Constraints on the G1/S transition pathway may favor selection of multicellularity as a passenger phenotype
- Université Bordeaux, CNRS, IBGC, UMR 5095, France
Figures
Figure 1 with 1 supplement
Competition experiments.
(A) Experimental set-up of the co-culture competition experiments between ace2/ace2 and ACE2/ACE2 strains. A 50/50 mix of the two strains based either on phenotype (snowflake vs planktonic, microscopy) or on genotype (ace2 vs ACE2, qPCR) was inoculated in SDcasaWAU liquid medium. The resulting co-culture was grown for 2 days until stationary phase was reached and then diluted in new SDcasaWAU medium. For each dilution step, the proportion of the snowflake phenotype or ace2 genotype was determined (by microscopy or qPCR, respectively). (B) Evolution of the percentage of snowflake entities during independent co-culture competitions between ace2/ace2 and ACE2/ACE2 strains, either cln3/cln3 (red bars) or CLN3/CLN3 (black bars) (N=4, n>250, mean ± SD, ns p>0.05, *p<0.05, ***p<0.001). The percentage of snowflakes is statistically compared between CLN3/CLN3 and cln3/cln3 co-cultures at each dilution round, using a Fisher’s exact test. (C) The proportion of ace2/ace2 genotype was monitored by qPCR in independent competitions in cln3/cln3 (red bars) and CLN3/CLN3 (black bars) backgrounds. The ACT1 locus, amplified in all the cells of the population, was used to normalize the proportion of ace2 cells in the co-culture cell population (N=3, mean ± SD, unpaired t-test, Welch correction, ns p>0.05, ***p<0.001). (D) Evolution of the percentage of snowflake entities during independent co-culture competitions between ace2/ace2 and ACE2/ACE2 strains overexpressing WHI5 (orange bars) or not (black bars) (N=3, n>235, mean ± SD, Fisher’s exact test, ns p>0.05, *p<0.05, **p<0.005, ***p<0.001).
-
Figure 1—source data 1
Competition experiments.
- https://cdn.elifesciences.org/articles/109833/elife-109833-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Characterization of the snowflakes.
(A) Number of cells per Snowflake entity determined by counting the number of HTB1-CFP positive nuclei per Snowflake entity. (B–E) Representative images of CLN3/CLN3 strains, either ACE2/ACE2 (B) or ace2/ace2 (C), and cln3/cln3 strains, either ACE2/ACE2 (D) or ace2/ace2 (E). Bars are 10 µm. (F) Cell volume measured at 2 days of culture (error bars ± SD, unpaired t-test, Welch correction, ***p<0.001, ns p>0.05).
-
Figure 1—figure supplement 1—source data 1
Characterization of the snowflakes.
- https://cdn.elifesciences.org/articles/109833/elife-109833-fig1-figsupp1-data1-v1.xlsx
Figure 2 with 1 supplement
Quiescence exit efficiency explains the results of competition experiments.
(A) Lag phase duration after cell 2-day-old population refeeding with SDcasaWAU medium. The optical density at 600 nm was followed after population refeeding for 4 independent experiments. The mean and the SD are indicated together with an unpaired t-test, Welch correction, ns p>0.05, ***p<0.001. (B) Representative image series of cln3/cln3 cells either ace2/ace2 or ACE2/ACE2 after refeeding of 2 days cultures on a SDcasaWAU medium containing microscope pad. Arrows point to emerging buds. Bars are 10 µm. (C) Proportion of cln3/cln3 cells that have formed a new bud after refeeding on a SDcasaWAU medium containing microscope pad of either ace2/ace2 or ACE2/ACE2 2 days cultures (N=3, n>101, Fisher’s exact test, mean ± SD, ns p>0.05, *p<0.05, **p<0.005, ***p<0.001). (D) Same as C in a cln3 haploid background (N=3, n>100, mean ± SD, Fisher’s exact test, **p<0.005, ***p<0.001). (E) Percentage of snowflake entities observed in independent co-cultures of ace2/ace2 and ACE2/ACE2 strains. Cultures either went through cycles of proliferation and stationary phase as described in Figure 1A (right panel), or maintained in constant exponential phase (left panel) (N>3, n>208, mean ± SD, Fisher’s exact test, ns p>0.05). (F) Same as A except that the refeeding was done after a culture of 5 days (N=3, mean ± SD, unpaired t-test, Welch correction, **p<0.005). (G) Percentage of snowflake entities observed in independent co-cultures of ace2/ace2 and ACE2/ACE2 strains diluted every two days (red and black bars) or every five days (gray and pink bars) (N≥3, n>700, mean ± SD, Fisher’s exact test, ns p>0.05, **p<0.005, ***p<0.001).
-
Figure 2—source data 1
Quiescence exit efficiency.
- https://cdn.elifesciences.org/articles/109833/elife-109833-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Characterization of the various phases of the growth curve.
(A) Theoretical diagram showing the various phenomena that can explain, either alone or combined, how one subpopulation can outcompete another subpopulation in a co-culture. One subpopulation may divide more rapidly in exponential phase (a), may have a higher yield (b), may undergo less cell death during stationary phase (c) or may re-enter proliferation phase faster after refeeding (d). (B) Doubling time of populations in proliferation phase. Independent cultures (N>3) were maintained in constant proliferation phase for more than 24 hr, then the optical density at 600 nm was measured every 15 min for 8 hr (mean ± SD, unpaired t-test, Welch correction, ns p>0.05). (C–D) The dry biomass determined by filtration (C, N=3, mean ± SD, unpaired t-test, Welch correction, ns p>0.05) and the percentage of dead cells stained with ethylene blue (D, N=3, n>280, mean ± SD, Fisher’s exact test, ns p>0.05,) were also measured for 2 days stationary phase cultures. (E) Proportion of CLN3/CLN3 cells that have formed a new bud after refeeding on a SDcasaWAU medium containing microscope pad of either ace2/ace2 or ACE2/ACE2 2 days cultures (N=3, n>101, Fisher’s exact test, mean ± SD, ns p>0.05). (F) Proportion of CLN3 cells that have formed a new bud after refeeding on a SDcasaWAU medium containing microscope pad of either ace2 or ACE2 2 days cultures (N=3, n>91, Fisher’s exact test, mean ± SD, ns p>0.05). (G–J) Representative images of diploid ace2/ace2 snowflakes either cln3/cln3 (G) or CLN3/CLN3 (H), and haploid ace2 snowflakes either cln3 (I) or CLN3 (J). Bars are 10 µm. (K). Size distribution of snowflakes in haploid (empty circles) or diploids (plain circles) backgrounds, either CLN3 (black) or cln3 (red). Size is estimated by measuring both the longest segment of the snowflake entity and the longest segment perpendicular to the first one (N=3, n>72). We compared the length of each segment independently with an unpaired t-test with a Welch correction (error bars ± SD, unpaired t-test, Welch correction, ***p<0.001, account for both segments).
-
Figure 2—figure supplement 1—source data 1
Characterization of the various phases of the growth curve.
- https://cdn.elifesciences.org/articles/109833/elife-109833-fig2-figsupp1-data1-v1.xlsx
Figure 3 with 1 supplement
Quintuple cts1, dse2, dse4, egt2, and scw11 mutant strain does not rescue the quiescence-exit default associated with cln3 and are not selected in competition experiments.
(A) Proportion of cln3/cln3 cells, either quintuple mutant or WT, that formed a new bud after refeeding of 2 days cultures on a SDcasaWAU medium containing microscope pad (N=3, n>102, mean ± SD, Fisher’s exact test, ns p>0.05, *p<0.05). (B) Proportion of cln3/cln3 cells, either quintuple mutant or ace2/ace2, that formed a new bud after refeeding of 2 days cultures on a SDcasaWAU medium containing microscope pad (N=3, n>75, mean ± SD, Fisher’s exact test, ns p>0.05, *p<0.05, **p<0.005, ***p<0.001). (C) Evolution of the percentage of snowflake entities during independent co-culture competitions between quintuple mutant and WT strains either cln3/cln3 (red bars) or CLN3/CLN3 (black bars) (N=3, n>250, mean ± SD, Fisher’s exact test).
-
Figure 3—source data 1
Quintuple mutant strains.
- https://cdn.elifesciences.org/articles/109833/elife-109833-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Snowflake characterization of the quintuple mutant strain.
(A) Representative image of the quintuple mutant strain. Bar is 10 µm. (B) Size distribution of quintuple mutant (triangles) or ace2/ace2 (circles) snowflakes. Size is estimated by measuring both the longest segment of the snowflake entity and the longest segment perpendicular to the first one. We compared the length of each segment independently with an unpaired t-test with a Welch correction (N=3, n>60, mean ± SD). (C) Proportion of snowflake entities in a population of quintuple mutant or ace2/ace2 strains (N=3, n>201, mean ± SD, Fisher’s exact test, ns p>0.05).
-
Figure 3—figure supplement 1—source data 1
Snowflake characterization of the quintuple mutant strain.
- https://cdn.elifesciences.org/articles/109833/elife-109833-fig3-figsupp1-data1-v1.xlsx
Figure 4 with 1 supplement
Rescue of the quiescence-exit default associated with cln3 depends on the ace2 mutation and not on the snowflake phenotype.
(A) A 2 day ace2/ace2 cln3/cln3 culture was sonicated and refed onto a fresh SDcasaWAU microscope pad. The proportion of cells that formed a new bud after refeeding on a SDcasaWAU medium containing microscope pad was assessed within different multicellular size ranges (N=3, n>184, mean ± SD, Fisher’s exact test). (B) 2 day cln3 cultures, either ace2 or ACE2, were sonicated and refed onto a fresh SDcasaWAU microscope pad. Within entities formed of 1–3 cells, the proportion of cells that formed a new bud after refeeding on a SDcasaWAU medium containing microscope pad was assessed (N=3, n>63, mean ± SD, Fisher’s exact test, ns p>0.05, *p<0.05, **p<0.005, ***p<0.001).
-
Figure 4—source data 1
Rescue of the quiescent exit default depends on ace2 mutation.
- https://cdn.elifesciences.org/articles/109833/elife-109833-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Effect of sonication on SF phenotype, cell death, and quiescence exit.
(A–B) The effect of sonication bath on an ace2 culture was assessed by measuring the proportion of single cell entities (A, N=3, n>212) and the percentage of dead cells (B, N=3, n>207) in the population before and after the culture was sonicated. (C) Proportion of cln3 cells, either ace2 or ACE2, and either sonicated or not, that formed a new bud after refeeding of 2 days cultures on a SDcasaWAU medium containing microscope pad (N=3, n>63, Fisher’s exact test, mean ± SD).
-
Figure 4—figure supplement 1—source data 1
Effect of sonication on SF phenotype, cell death, and quiescence exit.
- https://cdn.elifesciences.org/articles/109833/elife-109833-fig4-figsupp1-data1-v1.xlsx
Figure 5
Rescue of the quiescence-exit default associated with cln3 is dependent on the Kss1 MAP kinase, which favors transcription of the CLN1 cyclin gene.
(A) Proportion of cln3 kss1 cells, either ace2 or ACE2, that formed a new bud after refeeding of 2 day cultures on a fresh SDcasaWAU medium containing microscope pad (N=3, n>86, mean ± SD, Fisher’s exact test, ns p>0.05). (B) Ratio of CLN1 mRNA level and ACT1 mRNA level, determined by RT-qPCR, 15 min after refeeding of 2 days cln3 cultures, either ace2 or ACE2 (N=3, mean ± SD, unpaired t-test, Welch correction, **p<0.005). (C) Ratio of CLN1 mRNA level and ACT1 mRNA level, determined by RT-qPCR, 15 min after refeeding of 2 day kss1 cln3 cultures, either ace2 or ACE2 (N=3, mean ± SD, unpaired t-test, Welch correction, ns p>0.05).
-
Figure 5—source data 1
Rescue of the quiescent exit default depends on Kss1 MAP kinase.
- https://cdn.elifesciences.org/articles/109833/elife-109833-fig5-data1-v1.xlsx
Figure 6 with 1 supplement
Quiescence exit efficiency and selection in competition experiments of snowflake AMN1368D strains.
(A) Proportion of cln3 cells, either AMN1368D or amn1-368V, that formed a new bud after refeeding of 2 days cultures on a fresh SDcasaWAU medium containing microscope pad (N=3, n>77, mean ± SD, Fisher’s exact test, ns p>0.05, *p<0.05, **p<0.005, ***p<0.001). (B) Evolution of the percentage of snowflake entities during independent co-culture competitions between AMN1368D and amn1-368V strains, either cln3/cln3 (red bars) or CLN3/CLN3 (black bars) (N=3, n>252, mean ± SD, Fisher’s exact test, ns p>0.05, **p<0.005, ***p<0.001). (C) Evolution of the percentage of snowflake entities during independent co-culture competitions between AMN1368D and amn1-368V strains overexpressing WHI5 (orange bars) or not (black bars) (N=3, n>302, Fisher’s exact test, ns p>0.05, **p<0.005, ***p<0.001).
-
Figure 6—source data 1
AMN1368D strain.
- https://cdn.elifesciences.org/articles/109833/elife-109833-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Snowflake characterization of AMN1368D strain.
(A) Representative image of the AMN1368D strain. Bar is 10 µm. (B) Proportion of snowflake entities in populations of AMN1368D or ace2 haploid strains (N=3, n>219, mean ± SD, Fisher’s exact test, ns p>0.05). (C) Size distribution of AMN1368D (diamond) or ace2 (circle) snowflakes. Size is estimated by measuring both the longest segment of the snowflake entity and the longest segment perpendicular to the first one (N=3, n>74, mean ± SD, unpaired t-test, Welch correction, ***p<0.001, account for both segments).
-
Figure 6—figure supplement 1—source data 1
Snowflake characterization of AMN1368D strain.
- https://cdn.elifesciences.org/articles/109833/elife-109833-fig6-figsupp1-data1-v1.xlsx
Figure 7
Model explaining the selection of the Snowflake phenotype as a passenger phenotype.
In strains expressing the non-functional amn1-368V allele (A), a default in quiescence exit after refeeding was observed in a cln3 mutant. In non-laboratory strains (B), the functional AMN1368D allele leads to degradation of Ace2p, which can no longer repress the expression of the Kss1 Map kinase. Kss1p favors the transcription of CLN1, which would favor progression to S phase and partially suppress the default in quiescence exit associated with the cln3 mutation. This observed selective advantage (a) leads to the selection of AMN1368D genotype (b), and because of the pleiotropy of Ace2p transcription factor, to the selection of the Snowflake multicellular phenotype as a passenger phenotype (c).
Tables
Table 1
Strains.
| Strain name | Genotype |
|---|---|
| FY4 | |
| Y12580, Y12581, Y12582 | cln3::URA3/cln3::URA3 ura3∆0/ura3∆0 leu2∆0/leu2∆0 |
| Y12584, Y12585, Y12586 | ace2::KanMX4/ace2::KanMX4 cln3::URA3/cln3::URA3 ura3∆0/ura3∆0 leu2∆0/leu2∆0 |
| Y12606, Y12607, Y12608 | leu2∆0/leu2∆0 |
| Y12973, Y12974, Y12975 | ace2::KanMX4/ace2::KanMX4 leu2∆0/leu2∆0 |
| Y12575 +p5314 | ace2::KanMX4/ace2::KanMX4 ura3∆0/ura3∆0 carrying empty plasmid 2µ |
| (Y11418xY12599)+p5314 | ura3∆0/ura3∆0 carrying empty plasmid 2µ |
| Y12575 +p4726 | ace2::KanMX4/ace2::KanMX4 ura3∆0/ura3∆0 carrying plasmid 2µ WHI5 |
| (Y11418xY12599)+p4726 | ura3∆0/ura3∆0 carrying plasmid 2µ WHI5 |
| Y12512 | ace2::KanMX4/ace2::KanMX4 HTB1-3xCFP-LEU2/HTB1-3xCFP-LEU2 ura3∆0/ura3∆0 his3∆1/HIS3 |
| Y12565, Y12566, Y12958 | ace2::KanMX4 cln3::URA3 ura3∆0 leu2∆0 |
| Y12567, Y12568, Y12959 | cln3::URA3 ura3∆0 leu2∆0 |
| Y12408, Y12595, Y12596 | ace2::KanMX4 leu2∆0 |
| Y11417, Y12571 | leu2∆0 |
| Y12709, Y12710, Y12711 | cln3::URA3/cln3::URA3 ura3∆0/ura3∆0 leu2∆0/leu2∆0 |
| Y12716, Y12717, Y12718 | dse2::KanMX4/dse2::KanMX4 cts1::KanMX4/cts1::KanMX4 scw11::KanMX4/scw11::KanMX4 egt2::KanMX4/egt2::KanMX4 dse4::KanMX4/dse4::KanMX4 cln3::URA3/cln3::URA3 ura3∆0/ura3∆0 leu2∆0/leu2∆0 |
| Y12976, Y12977, Y12978 | dse2::KanMX4/dse2::KanMX4 cts1::KanMX4/cts1::KanMX4 scw11::KanMX4/scw11::KanMX4 egt2::KanMX4/egt2::KanMX4 dse4::KanMX4/dse4::KanMX4 leu2∆0/leu2∆0 |
| Y12967, Y12968 | kss1::KanMX4 ace2::KanMX4 cln3::URA3 ura3∆0 leu2∆0 |
| Y12969, Y12970 | kss1::KanMX4 cln3::URA3 ura3∆0 leu2∆0 |
| Y12838, Y12839, Y12840 | AMN1368D-URA3-AMN1368V ura3∆0 leu2∆0 |
| Y12935, Y12936, Y12937 | AMN1368V-URA3-AMN1368V ura3∆0 leu2∆0 |
| Y12942, Y12943, Y12944 | AMN1368D-URA3-AMN1368V cln3::KanR ura3∆0 leu2∆0 his3∆1 |
| Y12946, Y12947, Y12949 | AMN1368V-URA3-AMN1368V cln3::KanR ura3∆0 leu2∆0 his3∆1 |
| Y12838 +p338 | AMN1368D-URA3-AMN1368V ura3∆0 leu2∆0 carrying empty plasmid 2µ |
| Y12935 +p6053 | AMN1368D-URA3-AMN1368V ura3∆0 leu2∆0 carrying plasmid 2µ WHI5 |
| Y12838 +p338 | AMN1368D-URA3-AMN1368V ura3∆0 leu2∆0 carrying empty plasmid 2µ |
| Y12935 +p6053 | AMN1368D-URA3-AMN1368V ura3∆0 leu2∆0 carrying plasmid 2µ WHI5 |
| GN-1C | HO:NatR AMN1368D FLO8+ |
Table 2
Plasmids.
| Plasmid name | Description | |
|---|---|---|
| p5314 | YEpLac195: 2μ URA3 AmpR | Gietz and Sugino, 1988 |
| p4726 | WHI5 in YEpLac195 | Lab collection |
| p338 | YEpLac181 : 2μ LEU2 AmpR | Gietz and Sugino, 1988 |
| p6053 | WHI5 in YEpLac181 | This study |
| p6164 | YIpLac211: integrative plasmid URA3 AmpR | Gietz and Sugino, 1988 |
| p6165 | AMN1-368D in YIpLac211 | This study |
| p6167 | AMN1-368V in YIpLac211 | This study |
Table 3
Oligonucleotides.
| Oligonucleotide name | Sequence 5’–3’ |
|---|---|
| qPCR locus ACE2 –26 forward | GGACCAAAAACGGTGTTAATACAATC |
| qPCR KanMX4-specific reverse | CTGGCGCGCCTTAATTAACC |
| qPCR ACT1 forward (coding) | CCCCAGAAGAACACCCTGTTC |
| qPCR ACT1 reverse (coding) | CGTAGAAGGCTGGAACGTTG |
| qPCR CLN1 coding forward | ATCGATCAGCAACCGGAGAT |
| qPCR CLN1 coding reverse | AACCTGACAGCGTGGAAGAA |
| KanB reverse | CTGCAGCGAGGAGCCGTAAT |
| ACE2 promoter forward | CGTCACTCCATTAGAATCCC |
| CLN3 promoter forward | TCCTCATTCGGTTTAACTCC |
| CLN3 terminator reverse | TGACTAGAGGAAGTAAGGAG |
| DSE2 promoter forward | CAGTAGAGCTAACCACAGTC |
| CTS1 promoter forward | ACTGTCGCTCGTTTCACAAC |
| SCW11 promoter forward | CAGTTACGCAACAAAGACAG |
| DSE4 promoter forward | ACTACAAGCGAGGGTAAAGG |
| EGT2 promoter forward | GATGCTGGTTTGATGCTAAG |
| CLN3 promoter –500 forward | TGAGGAAAGAGGACTATACC |
| CLN3 terminator +500 reverse | TAGGTAGCGATGAAGATTGG |
| URA3 promoter –500 forward | TCATCATCTCATGGATCTGC |
| URA3 terminator +500 reverse | TACGCCAGTACACCTTATCG |
| CLN1 promoter –200 forward | CCAAGGAGTTCTTCGTTCGC |
| CLN1 terminator +200 reverse | TCGCGTCATCTTTTCCGTTC |
| AMN1 promoter –75 forward | GTTTAATATCCATCCATTCC |
| AMN1 +459 forward | CCTTTGACTGCTCAACATCAG |
| AMN1 +882 forward | CATCAAGTAACACAACCAG |
| AMN1 +1269 forward | GGTTGTGATGTTGATGATG |
| AMN1 terminator +169 reverse | GTTTCTTCGGCCCTTCTGGA |
| AMN1 +1269 reverse | CATCATCAACATCACAACC |
| AMN1 +882 reverse | CTGGTTGTGTTACTTGATG |
| AMN1 +376 reverse | GAAAGACTGGATGCAGAAAC |
| Mat a and alpha forward | AGTCACATCAAGATCGTTTATGG |
| Mat a specific reverse | CTCCACTTCAAGTAAGAGTTTG |
| Mat alpha specific reverse | GCACGGAATATGGGACTACTTCG |
| WHI5 BamHI forward | CGCGGATCCCAAATCGGATATGAGCAGCTG |
| WHI5 PstI reverse | ACGTCTGCAGGCTCGAGGCGATCTGTCGC |
| M13 reverse | CAGGAAACAGCTATGACC |
| AMN1 BamHI forward | GTTGGATCCATGAAACTAGAACGCG |
| AMN1 PstI reverse | AACCTGCAGCTAGTCCACATTATTCTCTATTTCG |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Constraints on the G1/S transition pathway may favor selection of multicellularity as a passenger phenotype
eLife 15:RP109833.
https://doi.org/10.7554/eLife.109833.3
