DNA methylation directs genomic localization of Mbd2 and Mbd3 in embryonic stem cells
- University of Massachusetts Medical School, United States
Figures
Figure 1 with 2 supplements
Analysis of bio-Mbd3 and bio-Mbd2 ChIP-seq datasets reveals methylation-dependent chromatin localization in ES cells.
Mbd3 and Mbd2 ChIP-seq datasets from (Baubec et al., 2013) were obtained from GEO (GSE39610; see Table 1). (A–C) Analysis of ChIP-seq data for biotin-tagged Mbd3 (bio-Mbd3) in WT or TKO cells. The …
Figure 1—figure supplement 1
Variable bio-Mbd2 binding in WT cells over TSSs and gene-distal DHSs.
Analysis of ChIP-seq data for biotin-tagged Mbd3 (bio-Mbd3) or Mbd2 (bio-Mbd2) in WT or TKO cells. (A–B) Peaks were called from bio-Mbd3 ChIP in WT cells from replicate 1 (A) or replicate 2 (B) and …
Figure 1—figure supplement 2
Variable bio-Mbd1 and bio-MeCP2 binding in WT cells.
Analysis of ChIP-seq data for biotin-tagged Mbd1a (bio-Mbd1a), Mbd1b (bio-Mbd1b), Mbd4 (bio-Mbd4), or MeCP2 (bio-MeCP2) in WT or TKO cells. (A–B) Analysis of ChIP-seq data for bio-Mbd1a in WT or TKO …
Figure 2 with 4 supplements
Dnmt1 and Tet1 are required for Mbd3 and Mbd2 binding in ES cells.
(A) Genome browser tracks of replicate ChIP-seq experiments examining endogenous Mbd3 or Mbd2 occupancy in control (EGFP KD), Dnmt1 KD, and Tet1 KD ES cells over indicated loci (Hoxd cluster). (B) …
Figure 2—figure supplement 1
Loss of Dnmt1 and Tet1 results in reduced occupancy of both Mbd3 and Mbd2 in ES cells.
(A) Efficient KD of Dnmt1, Tet1, Mbd3, Mbd2, and Chd4 is confirmed by RT-qPCR with expression levels normalized to GAPDH and shown relative to control (EGFP) KD. Shown are the mean ± SD values of …
Figure 2—figure supplement 2
Validation of endogenous Mbd3 and Mbd2 ChIP-seq experiments.
(A–B) Biological replicates of Mbd3 (A) and Mbd2 (B) ChIP-seq experiments demonstrate similar results. Shown are aggregation plots of Mbd3 (A) or Mbd2 (B) ChIP-seq datasets over Mbd3 peaks (A) or …
Figure 2—figure supplement 3
FLAG ChIPs confirm Dnmt1 and Tet1 are required for Mbd3 and Mbd2 occupancies.
(A) Western blots showing expression in Mbd3abc-3XFLAG, Mbd3a-3XFLAG, and Mbd2-3XFLAG ES cell lines. β-actin serves as a loading control. (B) Aggregation plots of Mbd3abc-3XFLAG ChIP-seq over ICPs …
Figure 2—figure supplement 4
ChIP-seq experiments using MBD-FLAG fusions.
(A–B) Aggregation plots of Mbd3abc-3XFLAG (A) or Mbd2-3XFLAG (B) ChIP-seq over ICPs (top left panel), annotated TSSs (bottom left panel), the LMR subset (top middle panel), gene-distal DHSs (bottom …
Figure 3 with 1 supplement
The catalytic activity of Tet1 is required for occupancy of Mbd3 and Mbd2 in ES cells.
Aggregation plots of Mbd3 or Mbd2 ChIP-seq showing association over ICPs (top left panel), annotated TSSs (bottom left panel), the LMR subset (top middle panel), gene-distal DHSs (bottom middle …
Figure 3—figure supplement 1
Catalytic mutation in Tet1 does not alter total protein levels.
Western blot showing expression of Tet1 in Tet1c.i. ES cell line. β-actin serves as a loading control.
Figure 4 with 1 supplement
Dnmt1, Mbd3, and Mbd2 are required for 5mC and 5hmC in ES cells.
(A–B) Aggregation plots of 5mC (A) or 5hmC (B) enrichment over ICPs (top left panel), annotated TSSs (bottom left panel), the LMR subset (top middle panel), gene-distal DHSs (bottom middle panel) …
Figure 4—figure supplement 1
5mC and 5hmC levels over total and removed LMRs.
(A–B) Aggregation plots of 5mC (A) or 5hmC (B) enrichment over total LMRs ± 2 kb in control (EGFP) KD, Dnmt1 KD, Mbd3 KD, and Mbd2 KD ES cells. (C–D) Aggregation plots of 5mC (C) or 5hmC (D) …
Figure 5 with 2 supplements
Mbd3 and Mbd2 are required for each other’s binding in ES cells.
(A) Genome browser tracks of ChIP-seq experiments examining Mbd3 or Mbd2 occupancy in control (EGFP KD), Mbd2 KD, or Mbd3 KD ES cells over one example locus (Pitx1). (B) Aggregation plots of Mbd3 or …
Figure 5—figure supplement 1
Interplay between Mbd3 and Mbd2.
(A–B) Genome browser tracks of replicate ChIP-seq experiments examining Mbd3 or Mbd2 occupancy in control (EGFP KD), Mbd2 KD, or Mbd3 KD ES cells over example loci (Hoxd cluster (A) and Tfap2a (B)) …
Figure 5—figure supplement 2
Mbd3 is required for Dnmt1 occupancy in ES cells.
(A) Western blot showing loss of Mbd3 expression in Mbd3 KO ES cell line. β-actin serves as a loading control. (B) Aggregation plots of Dnmt1 ChIP-seq over ICPs, annotated TSSs, gene-distal DHSs, …
Figure 6 with 1 supplement
KD of DNA methylation/hydroxymethylation machinery or its readers results in similar effects on gene expression.
(A) K-means clustering (k = 3) of genes misregulated (adjusted p<0.05) upon Dnmt1 KD, Tet1 KD, Mbd3 KD, Mbd2 KD, or Chd4 KD. Upregulated genes are indicated in yellow and downregulated genes are …
Figure 6−figure supplement 1
Dnmt1 KD, Tet1 KD, Mbd3 KD, Mbd2 KD, or Chd4 KD have correlated effects on gene expression.
Genes misregulated (adjusted p<0.05) upon Dnmt1 KD, Tet1 KD, Mbd3 KD, Mbd2 KD, Chd4 KD, Tip60 KD, or Brg1 KD. Tip60 KD and Brg1 KD expression data were downloaded from GSE31008. Dnmt1 KD, Tet1 KD, Mb…
Tables
Table 1
Related to Figure 1. SRA file numbers for re-analyzed Baubec et al. (2013) datasets.
Name | SRA file number | Number of mapped reads (Bowtie, up to three mismatches) |
|---|---|---|
WT Mbd3 ChIP replicate 1 | SRR696667 | 11,601,021 |
WT Mbd3 ChIP replicate 2 | SRR696673 | 14,166,151 |
TKO Mbd3 ChIP | SRR769560 | 34,666,789 |
WT Mbd2 ChIP replicate 1 | SRR527128 | 9,441,721 |
WT Mbd2 ChIP replicate 2 | SRR527129 | 15,116,380 |
WT Mbd2 ChIP replicate 3 | SRR696658 | 12,545,659 |
TKO Mbd2 ChIP replicate 1 | SRR527161 | 24,282,816 |
TKO Mbd2 ChIP replicate 2 | SRR696682 | 7,605,171 |
WT Mbd1a ChIP replicate 1 | SRR527126 | 11,566,092 |
WT Mbd1a ChIP replicate 2 | SRR527127 | 19,528,778 |
TKO Mbd1a ChIP | SRR527159 | 22,070,693 |
WT Mbd1b ChIP replicate 1 | SRR527147 | 14,320,842 |
WT Mbd1b ChIP replicate 2 | SRR527148 | 22,371,797 |
TKO Mbd1b ChIP | SRR527160 | 7,503,068 |
WT Mbd4 ChIP replicate 1 | SRR527131 | 13,864,108 |
WT Mbd4 ChIP replicate 2 | SRR527132 | 23,655,753 |
TKO Mbd4 ChIP replicate 1 | SRR669321 | 13,670,155 |
TKO Mbd4 ChIP replicate 2 | SRR669322 | 11,251,853 |
WT MeCP2 ChIP replicate 1 | SRR527133 | 19,229,199 |
WT MeCP2 ChIP replicate 2 | SRR527134 | 11,771,499 |
WT MeCP2 ChIP replicate 3 | SRR696681 | 12,118,572 |
TKO MeCP2 ChIP replicate 1 | SRR527162 | 17,003,233 |
TKO MeCP2 ChIP replicate 2 | SRR696683 | 28,586,006 |
Table 2
Related to Figure 2—figure supplement 1–3. Primer list for qPCR.
Gene | Forward | Reverse |
|---|---|---|
Dnmt1 | TGTTCTGTCGTCTGCAACCT | GCCATCTCTTTCCAAGTCTTT |
Tet1 | TCACAGGCACAGGTTACAAAAG | TCCTTACATTTTCAAGGGGATG |
Mbd3 | GGCCACAGGGATGTCTTTTACT | CTTGACCTGGTTGGAAGAATCA |
Mbd2 | AACCAAATTCACGAACCACC | CCTTGTAGCCTCTTCTCCCA |
Chd4 | AAGTTTGCAGAGATGGAAGAGC | GGTCGTAGTCCTGAATCTCCAC |
Farp1 | AACTGCAAGTCATTCTAAATCTCG | GGTATTCAATGCCAGAGACACA |
Ppp2r2c | CGAATTATCCAGCTCTGCCTTA | TGGAGGAGAGACTTAGGGGTGT |
Gpr83 | GAGCCACCTTACTGTAGGGAATG | CACGCTCACCAGCTTTCTGTA |
Cldn7 | ACCTTTGGAAGAGCAGTCAGTG | CCTTCTCCATCCACACACTTTC |
Tgfb1 | AAGTCAGAGACGTGGGGACTTCTTG | AGTCTTCGCGGGAGGCGGGGT |
Trh | TAATGCCTCTGACCTGGGATC | CCCACATCCTAATTCCAAAGTG |
Table 3
Related to Figure 6−figure supplement 1. Correlation coefficients for pairwise combinations of factor KD. Tip60 KD (a histone acetyltransferase with repressive functions in ES cells) and Brg1 KD (an …
Dnmt1 | Tet1 | Mbd3 | Mbd2 | Chd4 | Tip60 | Brg1 | KD: |
|---|---|---|---|---|---|---|---|
1.0 | 0.508 | 0.693 | 0.612 | 0.645 | -0.033 | 0.051 | Dnmt1 |
1.0 | 0.441 | 0.551 | 0.475 | -0.003 | 0.104 | Tet1 | |
1.0 | 0.712 | 0.831 | -0.101 | 0.308 | Mbd3 | ||
1.0 | 0.656 | -0.027 | 0.033 | Mbd2 | |||
1.0 | -0.094 | 0.269 | Chd4 | ||||
1.0 | 0.199 | Tip60 | |||||
1.0 | Brg1 |
