Platelet-derived growth factor (PDGF) signaling directs cardiomyocyte movement toward the midline during heart tube assembly
- University of California, San Diego, United States
- Victor Chang Cardiac Research Institute, Australia
- St. Vincent’s Clinical School, University of New South Wales, Australia
- Peter MacCallum Cancer Centre, Australia
- School of Biotechnology and Biomolecular Science, University of New South Wales, Australia
Figures
Figure 1 with 3 supplements
Cardiac fusion defects in refuse-to-fuse (ref) mutants.
(A,B) Three-dimensional reconstructions depict wild-type (wt) and ref mutant hearts expressing the myocardial reporter transgene Tg(myl7:egfp) at 48 hpf. In contrast to the normal contours of the wt …
Figure 1—figure supplement 1
ref mutant embryos display a range of cardiac defects.
(A,B) Lateral views of live wild-type (wt, A) and ref mutant (B) embryos at 48 hpf. ref mutants exhibit a mild pericardial edema. (C–F) Lateral views from the right side of wt (C) and ref mutant (D–F…
Figure 1—figure supplement 2
The anterior endoderm forms normally in ref mutant embryos.
(A–D) Lateral views, dorsal to the right, depict the expression of axial at 8.5 hpf (A,B) or sox17 at 8 hpf (C,D). The number and distribution of endoderm precursor cells is similar in wt (A,C) and r…
Figure 1—figure supplement 3
Endocardial cells move to the midline in ref mutant embryos.
(A,B) Dorsal views, anterior to the top, depict the expression of the endothelial reporter transgene Tg(fli1a:negfp) in the endocardial precursor population at 18 s (n = 8). In both wt (A) and ref …
Figure 2 with 2 supplements
ref is a loss-of-function mutation in pdgfra.
(A) Polymorphic markers (z21170, kdr_e28, 5’scfd2, z14614) were used to map meiotic recombination events, narrowing the region containing the ref mutation to <0.1 cM on linkage group (LG) 20. (See …
Figure 2—figure supplement 1
ref mutants display craniofacial defects.
(A–F) Lateral (A–C) and ventral (D–F) views of embryos at 6 days post-fertilization (dpf), stained with Alcian blue to show the dorsal and ventral cartilage in the head. Embryos homozygous for ref (B…
Figure 2—figure supplement 2
Comparison of cardiac fusion phenotypes resulting from alteration of PDGF signaling.
Bar graph compares severity of cardiac fusion phenotypes observed at 22 s in three sets of experiments: one set of experiments comparing ref homozygous mutant embryos, b1059 homozygous mutant …
Figure 3
Pdgfra mouse mutants display defects in heart tube assembly.
(A–E') Ventral views (A,B,D,E), lateral views (A',B',C), and transverse sections (A'',E') depict Nkx2-5 expression in wt (A–A'') and Pdgfra homozygous mutant (B–E') mice on a C57BL/6J background at …
Figure 4
pdgfra is expressed within the ALPM while cardiac fusion is underway.
(A–D) Dorsal views, anterior to the top, depict pdgfra expression in wt embryos at 10 s (A), 12 s (B), 14 s (C), and 18 s (D). Arrows (A) indicate pdgfra expression in the ALPM and the neural crest …
Figure 5 with 2 supplements
pdgfra influences the movement of the ALPM after the 15 somite stage.
(A–F) Dorsal views, anterior to the top, depict expression of hand2 in the wt (A–C) and ref mutant (D–F) ALPM from 12 to 20 s. The morphology and position of the ALPM are indistinguishable in wt (A) …
Figure 5—figure supplement 1
PDGF signaling is required after gastrulation for proper cardiac fusion.
(A,B) Dorsal views, anterior to the top, display myl7 expression at 22 s in representative embryos treated with DMSO (A) or Pdgfr inhibitor V (B) from the tailbud stage until 22 s. DMSO-treated …
Figure 5—figure supplement 2
Overexpression of pdgfaa influences ALPM movement by the 15 somite stage.
(A–C) Dorsal views, anterior to the top, depict expression of hand2 in the ALPM of Tg(hsp70l:pdgfaa-2A-mCherry) embryos from 12 to 20 s, following heat shock at the tailbud stage. See Figure 5A–C …
Figure 6
pdgfra regulates the directionality of cardiomyocyte movement.
(A–F) Representative timelapse experiments indicate patterns of cell movement in wt (A,B) and ref mutant (C–F) embryos carrying the Tg(myl7:egfp) transgene. (A,C,E) Three-dimensional confocal …
Figure 7 with 1 supplement
pdgfaa is expressed in the anterior endoderm, medially adjacent to the ALPM.
(A–G) Fluorescent in situ hybridization and immunofluorescence compare the expression of pdgfaa (magenta) and Tg(sox17:egfp) (green) in wt embryos at 13 s. (A–C) Dorsal views, anterior to the top, …
Figure 7—figure supplement 1
Expression of genes encoding Pdgfra ligands.
(A–C) Dorsal views, anterior to the top, display expression of pdgfaa (A), pdgfab (B), and pdgfc (C) in wt embryos at 14 s. Since Pdgfa homodimers and Pdgfc homodimers have been shown to interact …
Author response image 1
Mosaic expression of pdgfaa in the endoderm causes defects in cardiac fusion and ALPM formation.
(A-D) Lateral (A, B) and dorsal (C, D) views depict the expression of myl7 at 22 s in a representative uninjected embryo (wt; A, C) and in a representative embryo injected with Tg(sox17:pdgfaa-2A-mCh…
Videos
Video 1
Cardiomyocytes in a wild-type embryo undergo medially directed movement during cardiac fusion.
(A,B) Representative timelapse movie (A) and associated tracks (B) of cardiomyocyte movement occurring during cardiac fusion in a wild-type embryo carrying the Tg(myl7:egfp) transgene. (A) Movie of …
Video 2
Not all cardiomyocytes in a mildly affected ref mutant embryo undergo medially directed movement during cardiac fusion.
(A,B) Representative timelapse movie (A) and associated tracks (B) of cardiomyocyte movement in a mildly affected ref mutant embryo carrying the Tg(myl7:egfp) transgene. Images were acquired as …
Video 3
Cardiomyocytes in a severely affected ref mutant embryo fail to display medially directed movement during cardiac fusion.
(A,B) Representative timelapse movie (A) and associated tracks (B) of cardiomyocyte movement in a severely affected ref mutant embryo carrying the Tg(myl7:egfp) transgene. Images were acquired as …
Tables
Table 1
Variable expressivity of cardiac phenotype in ref mutant embryos.
Stage | Phenotype | Number of embryos |
|---|---|---|
22 s∗ | ||
No fusion | 8 | |
Only posterior fusion | 7 | |
48 hpf† | ||
Bifurcated ventricle | 229 | |
Shrunken heart | 147 | |
Abnormal looping | 74 | |
Cardia bifida | 4 |
-
∗ Tabulated from 15 embryos with morphologically evident phenotypes from clutch depicted in Figure 1C–E and in Table 2. See Figure 2—figure supplement 2 for additional data.
-
† Tabulated from 454 embryos with morphologically evident phenotypes collected from multiple clutches. See Figure 1—figure supplement 1 for representative images.
Table 2
Penetrance of cardiac phenotype in ref mutant embryos.
Stage | Total # embryos | # +/+ embryos | # +/− embryos | # −/− embryos | # with evident cardiac defects | Approximate penetrance |
|---|---|---|---|---|---|---|
22 s | 61 | 14 | 27 | 20 | 15 | 75% |
48 hpf | 522 | NG∗ | NG∗ | NG∗ | 58 | 44%† |
-
∗ NG=not genotyped.
-
† Calculated with the assumption that 25% of embryos are -/-.
Table 3
Primers used to map recombinants.
Marker | Forward primer | Reverse primer |
|---|---|---|
5’SCFD2 | CGCGTTACCAGAGAGACACA | TTCTCGGCAGGATAAATTGG |
Z14614 | AAACACATGCACAATGGTAGAAA | CAGCAAGTTCAGCCAAAACA |
Z21170 | AAACATTGCTTTTGGCCACT | CTCACTCCCCCACACTGTTT |
kdr_e28 | TATGATAACGCTCCGCCTCT | CAGGGGAATGTCCACAAAAC |
Table 4
Genotypes encountered in progeny from intercrosses of Pdgfra heterozygotes at E9.5.
Total | Wild-type | Heterozygous mutant | Homozygous mutant | |
|---|---|---|---|---|
Number of embryos | 108 | 30∗ | 64∗ | 14† |
Observed ratio | 0.9 | 2.0 | 0.4‡ | |
Expected ratio | 1.0 | 2.0 | 1.0 |
-
∗ No observed phenotype.
-
† See Table 5 for detail on observed phenotypes.
-
‡ Chi-squared test p<0.05 compared to expected.
Table 5
Cardiac phenotypes observed in Pdgfra mutants at E9.5.
Number of embryos | |
|---|---|
Total | 14 |
Normal phenotype | 2 |
Abnormal looping | 5 |
Split inflow/common atrial region | 6 |
Cardia bifida | 1 |
