The Plasmodium falciparum rhoptry protein RhopH3 plays essential roles in host cell invasion and nutrient uptake
- The Francis Crick Institute, United Kingdom
- National Institute of Allergy and Infectious Diseases, National Institutes of Health, United States
- London School of Hygiene & Tropical Medicine, United Kingdom
Figures
Figure 1 with 3 supplements
Conditional truncation of the rhopH3 gene.
(A) The rhopH3 gene comprises seven exons (numbered grey boxes) and six introns (blue lines). Using Cas9-mediated recombination, the region spanning introns 3 to 6 was replaced with two loxP-containing (purple open arrowhead) P. falciparum introns (SERA2 (orange line) and sub2 (green line)) flanking a recodonized and fused version of exons 4 to 6 (exon 4–6, green box). Integration of this sequence by homologous recombination was promoted by the addition of sequences of exon 3 and 7 to either side of the introns. Colored arrowheads, primer binding sites. B, S and X, BsgI, SacI and XmnI restriction sites. Dotted line, probe used for Southern blotting. Rapamycin-induced site-specific recombination between the loxP sites removes the recodonized exon 4–6. (B) PCR analysis of rhopH3-loxP clones 5F5 and 4B11 confirms the expected gene modification event. Genomic DNA from parental 1G5DC (WT) parasites or the clones was used as template for PCR using the indicated primers (see panel A). Numbers between the arrowheads indicate the expected size of the amplicon. (C) Southern blot analysis of parental 1G5DC (WT) and the rhopH3-loxP parasite clones confirms the expected modification of the rhopH3 locus. Genomic DNA was digested with BsgI, SacI and XmnI and hybridized with a radiolabeled probe that binds to part of exon 3 (dotted line in panel A). Expected fragment sizes are 3016 bp for the WT rhopH3 locus and 3349 bp for the rhopH3-loxP locus. (D) Efficient rapamycin-induced truncation of the rhopH3 gene. Clones rhopH3-loxP 5F5 and 4B11 were analyzed by PCR ~44 hr after treatment with DMSO (D) or rapamycin (R) using the indicated primers (see panel A). Excision decreases the amplicon from 2760 bp to 1755 bp. (E) Southern blot showing efficient rapamycin-induced truncation of the rhopH3 gene. Genomic DNA extracted from control or rapamycin-treated rhopH3-loxP clones 5F5 and 4B11 was digested and probed as described in panel C. Expected fragment sizes are 3349 bp for the non-excised locus and 4784 bp for the excised locus. (F) Immunoblot analysis of mature schizonts of rhopH3-loxP clone 5F5, examined ~44 hr following treatment at ring stage with DMSO (D) or rapamycin (R). The blots were probed with an antibody against RhopH3 (left panel) or the merozoite protein AMA1 (right panel) as a loading control. The expected molecular masses of WT RhopH3 and RhopH3△4–6are ~110 kDa and~70 kDa, respectively. In panels B–F, positions of relevant molecular mass markers are indicated.
Figure 1—figure supplement 1
Multiple alignment of predicted primary sequences of rhopH3 orthologues from P. falciparum (PF3D7_0905400), Plasmodium chabaudi (PCHAS_0416900) and Plasmodium vivax (PVX_098712).
The portion of the protein encoded by exon 4–6 in the P. falciparum orthologue is underlined. Note that this region includes some of the most highly conserved regions of the protein. Sequence data were obtained from PlasmoDB (Aurrecoechea et al., 2009) and aligned using Clustal Omega (Sievers et al., 2011). ‘*’ indicates positions of identity, ‘:’ indicates conservation of residues with strongly similar chemical properties and ‘.’ indicates conservation of residues of weakly similar properties.
Figure 1—figure supplement 2
Modification (floxing) of the rhoph3 gene does not impact on gene expression or parasite growth.
(A) Immunoblot analysis of untreated mature schizonts of rhopH3-loxP clones 5F5 and 4B11, as well as the RhopH3 NE clone and the parental 1G5DC parasites. The blots were probed with an antibody against RhopH3 (top), RhopH1/Clag3.1 (middle) or the merozoite protein EBA175 (O'Donnell et al., 2006) (bottom) as a loading control. (B) Growth curves showing similar replication rates of parasites of the indicated clones (not treated with rapamycin) over the course of 4 erythrocytic cycles. Data were averaged from three biological replicate experiments and presented as the mean ± standard error of the mean. Linear regression analysis showed that all the slopes fall within the same 95% confidence interval range.
Figure 1—figure supplement 3
Conditional truncation of RhopH3 in both the 5F5 and 4B11 rhopH3-loxP clones.
Immunoblot analysis of mature schizonts of the indicated clones ~44 hr following treatment at ring stage with DMSO (D) or rapamycin (R). The blots were probed with an antibody against RhopH3 (top) or the mAb 89.1 against the merozoite surface protein MSP1 (bottom) as a loading control. The expected molecular masses of WT RhopH3 and RhopH3△4–6 are 110 kDa and ~70 kDa, respectively. Positions of relevant molecular mass markers are indicated.
Figure 2 with 1 supplement
Truncation of RhopH3 leads to mistrafficking of components of the RhopH complex and loss of complex formation.
(A) IFA showing colocalization of RhopH3, RhopH2 and RhopH1/Clag3.1 with the rhoptry marker RAP2 in schizonts of control (DMSO) rhopH3-loxP parasites but loss of colocalization following rapamycin (Rapa) treatment. Parasite nuclei were visualized by staining with 4,6-diamidino-2-phenylindole (DAPI). Scale bar, 5 μm. (B) Colocalization of the members of the RhopH complex. RhopH3, RhopH2 and RhopH1/Clag3.1 colocalize in rhopH3-loxP parasites treated with DMSO, but this colocalization is lost in parasites treated with rapamycin. (C) Mislocalisation and reduced levels of RhopH3 in naturally released free merozoites of rhopH3-loxP parasites treated with rapamycin. Samples were probed with a monoclonal antibody to the merozoite surface marker MSP1 as well as anti-RhopH3 antibodies. Scale bar, 2 μm. (D) Immunoprecipitation reveals disruption of the RhopH complex in rapamycin-treated rhopH3-loxP parasites. RhopH2 was immunoprecipitated from extracts of control or rapamycin-treated rhopH3-loxP parasites. Subsequent immunoblotting with antibodies against RhopH3 or RhopH1/Clag3.1 revealed the absence of RhopH3 from the immunoprecipitates derived from the rapamycin-treated parasites, although RhopH2 and RhopH1/Clag3.1 still showed association. Arrowheads indicate the expected position of migration of the full-length (WT) and truncated RhopH3, and RhopH1/Clag3.1. The rhopH3-loxP clone 5F5 was used throughout for these experiments.
Figure 2—figure supplement 1
Truncation of RhopH3 leads to mistrafficking of components of the RhopH complex.
IFA of mature schizonts of control (DMSO) and rapamycin-treated rhopH3-loxP parasites, probed with MSP1-specific antibodies (either mAb 89.1 or rabbit polyclonal anti-MSP1 antibodies; red) and antibodies to the three indicated RhopH components (green). Mis-localisation of the RhopH proteins was observed in all cases, and in the case of RhopH3 the protein often appeared to reside external to the plasma membrane of intracellular merozoites. Parasite nuclei were visualized by staining with DAPI. Note that, for clarity, the merge panels do not include the DAPI signal. Scale bar, 5 μm.
Figure 3
Loss of long-term viability in parasites lacking the RhopH complex.
(A) Representative wells seeded with identical concentrations (10 parasitised cells/well) of DMSO-treated or rapamycin-treated rhopH3-loxP clone 5F5 parasites, showing formation of plaques only in the wells seeded with DMSO-treated parasites. Two of the plaques are indicated by white arrowheads. (B) PCR analysis of the rhopH3-loxP locus in the small number of clones isolated from wells seeded with rapamycin-treated rhopH3-loxP parasites. The size of the PCR product indicates excision of the floxed sequence had not taken place in these seven clones (numbered 1–7), whereas rapamycin induced efficient excision in the parent 5F5 clone (left-hand two tracks). For PCR strategy, see Figure 1A. (C) PCR analysis of the modified SERA5 locus in parasite clone RhopH3 NE, showing loss of the DiCre cassette in this clone. (D) Growth curves showing replication of parasites of the indicated clones over the course of 5 erythrocytic cycles. Data were averaged from three biological replicate experiments and presented as the mean ± standard error of the mean (SEM). (E) Non-excised parasites quickly outgrow RhopH3△4–6 parasites. The relative abundance of parasites harbouring the excised or intact rhopH3-loxP locus in a population of rapamycin-treated rhopH3-loxP clone 5F5 parasites was determined by diagnostic PCR over the course of 7 erythrocytic growth cycles (indicated, where cycle 1 indicates that in which treatment occurred). (F) Decreased erythrocyte invasion by rapamycin-treated rhopH3-loxP parasites. Parasites of the indicated clones were treated with DMSO or rapamycin and allowed to invade fresh erythrocytes. Ring-stage parasitemia levels were determined 4 hr later. Data were averaged from three biological replicate experiments. Error bars depict standard error of the mean. Statistical significance was determined by a two-tailed t-test where p≤0.01 (indicated by asterisks) and p>0.05, non-significant (ns).
Figure 4
Loss of the RhopH complex results in developmental arrest.
(A) Developmental block in rapamycin-treated rhopH3-loxP parasites. Giemsa-stained images showing intracellular development of DMSO-treated and rapamycin-treated rhopH3-loxP clone 5F5 parasites from the end of cycle 1 to the end of cycle 2. A clear developmental block was evident in the rapamycin-treated parasites in cycle 2. The number of hours following the beginning of cycle 1 is indicated, as well as its relation to the time point of rapamycin treatment (indicated in the schematic timeline). (B) Flow cytometry analysis of DMSO-treated and rapamycin-treated rhopH3-loxP clones 5F5 and 4B11. Analysis was performed at the end of cycle 2 (92 hr after rapamycin-treatment). The intensity of Hoechst 33342 staining provides a measure of the DNA content of the parasites, reflecting parasite development.
Figure 5
Loss of the RhopH complex does not ablate parasite protein export.
Cycle 2 (72 hr post rapamycin treatment) DMSO-treated and rapamycin-treated rhopH3-loxP clone 5F5 trophozoite-stage parasites were probed with antibodies against the parasitophorous vacuole membrane marker EXP2 to delineate the parasite in the infected erythrocyte, as well as antibodies specific for either the Maurer’s cleft marker MAHRP1 (top panels) or the export marker KAHRP (bottom panels). Scale bar, 5 μm. (B) Transmission electron micrograph showing a comparison between cycle 2 parasites of DMSO-treated or rapamycin-treated rhopH3-loxP clone 5F5 parasites ~92 hr following rapamycin treatment. The developmental block in the RhopH3△4–6 parasite is clearly evident, as is the presence of knobs (arrowed) on the surface of the erythrocyte in both cases. Components of the mutant parasite labelled are the digestive vacuole (DV), haemozoin (H), nucleus (N), parasitophorous vacuole membrane (PVM), cytostomes (C) and parasite plasma membrane (PPM). The mutant parasites displayed no obvious ultrastructural differences from wild type trophozoites at a similar developmental stage (not shown). Scale bar, 1 μm.
Figure 6
Loss of the RhopH complex results in reduced sorbitol sensitivity and reduced uptake of exogenous small molecules.
(A) Synchronous cycle 2 parasites of the indicated clone (parasitaemia ~5%) treated 72 hr previously with DMSO or rapamycin in cycle 1 were suspended in osmotic lysis buffer containing 280 mM sorbitol or in PBS, and the resulting cell lysis determined by measuring the absorbance of the supernatant at 405 nm. An equal volume of parasite culture was lysed in 0.15% (w/v) saponin to give a value for 100% lysis and all other absorbance values normalized to this. Data were averaged from three biological replicate experiments. Statistical significance was determined by a two-tailed t-test; significance levels are indicated: p≤0.001, ***; p≤0.01, **;p≤0.05, *; and p>0.05, non-significant (ns). (B) Uptake of 5-ALA by erythrocytes infected with either DMSO-treated or rapamycin-treated rhopH3-loxP clone 5F5 parasites at cycle 2. Cultures were incubated overnight with 200 μM 5-ALA and uptake of the compound and its subsequent conversation to PPIX in infected erythrocytes visualized by fluorescence microscopy. Infected erythrocytes were visualized by staining with Hoechst 33342. Top panels show fields of view containing multiple infected erythrocytes of the indicated strain. Scale bar, 50 μm. Bottom panels show individual infected erythrocytes. Scale bar, 5 μm. (C) Quantitation of the levels of uptake of 5-ALA by infected erythrocytes. For each condition, a total of 1300 Hoechst-positive cells were analyzed for intensity of PPIX fluorescence using MetaMorph (Molecular Devices) and a statistical significance was determined by a two-tailed t-test. Significance levels are indicated: p≤0.0001, **** and p>0.05, non-significant (ns). (D) Flow cytometry analysis of 5-ALA-treated parasites. Uptake of 5-ALA and its subsequent conversation to PPIX in cycle 2 parasites following treatment in cycle 1 with rapamycin or DMSO was determined by flow cytometry of Hoechst stained parasites. Gating was applied to distinguish Hoechst negative cells (red population), Hoechst positive/PPIX negative cells (green population) and Hoechst positive/PPIX-positive cells (purple population). For the 1G5DC parental and RhopH3-loxP NE parasite clones, most of the parasites were positive for both Hoechst and PPIX fluorescence regardless of their treatment with rapamycin or DMSO. In contrast, for rapamycin-treated rhopH3-loxP clones 5F5 and 4B11, most of the parasites were Hoechst positive/PPIX negative indicating a defect in 5-ALA uptake.
Videos
Video 1
Parasite egress is unaffected by loss of the RhopH complex.
Synchronized parasites of rhopH3-loxP clone 4B11 were treated with DMSO or rapamycin at ring stage, then allowed to mature to schizont stage and further synchronised by incubation for 3–5 hr in the presence of 1 µM (4-[7-[(dimethylamino)methyl]−2-(4-fluorphenyl)imidazo[1,2-α]pyridine-3-yl]pyrimidin-2-amine (compound 2), which reversibly stalls egress. Egress of the parasites was then monitored by time-lapse DIC video microscopy following removal of the compound 2, as described previously (Das et al., 2015). DMSO-treated samples are shown on the left, rapamycin-treated are samples shown on the right.
Tables
Table 1
Conditional truncation of RhopH3 results in decreased parasite survival as determined by plaque assay.
| ∗Plaque assay no. | Treatment | †Proportion of wells containing plaques (%) | Mean number of plaques/well |
|---|---|---|---|
| 1 (clone 5F5) | DMSO | 98.88 | 7.7 |
| Rapamycin | 10.56 | 0.11 | |
| 2 (clone 5F5) | DMSO | 100 | 9.1 |
| Rapamycin | 8.89 | 0.09 | |
| 3 (clone 4B11) | DMSO | 99.44 | 5.24 |
| Rapamycin | 9.44 | 0.1 |
-
∗Three independent plaque assays were set up on different days.
-
†A total of 180 wells were used for each treatment in each assay.
Table 2
Oligonucleotide primers used in this study. Guide sequences shown in bold.
| Primer name | Sequence (5’−3’) |
|---|---|
| RHOPH3_sgRNA_E4_F | taagtatataatattTTCTTCGTTTTTAAAAAAAGgttttagagctagaa |
| RHOPH3_sgRNA_E4_R | ttctagctctaaaacCTTTTTTTAAAAACGAAGAAaatattatatactta |
| RHOPH3_sgRNA_E5_F | taagtatataatattCACCGATTTTAGCTTTAAAGgttttagagctagaa |
| RHOPH3_sgRNA_E5_R | ttctagctctaaaacCTTTAAAGCTAAAATCGGTGaatattatatactta |
| RHOPH3_sgRNA_E6_F | taagtatataatattACATTCTTATCATTATATTTgttttagagctagaa |
| RHOPH3_sgRNA_E6_R | ttctagctctaaaacACATTCTTATCATTATATTTaatattatatactta |
| RHOPH3_exon2_F1 | AGGAAATGGCCCAGACGC |
| RHOPH3_exon5_WT_R | TCTTTAAAGCTAAAATCGGTGATATTATGGCTC |
| RHOPH3_exon4-6rec_R | CAGGAAGTTACCTTTCAGCAGGG |
| RHOPH3_exon4-6rec_F | CCCTGCTGAAAGGTAACTTCCTG |
| RHOPH3_3UTR_R | CGAATATGTAATCAGTTGTATTTTTTCTCTAAAAGTTCATAG |
| +27 | CAATATCATTTGAATCAAACAGTGGT |
| −11 | CTTTGCCATCCAGGCTGTTC |
| −25 | CCATTGGACTAGAACCTTCAT |
| RHOPH3_exon7_R | CATAAAGAACGTCTTGTTTTCTGTATCCAATACC |
| RHOPH3_exon3_SB_F | CAAATATGCTATATGTGTAGGTACTCAATTTAAC |
| RHOPH3_exon3_SB_R | CATATAACTTTGGAGATGTAGAACCACAAGG |
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
The Plasmodium falciparum rhoptry protein RhopH3 plays essential roles in host cell invasion and nutrient uptake
eLife 6:e23239.
https://doi.org/10.7554/eLife.23239
