Elevation of CpG frequencies in influenza A genome attenuates pathogenicity but enhances host response to infection
- University of Edinburgh, United Kingdom
- University of Oxford, United Kingdom
Figures
Figure 1 with 6 supplements
Replication phenotypes of IAV WT and compositionally altered mutants.
(A) Replication kinetics of IAV in a multi-cycle replication assay; MDCK cells were infected at an MOI of 0.01 and supernatant assayed for IAV RNA at three post-infection time points; y-axis records …
Figure 1—figure supplement 1
Variability and composition analysis of IAV segment 5.
(A) Variability at synonymous sites of selected subtypes of IAV (H1N1, H3N2, avian-derived variants H5, H6 and H9) in the coding region of segment 5 recorded as mean within-group pairwise …
Figure 1—figure supplement 2
Single replication cycle kinetics of IAV infected an am MOI of 5 Replication kinetics of IAV in a single-cycle replication assay; MDCK cells were infected at an MOI of 5 and supernatant assayed for IAV RNA at 5 post-infection time points; y-axis records infectivity of supernatant on titration in MDCK cells.
https://doi.org/10.7554/eLife.12735.005
Figure 1—figure supplement 3
Expression of IAV viral proteins M2, NS1, NA and PB2 relative to that of NP in different IAV mutants.
Frequency of MDCK cells expressing different viral proteins 6 hr after infection with WT and mitant strains of IAV. Frequencies of infected cells were compared to those expressing the NP protein …
Figure 1—figure supplement 4
Detection of IAV viral proteins HA1, M1 and HA2 relative to that of NP in purified virions of different IAV mutants.
(A) PAGE of purified IAV virions derived from egg cultures of WT and mutant IAV strains. The major contaminant band in the CDLR preparation is most likely ovalbumin; its presence did not influence …
Figure 1—figure supplement 5
Ratio of segment 5 and segment 2 RNA sequences in purified virions Quantitation of segment 5 and segment 2 RNA by qPCR in purified virions of WT and mutant IAV strains.
The y-axis records mean values of two biological replicates with values normalised to the ratio observed in WT virus; error bars show SEMs.
Figure 1—figure supplement 6
Pairwise comparisons of the replication fitness of the mutants by competition assays.
(A) Assay design and relative quantitation of virus pairs using restriction enzyme digestion of PCR product to differentiate amplicon sequences. (B) Summary results of pairwise comparisons. Cells …
Figure 2
Infection outcomes and protective immunity in mice infected with IAV.
(A, B) Weights of mice (proportion of starting weight) of mice inoculated with 200 PFU of IAV WT and mutant strains with altered dinucleotide compositions. Deaths of individual mice are shown …
Figure 3 with 3 supplements
Cytopathology and innate immune responses to IAV infection in mice.
(A) Representative lung sections from mice infected with WT (a, b, e, f) and CpG-high (c, d, g, h) IAV variants at days 3 (a-d) and 14 (e-h) post infection. At day 3 prominent peribronchiolar and …
Figure 3—figure supplement 1
Cytokine response to IAV infection at different time point post-inoculation.
Induction of individual cytokines in pooled lung samples (n = 6) collected at days 3, 6 and 14 post-inoculation. The y-axis records fold-induction over cytokine level detected in uninfected mice; …
Figure 3—figure supplement 2
Induction of interferon-β mRNA in lung samples.
Quantitation of IFN-β mRNA in lungs of infected mice at days 3 and 6 by qPCR. Bars record mean levels; error bars show SEM. IFN-β was undetectable in all lung samples collected at day 14 (data not …
Figure 3—figure supplement 3
Cytokine responses in lungs of mice infected in experiment 1 (day 5).
Induction of individual cytokines using a standard mouse panel in pooled lung samples (n = 6) collected at days 3, 6 and 14 post-inoculation. The y-axis records fold-induction over cytokine level …
Figure 4 with 2 supplements
Adaptive immune response (T cell and neutralising antibody) after infection with wild-type and mutant strains of IAV.
(A) Representative FACS plots showing the percentage of IFN-γ producing cells in mice infected with 200 PFU of IAV in the CD8+ T cell population after peptide stimulation. (B, C) Mean frequencies of …
Figure 4—figure supplement 1
Gating strategy to identify and quantify lymphocytes producing IFN-γ.
Gating strategy used to isolate the population of CD8 T cell IFN-γ producers after peptide stimulation.
Figure 4—figure supplement 2
ELISPOT analysis of T cell reactivity to individual IAV peptides.
The number of IFN-γ reactive SFU per 106 measured using ELISPOT following overnight stimulation of thawed splenocytes with peptides or media from mice immunised 21 days earlier with 200pfu of the …
Tables
Table 1
Composition and coding parameters of the mutated region of segment 5.
| Subs.a | C+G% | CpG | ΔCpGb | CpG-O/Ec | UpA | ΔUpAb | UpA-O/E | CAI | CPSd | |
|---|---|---|---|---|---|---|---|---|---|---|
| PR8 WT | --- | 0.46 | 28 | --- | 0.43 | 43 | --- | 0.49 | 0.745 | 0.005 |
| CDLR | 134 | 0.46 | 28 | 0 | 0.43 | 43 | 0 | 0.49 | 0.745 | 0.011 |
| CpG-high | 233 | 0.46 | 114 | +86 | 1.63 | 45 | +2 | 0.51 | 0.611 | -0.011 |
| UpA-high | 199 | 0.46 | 29 | +1 | 0.56 | 116 | +73 | 1.31 | 0.627 | -0.118 |
-
a Number of sequence changes from WT sequence
-
b Change in the numbers of CpG and UpA dinucleotides
-
c Observed to expected frequencies of CpG and UpA dinucleotides
-
dCalculated as previously described (Buchan et al., 2006)
Table 2
Primers used for qPCR and for amplification of segment 5 for competition assays.
| Gene/Region | Aim | Primer type | Sequence |
|---|---|---|---|
| Seg 5 | Reverse Transcription | Sense | ATCATGGCGTCTCAAGGCAC |
| Seg 5 | Sequencing | Sense | GAATGCCACTGAAATCAGAG |
| Antisense | CGTCCGAGAGCTCGAAGACT | ||
| Seg 5 | Competition Assay | Sense | CCAGAATGCCACTGAAATCA |
| Antisense | CCTTGCATYAGMGAGCACAT | ||
| Seg 5 | RT-qPCR | Sense | ATCATGGCGTCTCAAGGCAC |
| Antisense | CCGACGGATGCTCTGATTTC | ||
| GAPDH | RT-qPCR | Sense | CTACCCCCAATGTGTCCGTCG |
| Antisense | GATGCCTGCTTCACCACCTTC | ||
| IFN-β | RT-qPCR | Sense | CACAGCCCTCTCCATCAACT |
| Antisense | GCATCTTCTCCGTCATCTCC |
Table 3
List of enzymes used in pairwise competition assays.
| Virus 1* | Virus 2* | Restriction Enzyme | Digestion Site |
|---|---|---|---|
| WT | CDLR | Hpy188III | In CDLR |
| WT | CpGH | Hpy188III | In CpGH |
| WT | UpAH | Hpy188III | In UpAH |
| CpGH | UpAH | AhdI | In CpGH |
| CpGH | CDLR | AhdI | In CpGH |
| UpAH | CDLR | BsaHI | In UpAH |
-
*Virus pairs to be differentiated
Additional files
-
Supplementary file 1
Sequences of the mutated regions in segment 5 of IAV (CDLR, CpG-high and UpA-high) are provided in the Supplementary file.
- https://doi.org/10.7554/eLife.12735.020
