1. Chromosomes and Gene Expression
  2. Immunology and Inflammation

Major transcriptional changes observed in the Fulani, an ethnic group less susceptible to malaria

  1. Jaclyn E Quin
  2. Ioana Bujila
  3. Mariama Chérif
  4. Guillaume S Sanou
  5. Ying Qu
  6. Manijeh Vafa Homann
  7. Anna Rolicka
  8. Sodiomon B Sirima
  9. Mary A O'Connell
  10. Andreas Lennartsson
  11. Marita Troye-Blomberg
  12. Issa Nebie
  13. Ann-Kristin Östlund Farrants  Is a corresponding author
  1. Stockholm University, Sweden
  2. Centre National de Recherche et de Formation sur le Paludisme, Burkina Faso
  3. Université Polytechnique de Bobo-Dioulasso, Burkina Faso
  4. Karolinska Institute, Sweden
  5. Central European Institute of Technology, Czech Republic
https://doi.org/10.7554/eLife.29156
Share this article
Cite this article
  1. Jaclyn E Quin
  2. Ioana Bujila
  3. Mariama Chérif
  4. Guillaume S Sanou
  5. Ying Qu
  6. Manijeh Vafa Homann
  7. Anna Rolicka
  8. Sodiomon B Sirima
  9. Mary A O'Connell
  10. Andreas Lennartsson
  11. Marita Troye-Blomberg
  12. Issa Nebie
  13. Ann-Kristin Östlund Farrants
(2017)
Major transcriptional changes observed in the Fulani, an ethnic group less susceptible to malaria
eLife 6:e29156.
https://doi.org/10.7554/eLife.29156
  2. Download BibTeX
  3. Download .RIS
4 figures, 1 table and 3 additional files

Figures

Figure 1 with 1 supplement
Download asset Open asset
Characteristics of P.falciparum infection in Mossi and Fulani.

(a) Table describing study population. (b) Rate of infection with P.falciparum (Mossi n = 11/22 and Fulani n = 7/34, *p=0.0388). (c) Plasma levels of IgG antibodies to P.falciparum schizont extract antigens. Uninfected (- P.fal) and Infected (+P.fal). n = 11 Mossi – P.falw, 11 Mossi +P.falx, 27 Fulani – P.faly, 7 Fulani +P.falz (median ±min to max; w vs x n.s. p=0.4385, y vs z *p=0.0189, w vs y *p=0.0141, x vs z n.s. p=0.0693, w and x vs y and z ****p<0.001).

https://doi.org/10.7554/eLife.29156.003
Figure 1—figure supplement 1
Download asset Open asset
Schematic representation of workflow.
https://doi.org/10.7554/eLife.29156.004
Figure 2 with 2 supplements
Download asset Open asset
Differential gene expression in Mossi and Fulani following P.falciparum infection.

(a) Volcano plot of expression of individual genes in CD14+ cells (monocytes) of Fulani –P.fal (n = 7) relative to Mossi –P.fal (n = 4). (b) qRT-PCR analysis of selected DE genes (Up: P2RX7, CPVL, FAM26F. Down: ADAM28, ADGRG3, EPBH1) in validation cohort Mossi –P.fal (n = 4) and Fulani –P.fal (n = 10) (mean ±SD). (c) Table of significantly DE genes in CD14+ cells (monocytes) of Fulani –P.fal (n = 7) relative to Mossi –P.fal (n = 4). (d,e) Volcano plot of expression of individual genes in CD14+ cells (monocytes) of Fulani +P.fal (n = 2) relative to Fulani -P.fal (n = 7) (d), and Mossi +P.fal (n = 3) relative to Mossi -P.fal (n = 4) (e). (f) Table of number of DE genes in CD14+ cells (monocytes) of Mossi +P.fal relative to Mossi –P.fal and Fulani +P.fal relative to Fulani –P.fal. (g,h) Volcano plot of expression of individual genes in CD14- cells (lymphocytes) of Fulani +P.fal (n = 3) relative to Fulani -P.fal (n = 5) (g), and Mossi +P.fal (n = 3) relative to Mossi –P.fal (n = 5) (h).

https://doi.org/10.7554/eLife.29156.005
Figure 2—figure supplement 1
Download asset Open asset
Heat map of Pearson correlation between FPKM (fragments per kilobase of transcript per million mapped reads) values of for all CD14+ (monocytes) samples.

Mossi –P.fal (n = 4), Mossi +P.fal (n = 3), Fulani –P.fal (n = 7), Fulani + P.fal (n = 2).

https://doi.org/10.7554/eLife.29156.006
Figure 2—figure supplement 2
Download asset Open asset
Multidimension scaling for all CD14+ (monocytes) samples.

Mossi –P.fal (n = 4), Mossi +P.fal (n = 3), Fulani –P.fal (n = 7), Fulani + P.fal (n = 2).

https://doi.org/10.7554/eLife.29156.007
Figure 3 with 2 supplements
Download asset Open asset
Characteristics and validation of significantly DE genes in CD14+ cells (monocytes) of Fulani+P.fal relative to Fulani -P.fal.

(a) Classification of the most significantly DE genes in CD14+ cells (monocytes) of Fulani +P.fal relative to Fulani –P.fal (adjusted p-value<0.01, 171 genes). (b,c,d) qRT-PCR analysis of selected DE genes, with individual genes relative to –P.fal individuals (b), and combined genes relative to –P.fal (c) or Mossi (d) individuals (Genes: ALDOA, ARID3A, DUSP8, FES, FURIN, GAA, GAPDH, IRF3, IRF5, NFKBIE, OSM, RFXANK, SQSTM1, STRA13, TOLLIP, TRAF7), in validation cohort of Mossi –P.fal (n = 4), Fulani –P.fal (n = 10), Mossi +P.fal (n = 8) and Fulani + P.fal (n = 5) (mean ±SD) (Also see Figure 3—source data 1). (e,f,g) Cytokine levels in blood plasma of Mossi and Fulani individuals following P.falciparum infection. Uninfected (-P.fal) and Infected (+P.fal). n = 11 Mossi –P.falw, 11 Mossi +P.falx, 25 Fulani –P.faly, 9 Fulani + P.falz(e) Inflammasome cytokines IL-1β (mean ±SD; w vs x n.s. p>0.9999, y vs z ***p=0.0005, w vs y n.s. p=0.9285, x vs z **p=0.0081) and IL-18 (mean ±SD; w vs x n.s. p=0.4813, y vs z *p=0.0106, w vs y n.s. p>0.9999, x vs z n.s p=0.0947). (f) Pro-inflammatory cytokines IFNγ (mean ±SD; w vs x *p=0.0456, y vs z *p=0.0343, w vs y *p=0.0409, x vs z *p=0.0243) and IL-6 (mean ±SD; w vs x n.s. p=0.0862, y vs z n.s. p=0.3023, w vs y n.s. p=0.7166, x vs z *p=0.0359) (g) TGFβ (mean ±SD; w vs x n.s. p=0.5287, y vs z n.s. p=0.5735, w vs y *p=0.0122, x vs z n.s. p=0.2619, w and x vs y and z **p=0.0059) and IL-10 (mean ±SD; w vs x **p=0.032, y vs z n.s. p=0.0659, w vs y n.s. p=0.7154, x vs z n.s. p=0.2014)

https://doi.org/10.7554/eLife.29156.008
Figure 3—source data 1

qRT-PCR analysis of selected DE genes in monocytes of validation cohort of Mossi –P.fal (n = 4), Fulani –P.fal (n = 10), Mossi +P.fal (n = 8) and Fulani +P.fal (n = 5) (mean ±SD).

https://doi.org/10.7554/eLife.29156.011
Figure 3—figure supplement 1
Download asset Open asset
Volcano plot of expression of individual genes in Fulani +P.fal (n = 2) relative to Mossi +P.fal (n = 3) CD14 +PBMCs (monocytes).
https://doi.org/10.7554/eLife.29156.009
Figure 3—figure supplement 2
Download asset Open asset
ELISA of blood plasma in Mossi and Fulani individuals following P.falciparum infection.

Uninfected (-P.fal) and Infected (+P.fal). (n = 11 Mossi –P.falw, 8 Mossi +P.falx, 23 Fulani –P.faly, 9 Fulani +P.falz.) a. IL-1Ra (mean ±SD; w vs x *p=0.0257, y vs z **p=0.0048, w vs y n.s. p=0.5673, x vs z n.s. p=0.4807). b. IL-1RII (mean ±SD; w vs x n.s. p=0.5305, y vs z *p=0.0149, w vs y n.s. p=0.6179, x vs z n.s. p=0.4807). c. IL-18BPa (mean ±SD; w vs x n.s. p=0.3100, y vs z *p=0.0149, w vs y n.s. p=0.2038, x vs z n.s. p=0.2766).

https://doi.org/10.7554/eLife.29156.010
Figure 4 with 1 supplement
Download asset Open asset
Regulation of chromatin in Mossi and Fulani monocytes.

(a) Table of selected DE chromatin regulation factors. (b and c) qRT-PCR analysis of selected DE chromatin regulation genes (Genes: SETD1A, CXXC1, KDM4B, KDM6B, BRG1, RUVBL2, SUV39H1, SIRT7, PHC2, PPP4C) in validation cohort of Mossi -P.fal (n = 4), Fulani -P.fal (n = 10), Mossi +P.fal (n = 8) and Fulani +P.fal (n = 5) relative to –P.fal (b) and Mossi (c) individuals (mean ±SD). (Also see Figure 4—source data 1). (d) Difference in DNA methylation at DE genes (Fulani +P.fal (n = 3) relative to Fulani –P.fal (n = 3)). (e and f) Examples of clusters of DE genes. (e) Change in expression of all significantly DE genes, in selected regions that include cytobands enriched in DE genes (Fulani +P.fal relative to Fulani –P.fal, adjusted p-valued < 0.05). Genes indicated in red are also DE in Fulani +P.fal relative to Mossi +P.fal (FDR < 0.1). * Indicates location of uncharacterised loci associated with resistance to severe P.falciparum malaria. (f) Difference in DNA methylation in selected regions that include cytobands enriched in DE genes (Fulani +P.fal relative to Fulani –P.fal, adjusted p-valued < 0.05), showing individual probes (black) and binned values (300 probes; red).

https://doi.org/10.7554/eLife.29156.012
Figure 4—source data 1

qRT-PCR analysis of selected DE chromatin regulation genes in monocytes of validation cohort of Mossi –P.fal (n = 4), Fulani –P.fal (n = 10), Mossi +P.fal (n = 8) and Fulani +P.fal (n = 5) (mean ±SD).

https://doi.org/10.7554/eLife.29156.014
Figure 4—figure supplement 1
Download asset Open asset
Difference in DNA methylation at between Mossi –P.fal (n = 3), Mossi +P.fal (n = 3), Fulani –P.fal (n = 3), and Fulani +P.fal (n = 3).
https://doi.org/10.7554/eLife.29156.013

Tables

Table 1
Primer sequences used for QRT-PCR analysis
https://doi.org/10.7554/eLife.29156.015
GeneFR
ADGRG3CGAAGGGCCAAGAAACACCTCGTAGTTTAGCCAGTATCTCTGC
ALDOAATGCCCTACCAATATCCAGCAGCTCCCAGTGGACTCATCTG
ARID3AAGCTGCAGCCGCCTGACCACTGTTGGGAGCAGAGGTTGGC
BRG1 (SMARCA4)AGGCAAAATCCAGAAGCTGACGCTTGTCCTTCTTCTGGTC
CATSPER2ATGGCCGCTTACCAACAAGAATGCAAATGCTCAATGAGAGAGAA
CPVLTGGAAGGTGATTGTTTCGCTGGTCTCCCTTAGGTGGCATGGA
CXXC1GCAAACCGGACATCAACTGCGCACTCCCGACAGTACCAC
DACH1GGGGCTTGCATACGGTCTACCGAACTTGTTCCACATTGCACA
DUSP8CGAACTTGTTCCACATTGCACACGAACTTGTTCCACATTGCACA
EPBH1GGCTGCGATGGAAGAAACGCTGGTTGGGCTCGAAGACATT
FAM26FTGTCACCCGATGCCTATCTCTGGCCCTTCGGATTGAAAGTA
FESGGCCGAGCTTCGTCTACTGGTCCTGCATACTCCCTGTCAC
FURINCCTGGTTGCTATGGGTGGTAGAAGTGGTAATAGTCCCCGAAGA
GAACATCCTACTCCATGATTTCCTGCAGCTGGGTGAGTCTCCTCC
GAPDHTGCACCACCAACTGCTTAGCGGCATGGACTGTGGTCATGAG
IRF3IRF3 Set #VHPS-4629 purchased from Realtimeprimers.com
IRF5IRF5 Set #6 purchased from Realtimeprimers.com
KDM4BKDM4B Set #6 purchased from Realtimeprimers.com
KDM6BKDM6B Set #1 purchased from Realtimeprimers.com
NFKBIETCTGGCATTGAGTCTCTGCGAGGAGCCATAGGTGGAATCAG
OSMCACAGACTGGCCGACTTAGAGAGTCCTCGATGTTCAGCCCA
P2R × 7CTCCCATCTCAACTCCCTGATCCTGGTAGAGCAGGAGGAA
PHC2AGGGAACGGAAACTCTGCCTTCGATAACATGCGTCAGGATTTG
PP1AAGACAAGGTCCCAAAGACACCACCCTGACACATAAA
PPP4CAAGGTTCGCTATCCTGATCGCAGCCATAGACCTGCGTGATCT
RFXANKGTGACAACCTCGTCAACAAGCCGAACGGTCTCAATCTCTCCAA
RUVBL2RUVBL2 Set #1 purchased from Realtimeprimers.com
SETD1ASETD1A Set #1 purchased from Realtimeprimers.com
SIRT7GTGGACACTGCTTCAGAAGCACAGTTCTGAGACACCACA
SQSTM1GCACCCCAATGTGATCTGCCGCTACACAAGTCGTAGTCTGG
STRA13CCTCCTGGCCACATTCCTGGATTTATTGATGTTGCTTTGTGAGAA
SUV39H1SUC39H1 Set #2 purchased from Realtimeprimers.com
TOLLIPAGA ATC CCC GCT GGA ATA AGGCG TAG GAC ATG ACG AGG TT
TRAF7TCTGCGCTCCACATTCTCACACCGCGATGTTGTTCACCA

Additional files

Supplementary file 1

(A) Significantly differentially DNA methylated genes in monocytes of Fulani -P.fal relative to Mossi –P.fal. (B) Significantly differentially DNA methylated genes in monocytes of Fulani +P.fal relative to Fulani –P.fal.

https://doi.org/10.7554/eLife.29156.016
Supplementary file 2

(A) List of all significantly DE genes in monocytes for all comparisons (adjusted p-value<0.05, shown in red). Where gene symbol is listed in red, gene is not significantly DE in Fulani +P.fal relative to Fulani –P.fal. (B) List of significantly DE genes in monocytes of Fulani +P.fal relative to Fulani –P.fal (adjusted p-value<0.05). (C) List of significantly DE genes in monocytes of Mossi +P.fal relative to Mossi –P.fal (adjusted p-value<0.05). (D) List of significantly DE genes in monocytes of Fulani +P.fal relative to Mossi +P.fal (adjusted p-value<0.05). (E) List of inflammasome related significantly DE genes in monocytes of Fulani + P.fal relative to Fulani –P.fal (adjusted p-value<0.05). (F) List of transcription factor binding sites enriched at significantly DE genes in monocytes of Fulani +P.fal relative to Fulani –P.fal. (G) qRT-PCR analysis of selected DE genes in Fulani cohort for RNA-sequencing analysis. Fulani –P.fal  (n=7) and Fulani +P.fal  (n=3) (mean ± SD).

https://doi.org/10.7554/eLife.29156.017
Transparent reporting form
https://doi.org/10.7554/eLife.29156.018

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jaclyn E Quin
  2. Ioana Bujila
  3. Mariama Chérif
  4. Guillaume S Sanou
  5. Ying Qu
  6. Manijeh Vafa Homann
  7. Anna Rolicka
  8. Sodiomon B Sirima
  9. Mary A O'Connell
  10. Andreas Lennartsson
  11. Marita Troye-Blomberg
  12. Issa Nebie
  13. Ann-Kristin Östlund Farrants
(2017)
Major transcriptional changes observed in the Fulani, an ethnic group less susceptible to malaria
eLife 6:e29156.
https://doi.org/10.7554/eLife.29156