigates disease phenotypes in GD MLOs.
(A) Schematic illustration of AAV9-GBA1 gene therapy delivery to MLOs using a nanoliter injector. AAV9 vectors carrying the GBA1 gene (AAV9-GBA1) are administered to Wk13 MLOs. The samples were analyzed after 3 weeks of treatment. (B) GCase activity in WT-75.1, GD2-1260, and GD2-10-257 MLOs and AAV9-GBA1-treated MLOs were measured by enzymatic assay. Data are presented as mean ± SEM (3 MLOs pooled, n = 3–6 per group). ***p < 0.001, one-way ANOVA test. (C) GluSph levels in AAV9-GBA1-treated GD and control MLOs were quantified by LC–MS/MS and normalized to total protein. Data are presented as mean ± SEM (3 MLOs pooled, n ≥ 3 per group). ***p < 0.001; ns, not significant. One-way ANOVA test. (D) Immunoblot analysis of LAMP1 and TH in WT-75.1 and in GD2-1260 MLOs untreated or treated with AAV9-GBA1. Protein samples were extracted from n = 3 MLOs for each group. Protein levels are normalized to WT-75.1 untreated controls (set to 1.0). (E) Transgene expressions (yellow arrows and enlarged insert) in neurons (NeuN), DA neurons (TH), and astrocytes (GFAP) of AAV9-GBA1-treated GD2-1260 MLOs. Scale bar = 50 µm.
-
Figure 6—source data 1
Original files for western blot analysis are shown in Figure 6B, D.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig6-data1-v1.zip
-
Figure 6—source data 2
PDF file containing original western blots Figure 6B, D, including the relevant bands for immunoblotted targets, MLO sample, and experimental conditions.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig6-data2-v1.zip
Figure 7 with 1 supplement
Substrate reduction therapy with GZ452 reduces lipid accumulation and improves autophagic and lysosomal abnormalities in GD MLOs.
(A) Assessment of GZ452 tolerated dose in healthy MLO and the effect of GZ452 on organoid growth in WT-75.1 MLOs over 6 weeks. Data are presented as mean ± SEM (3 MLOs pooled, n = 3). *p < 0.05, **p < 0.01; one-way ANOVA test. Total GluCer levels (B) and distribution of GluCer species (C) in WT-75.1 MLOs with various doses of GZ452 at Wk6. Data are presented as mean ± SEM (3 MLOs pooled, n = 3 per concentration). *p < 0.05, **p < 0.01; one-way ANOVA test. (D) Schematic of the experimental timeline for short-term (2 weeks) GZ452 treatment of GD MLOs. GluCer (E) and GluSph (F) levels in WT-75.1 and GD2-1260 MLOs at Wk15 under short-term GZ452 treatment. Data were normalized to protein mass. Data are presented as mean ± SEM (3 MLOs pooled, n = 3–4). *p < 0.05, **p < 0.01; one-way ANOVA test. (G) Schematic of the experimental timeline for long-term (28 weeks) GZ452 treatment in GD MLOs. (H) GluSph levels in MLOs at Wk15 under long-term GZ452 treatment. Data were normalized to protein mass. Data are presented as mean ± SEM (3 MLOs pooled, n = 3–8). ***p < 0.01, ns, not significant; one-way ANOVA test. (I) Immunoblot analysis of LAMP1 and LC3-I/II in substrate reduction therapy (SRT)-treated GD2-1260 MLOs for 28 weeks, with β-actin as loading control. Protein samples were extracted from n = 3 MLOs for each group. (J) Quantification of LAMP1 and LC3-II/I in MLOs. Protein levels are normalized to WT-75.1 untreated controls (set to 1.0). Data are presented as mean ± SEM (n = 3). **p < 0.01; ***p < 0.001; ns, not significant. One-way ANOVA with Tukey’s test.
-
Figure 7—source data 1
Original files for western blot analysis are shown in Figure 7I.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig7-data1-v1.zip
-
Figure 7—source data 2
PDF file containing original western blots Figure 7I, including the relevant bands for immunoblotted targets, MLO sample, and experimental conditions.
- https://cdn.elifesciences.org/articles/109518/elife-109518-fig7-data2-v1.zip
Figure 7—figure supplement 1
Influence of substrate reduction therapy (SRT) drug GZ452 on DA neuron differentiation in WT-75.1 MLOs.
Relative mRNA expression of midbrain markers ASCL1, TH, and PLZF in WT-75.1 at Wk6 in untreated or treated MLOs with indicated concentrations of GZ452. Relative gene expression is normalized to untreated control WT-75.1 MLOs (set to 1.0) (mean ± SEM; n = 2–3). ns, not significant by one-way ANOVA analysis.
Author response image 1
qRT-PCR quantification of midbrain progenitor marker EN1 expression in WT-75.
1 and GD2-1260 MLOs at Wk3 and Wk8. Data was normalized to WT-75.1 hiPSC cells and presented as mean ± SEM (n = 3-4 MLOs per group). ns, not significant.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Tuj1 (mouse monoclonal) | BioLegend | Cat#801201; RRID:AB_2313773 | 1:1000 in immunoblot; 1:100 in immunostaining |
| Antibody | NeuN (mouse monoclonal) | Millipore | Cat#MAB377; RRID:AB_2298772 | 1:100 in immunostaining |
| Antibody | FOXA2 (rabbit monoclonal) | Cell Signaling Technology | Cat#8186S; RRID:AB_10891055 | 1:1000 in immunoblot; 1:100 in immunostaining |
| Antibody | GFAP (mouse monoclonal) | STEMCELL Technologies | Cat#60048.1; RRID:AB_3095092 | 1:1000 in immunoblot; 1:100 in immunostaining |
| Antibody | TH (rabbit polyclonal) | Millipore | Cat#AB152; RRID:AB_390204 | 1:1000 in immunoblot; 1:100 in immunostaining |
| Antibody | TH (mouse monoclonal) | Cell Signaling Technology | Cat#45648S; RRID:AB_3677640 | 1:50 in immunostaining |
| Antibody | 4e-bp1 (rabbit polyclonal) | Cell Signaling Technology | Cat#9452S; RRID:AB_331692 | 1:1000 in immunoblot |
| Antibody | Phospho-4E-BP1 (Thr37/46) (rabbit monoclonal) | Cell Signaling Technology | Cat#2855S; RRID:AB_560835 | 1:1000 in immunoblot |
| Antibody | β-Actin (mouse monoclonal) | Invitrogen | Cat#MA5-15739; RRID:AB_10979409 | 1:1000 in immunoblot |
| Antibody | Cathepsin D (rabbit monoclonal) | Novusbio | Cat#NBP2-67477; RRID:AB_3095093 | 1:1000 in immunoblot |
| Antibody | FOXG1 (rabbit polyclonal) | Abcam | Cat#ab18259; RRID:AB_732415 | 1:100 in immunostaining |
| Antibody | FOXP1 (mouse monoclonal) | Millipore | Cat#MAB45341; RRID:AB_3658314 | 1:100 in immunostaining |
| Antibody | GAPDH (mouse monoclonal) | Millipore | Cat#MAB374; RRID:AB_2107445 | 1:1000 in immunoblot |
| Antibody | GFP (chicken polyclonal) | Abcam | Cat#ab13970; RRID:AB_300798 | 1:100 in immunostaining |
| Antibody | GFP (mouse monoclonal) | Invitrogen | Cat#A11120; RRID:AB_221568 | 1:100 in immunostaining |
| Antibody | hGCase (NY#10, rabbit polyclonal) | Made in lab | Made in lab, NY#10; RRID:AB_3677641 | 1:1000 in immunoblot; 1:100 in immunostaining |
| Antibody | SOX2 (rabbit monoclonal) | Cell Signaling Technology | Cat#23064S; RRID:AB_2714146 | 1:1000 in immunoblot; 1:100 in immunostaining |
| Antibody | Ki67 (mouse monoclonal) | Cell Signaling Technology | Cat#9449S; RRID:AB_2797703 | 1:100 in immunostaining |
| Antibody | Lamp1 (mouse monoclonal) | Bioss | Cat#bsm-51301M; RRID:AB_3677642 | 1:1000 in immunoblot; 1:100 in immunostaining |
| Antibody | LC3B (rabbit polyclonal) | Novusbio | Cat#NB100-2220; RRID:AB_10003146 | 1:1000 in immunoblot; 1:100 in immunostaining |
| Antibody | MAP2 (rabbit polyclonal) | Cell Signaling Technology | Cat#4542S; RRID:AB_10693782 | 1:1000 in immunoblot; 1:100 in immunostaining |
| Antibody | PAX6 (rabbit polyclonal) | Covance | Cat#14811801; RRID:AB_2315064 | 1:100 in immunostaining |
| Antibody | S6 Ribosomal Protein (rabbit monoclonal) | Cell Signaling Technology | Cat#2217S; RRID:AB_331355 | 1:1000 in immunoblot |
| Antibody | Phospho-S6 Ribosomal Protein (Ser235/236) (rabbit monoclonal) | Cell Signaling Technology | Cat#4856S; RRID:AB_2181037 | 1:1000 in immunoblot |
| Chemical compound, drug | Ascorbic acid | Peprotech | Cat#5088177 | |
| Chemical compound, drug | db-cAMP | Sigma-Aldrich | Cat#D0627-250MG | |
| Chemical compound, drug | Y-27632; ROCK inhibitor | Tocris Bioscience | Cat#1254 | |
| Commercial assay or kit | CEPT | Bio-Techne | Cat#7991 | |
| Chemical compound, drug | Dorsomorphin | Millipore | Cat#171261-1MG | |
| Chemical compound, drug | A83-01 | STEMCELL Technologies | Cat#72024 | |
| Chemical compound, drug | CHIR99021 | STEMCELL Technologies | Cat#72052 | |
| Chemical compound, drug | IWP2 | STEMCELL Technologies | Cat#72122 | |
| Chemical compound, drug | SAG | STEMCELL Technologies | Cat#73412 | |
| Peptide, recombinant protein | Vitronectin | Thermo Fisher | Cat#A14700 | |
| Peptide, recombinant protein | FGF-Basic (FGF-b, human) | Thermo Fisher | Cat#PHG0264 | |
| Peptide, recombinant protein | FGF8 | Thermo Fisher | Cat#100-25A-100UG | |
| Peptide, recombinant protein | Laminin | STEMCELL Technologies | Cat#77003 | |
| Peptide, recombinant protein | BDNF | STEMCELL Technologies | Cat#78005.1 | |
| Peptide, recombinant protein | GDNF | STEMCELL Technologies | Cat#78058.1 | |
| Peptide, recombinant protein | Growth Factor Reduced (GFR) Matrigel | Corning | Cat#354230 | |
| Commercial assay or kit | Dopamine ELISA Kit | Abnova | Cat#KA3838 | |
| Cell line (Homo sapiens) | WT-75.1 | PSCF at CCHMC (Sun et al., 2015; Pitstick et al., 2022) | RRID:CVCL_C1UB | |
| Cell line (H. sapiens) | GD2-1260 | PSCF at CCHMC (Sun et al., 2015) | ||
| Cell line (H. sapiens) | GD2-10-257 | See Awad et al., 2017 | ||
| Sequence-based reagent | NANOG FP | See Kwak et al., 2020 | PCR primers | TGCAACCTGAAGACGTGTGA |
| Sequence-based reagent | NANOG RP | See Kwak et al., 2020 | PCR primers | CTATGAGGGATGGGAGGA |
| Sequence-based reagent | OCT4 FP | See Kwak et al., 2020 | PCR primers | GACAGGGGGAGGGGAGGAGCTAGG |
| Sequence-based reagent | OCT4 RP | See Kwak et al., 2020 | PCR primers | CTTCCCTCCAACCAGTTGCCCCAAAC |
| Sequence-based reagent | PLZF FP | See Kwak et al., 2020 | PCR primers | TCCCGCCCGACTGGAGGATA |
| Sequence-based reagent | PLZF RP | See Kwak et al., 2020 | PCR primers | TTCTTTCCTGGCTCCCCGCTC |
| Sequence-based reagent | FOXG1 FP | See Kwak et al., 2020 | PCR primers | GCGGGCCAGACCAGTTACTT |
| Sequence-based reagent | FOXG1 RP | See Kwak et al., 2020 | PCR primers | CCCAGACAGTCCCGTCGTAA |
| Sequence-based reagent | TH FP | See Kwak et al., 2020 | PCR primers | CTGAGATTCGGGCCTTCGAC |
| Sequence-based reagent | TH RP | See Kwak et al., 2020 | PCR primers | TGCACCTAGCCAATGGCACT |
Additional files
-
Supplementary file 1
Summary of therapeutic modalities on nGD MLOs.
- https://cdn.elifesciences.org/articles/109518/elife-109518-supp1-v1.docx
-
Supplementary file 2
Key dysregulated pathways.
- https://cdn.elifesciences.org/articles/109518/elife-109518-supp2-v1.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/109518/elife-109518-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Patient-specific midbrain organoids with CRISPR correction recapitulate neuronopathic Gaucher disease phenotypes and enable evaluation of novel therapies
eLife 15:RP109518.
https://doi.org/10.7554/eLife.109518.3
