Live-cell mapping of organelle-associated RNAs via proximity biotinylation combined with protein-RNA crosslinking
- Massachusetts Institute of Technology, United States
- Stanford University, United States
- Harvard University, United States
- Broad Institute of Massachusetts Institute of Technology and Harvard, United States
Figures
Figure 1 with 2 supplements
APEX-RIP in mitochondria.
(A) Overview of the APEX-RIP workflow. Live cells expressing APEX2 (grey ‘pacmen’) targeted to the compartment of interest (here, the mitochondrial matrix) are incubated with the APEX substrate …
Figure 1—figure supplement 1
Optimization of APEX-RIP protocol.
(A) Top: Alternative labeling and crosslinking protocols. In protocol I., cells are crosslinked with formaldehyde (FA) and quenched with Glycine (Gly) prior to the introduction of biotin-phenol (BP) …
Figure 1—figure supplement 2
Reproducibility of the mito-APEX2 RIP experiment.
Pairwise correlations between global RNA abundances (FPKM) in biological replicates (A) prior to enrichment, and (B) following mito-APEX2-RIP.
Figure 2 with 3 supplements
APEX-RIP mapping of the nuclear-cytoplasmic RNA distribution.
(A) Fluorescence imaging of nuclear and cytosol-targeted APEX2 fusion constructs. HEK 293T cells expressing the indicated constructs (‘NLS,’ nuclear localization signal; ‘NES,’ nuclear export …
Figure 2—figure supplement 1
Characterization of APEX2 fusion constructs.
HEK 293 T cells stably expressing the indicated constructs (right) were labeled and crosslinked via Protocol II (Figure 1—figure supplement 1A). Cell lysates were analyzed by SDS-PAGE, blotting with …
Figure 2—figure supplement 2
Reproducibility of nuclear–cytoplasmic APEX-RIP experiments.
Pairwise correlations between global RNA abundances (FPKM) in biological replicates of the APEX2–NLS-RIP experiment, (A) prior to, and (B), following enrichment, and similarly, of the APEX2–NES-RIP …
Figure 2—figure supplement 3
Precision and specificity of nuclear–cytoplasmic APEX-RIP, and its comparison to subcellular fractionation.
(A–B) Determination of cutoffs for APEX-RIP data by ROC analysis (see Materials and methods). (C) APEX protein localization isn’t perturbed during the APEX-RIP labeling and crosslinking protocol. …
Figure 3 with 2 supplements
APEX-RIP at the Endoplasmic Reticulum membrane.
(A—B) Schematics summarizing alternating ER-targeting strategies. (A) HRP, targeted to the ER lumen with a KDEL sequence, biotinylates proteins within the ER. Red B: biotin. Red X’s: chemical …
Figure 3—figure supplement 1
Further optimization of the APEX-RIP protocol; additional HRP-KDEL RIP data.
(A) Addition of a radical quenching step between APEX2 labeling and formaldehyde crosslinking improves APEX-RIP specificity. Top: schematic of the revised labeling–crosslinking workflow. The radical …
Figure 3—figure supplement 2
Additional analysis comparing HRP-KDEL RIP data and other ER-RNA data sets.
(A) Gene ontology (GO) analysis of mRNAs that were enriched in ER datasets, but which lack secretory annotation. The number of RNA species in each class is indicated to the right of the …
Figure 4
Mapping the ER-proximal transcriptome with APEX–RIP.
(A) Global analysis of RNA localization at the Endoplasmic Reticulum. Fold change = (FPKMpost-enrichment/FPKMpre-enrichment). Horizontal dashed line indicates p-value = 0.05. Top histogram …
Figure 5
APEX-RIP reveals RNAs with potentially novel localization.
(A) Many mitochondrial transmembrane proteins appear to be translated at the ER. mRNAs encoding mitochondrial proteins (defined by GOCC and MitoCarta 1.0 (Ashburner et al., 2000; Pagliarini et al., …
Author response image 1
Fractionation-Seq and APEX-RIP recover similar populations of intronic sequences from each compartment.
A. Both methods quantify the nuclear enrichment and cytosolic de-enrichment of intronic reads (GENCODE hg19) to similar extents. We ascribe the greater number of intronic reads in the APEX …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| cell line (human) | HEK293T | ATCC | CRL3216; RRID: CVCL_0063 | |
| cell line (human) | mito-APEX2 (HEK293T) | this paper | mito-BamHI-V5-APEX2 CMV promoter Mito is a 24-amino acidmitochondrial targeting sequence (MTS) derived from COX4. V5: GKPIPNPLLGLDST | |
| cell line (human) | APEX2-NLS (HEK293T) | this paper | NotI-V5-APEX2-EcoRI-3xNLS-NheI CMV promoter NLS: DPKKKRKV | |
| cell line (human) | APEX2-NES (HEK293T) | PMID: 28441135 | BstBI-FLAG-APEX2-NES-NheI CMV promoter NES: LQLPPLERLTLD | |
| cell line (human) | ERM-APEX2 (HEK293T) | PMID: 28441135 | BstBI-ERM-APEX2-V5-NheI CMV promoter ERM is ER membrane targeting sequence derived from N-terminal 27 amino acids of rabbit P450 C1 (MDPVVVLGLCLSCLLLLSLWKQSYGGG) | |
| cell line (human) | HRP-KDEL (HEK293T) | this paper | NotI-IgK-HRP-V5-KDEL-IRES-puromycin-XbaI CMV promoter IgK is N-terminal signaling sequence that brings protein to ER (METDTLLLWVLLLWVPGSTGD). KDEL is ER-retaining sequence | |
| antibody | Anti V5 | Life Technologies | R960-25; RRID: AB_2556564 | Dilution 1:1000 |
| antibody | Anti FLAG | Agilent | 200472 | Dilution 1:500 |
| antibody | Anti TOM20 | Santa Cruz Biotechnology | sc-11415; RRID: AB_2207533 | Dilution 1:400 |
| antibody | Anti RCN2 | Proteintech | 10193–2-AP; RRID: AB_2180018 | Dilution 1:200 |
| antibody | Anti Mouse-AlexaFlour488 | Life Technologies | A-11029; RRID: AB_2534088 | Dilution 1:1000 |
| antibody | Anti Mouse-AlexaFlour568 | Life Technologies | A-11031; RRID: AB_144696 | Dilution 1:1000 |
| antibody | Streptavidin-HRP | ThermoFisher | S-911 | Dilution 1:1000 |
| recombinant DNA reagent | Mito-APEX (plasmid) | PMID: 23371551 | pCDNA vector | |
| recombinant DNA reagent | mito-APEX2 (plasmid) | this paper | pLX304 vector | mito-BamHI-V5-APEX2 CMV promoter Mito is a 24-amino acidmitochondrial targeting sequence (MTS) derived from COX4. V5: GKPIPNPLLGLDST |
| recombinant DNA reagent | APEX2-NLS (plasmid) | this paper | NotI-V5-APEX2-EcoRI-3xNLS-NheI CMV promoter NLS: DPKKKRKV | |
| recombinant DNA reagent | HRP-KDEL (plasmid) | this paper | NotI-IgK-HRP-V5-KDEL-IRES-puromycin-XbaI CMV promoter IgK is N-terminal signaling sequence that brings protein to ER (METDTLLLWVLLLWVPGSTGD). KDEL is ER-retaining sequence | |
| sequence-based reagent | Ribo-Zero Gold rRNA removal kit (Illumina) | Illiumina | MRZG12324 | |
| sequence-based reagent | Truseq RNA sample preparation kit V2 | Illiumina | RS-122–2001 | |
| sequence-based reagent | MT-ND1 forward | this paper | CACCTCTAGCCTAGCCGTTT | |
| sequence-based reagent | MT-ND1 reverse | this paper | CCGATCAGGGCGTAGTTTGA | |
| sequence-based reagent | MT-ND2 forward | this paper | CTTAAACTCCAGCACCACGAC | |
| sequence-based reagent | MT-ND2 reverse | this paper | AGCTTGTTTCAGGTGCGAGA | |
| sequence-based reagent | MT-ND3 forward | this paper | CCGCGTCCCTTTCTCCATAA | |
| sequence-based reagent | MT-ND3 reverse | this paper | AGGGCTCATGGTAGGGGTAA | |
| sequence-based reagent | MT-ND4 forward | this paper | ACAACACAATGGGGCTCACT | |
| sequence-based reagent | MT-ND4 reverse | this paper | CCGGTAATGATGTCGGGGTT | |
| sequence-based reagent | MT-ND4L forward | this paper | TCGCTCACACCTCATATCCTC | |
| sequence-based reagent | MT-ND4L reverse | this paper | AGGCGGCAAAGACTAGTATGG | |
| sequence-based reagent | MT-ND5 forward | this paper | TCCATTGTCGCATCCACCTT | |
| sequence-based reagent | MT-ND5 reverse | this paper | GGTTGTTTGGGTTGTGGCTC | |
| sequence-based reagent | MT-ND6 forward | this paper | GGGTTGAGGTCTTGGTGAGT | |
| sequence-based reagent | MT-ND6 reverse | this paper | ACCAATCCTACCTCCATCGC | |
| sequence-based reagent | MT-CYTB forward | this paper | TCTTGCACGAAACGGGATCA | |
| sequence-based reagent | MT-CYTB reverse | this paper | CGAGGGCGTCTTTGATTGTG | |
| sequence-based reagent | MT-COX1 forward | this paper | TCCTTATTCGAGCCGAGCTG | |
| sequence-based reagent | MT-COX1 reverse | this paper | ACAAATGCATGGGCTGTGAC | |
| sequence-based reagent | MT-COX2 forward | this paper | AACCAAACCACTTTCACCGC | |
| sequence-based reagent | MT-COX2 reverse | this paper | CGATGGGCATGAAACTGTGG | |
| sequence-based reagent | MT-COX3 forward | this paper | CTAATGACCTCCGGCCTAGC | |
| sequence-based reagent | MT-COX3 reverse | this paper | AGGCCTAGTATGAGGAGCGT | |
| sequence-based reagent | MT-ATP6 forward | this paper | TTCGCTTCATTCATTGCCCC | |
| sequence-based reagent | MT-ATP6 reverse | this paper | GGGTGGTGATTAGTCGGTTGT | |
| sequence-based reagent | MT-ATP8 forward | this paper | ACTACCACCTACCTCCCTCAC | |
| sequence-based reagent | MT-ATP8 reverse | this paper | GGCAATGAATGAAGCGAACAGA | |
| sequence-based reagent | MT-RNR1 forward | this paper | CATCCCCGTTCCAGTGAGTT | |
| sequence-based reagent | MT-RNR1 reverse | this paper | TGGCTAGGCTAAGCGTTTTGA | |
| sequence-based reagent | MT-RNR2 forward | this paper | CAGCCGCTATTAAAGGTTCGT | |
| sequence-based reagent | MT-RNR2 reverse | this paper | AAGGCGCTTTGTGAAGTAGG | |
| sequence-based reagent | GAPDH forward | this paper | TTCGACAGTCAGCCGCATCTTCTT | |
| sequence-based reagent | GAPDH reverse | this paper | GCCCAATACGACCAAATCCGTTGA | |
| sequence-based reagent | XIST forward | this paper | CCCTACTAGCTCCTCGGACA | |
| sequence-based reagent | XIST reverse | this paper | ACACATGCAGCGTGGTATCT | |
| sequence-based reagent | EMC10 forward | this paper | TTCATTGAGCGCCTGGAGAT | |
| sequence-based reagent | EMC10 reverse | this paper | TTCATTGAGCGCCTGGAGAT | |
| sequence-based reagent | PCSK1N forward | this paper | GAGACACCCGACGTGGAC | |
| sequence-based reagent | PCSK1N reverse | this paper | AATCCGTCCCAGCAAGTACC | |
| sequence-based reagent | SSR2 forward | this paper | GTTTGGGATGCCAACGATGAG | |
| sequence-based reagent | SSR2 reverse | this paper | CTCCACGGCGTATCTGTTCA | |
| sequence-based reagent | TMX1 forward | this paper | ACGGACGAGAACTGGAGAGA | |
| sequence-based reagent | TMX1 reverse | this paper | ATTTTGACAAGCAGGGCACC | |
| sequence-based reagent | SFT2D2 forward | this paper | CCATCTTCCTCATGGGACCAG | |
| sequence-based reagent | SFT2D2 reverse | this paper | GCAGAACACAGGGTAAGTGC | |
| sequence-based reagent | EPT1 forward | this paper | TGGCTTTCTGCTGGTCGTAT | |
| sequence-based reagent | EPT1 reverse | this paper | AATCCAAACCCAGTCAGGCA | |
| sequence-based reagent | DRAP1 forward | this paper | ACATCCCACCTGAAGCAGTG | |
| sequence-based reagent | DRAP1 reverse | this paper | GATGCCACCAGGTCCTTCAA | |
| sequence-based reagent | FAU forward | this paper | TCCTAAGGTGGCCAAACAGG | |
| sequence-based reagent | FAU reverse | this paper | GTGGGCACAACGTTGACAAA | |
| sequence-based reagent | SUB1 forward | this paper | CGTCACTTCCGGTTCTCTGT | |
| sequence-based reagent | SUB1 reverse | this paper | TGATTTAGGCATCGCTTCGC | |
| sequence-based reagent | LSM6 forward | this paper | CGGACGACCAGTTGTGGTAA | |
| sequence-based reagent | LSM6 reverse | this paper | CCAGGACCCCTCGATAATCC | |
| sequence-based reagent | COPS2 forward | this paper | AGGAGGACTACGACCTGGAAT | |
| sequence-based reagent | COPS2 reverse | this paper | GCCGCTTTTGGGTCATCTTC | |
| sequence-based reagent | CGGBP1 forward | this paper | GCCTCGTCCACTTTCCCTAA | |
| sequence-based reagent | CGGBP1 reverse | this paper | TCATGCCTTTACGTAGGATCGAG | |
| sequence-based reagent | BCA53 forward | this paper | TCTTGCCTGCTCCACAGTTT | |
| sequence-based reagent | BCA53 reverse | this paper | CAAACACCAAGGAGGGGTCT | |
| sequence-based reagent | CEP128 forward | this paper | TACAGTAATGGACAGGCGGG | |
| sequence-based reagent | CEP128 reverse | this paper | TCCGGAGTTGGTCGATTGAT | |
| sequence-based reagent | MAD1L1 forward | this paper | CGAGTCTGCCATCGTCCAA | |
| sequence-based reagent | MAD1L1 reverse | this paper | GCACTCTCCACCTGCTTCTT | |
| sequence-based reagent | RAD51B forward | this paper | TTTGGACGAAGCCCTGCAT | |
| sequence-based reagent | RAD51B reverse | this paper | CACAACCTGGTGGACCTGTA | |
| sequence-based reagent | RBPMS forward | this paper | ACAGTCGCTCAGAAGCAGAG | |
| sequence-based reagent | RBPMS reverse | this paper | CGAAGCGGATGCCATTCAAA | |
| sequence-based reagent | TCF7 forward | this paper | TCAACAGCCCACATCCCAC | |
| sequence-based reagent | TCF7 reverse | this paper | AGAGGCCTGTGAACTTGCTT | |
| sequence-based reagent | HOOK2 forward | this paper | TTTGCTGAAAAGGAAGCTGGA | |
| sequence-based reagent | HOOK2 reverse | this paper | GCAACTCCAGATCTGCCTCA | |
| sequence-based reagent | MAN2C1 forward | this paper | ATGAGGCCCACAAGTTCCTG | |
| sequence-based reagent | MAN2C1 reverse | this paper | TCTCATAGGTGGCCTGGGAA | |
| peptide, recombinant protein | ||||
| commercial assay or kit | ||||
| chemical compound, drug | Biotin-phenol (BP) | PMID: 23371551 | ||
| software, algorithm | Tophat v2.1.1 | DOI: 10.1186/gb-2013-14-4-r36 | RRID:SCR_013035 | |
| software, algorithm | CuffDiff2 | RRID:SCR_001647 | ||
| software, algorithm | Slidebook 6.0 | RRID:SCR_014300 | ||
| software, algorithm | DAVID bioinformatics analysis | RRID:SCR_003033 | ||
| other |
Additional files
-
Supplementary file 1
Mitochondrial APEX-RIP Data.
(A) RNAs enriched by mito-APEX2-RIP. (B) Unfiltered mito-APEX-RIP RNA-Seq data. (C) Column definitions.
- https://doi.org/10.7554/eLife.29224.014
-
Supplementary file 2
Nuclear and Cytosolic APEX-RIP Data.
(A) APEX2-RIP-enriched nuclear RNAs. (B) APEX2-RIP-enriched cytosolic RNAs. (C) Unfiltered APEX-RIP RNA-Seq data. (D) Unfiltered nuclear and cytosolic fractionation-seq data (Sultan et al., 2014). (E) Fractionation-Seq-enriched Nuclear RNAs. (F) Fractionation-Seq-enriched cytosolic RNAs. (G) lncRNAs used to determine coverage analysis (Figure 2F). (H) Column definitions.
- https://doi.org/10.7554/eLife.29224.015
-
Supplementary file 3
KDEL-RIP Data (ER-proximal RNAs).
(A) KDEL-RIP-enriched ER-proximal RNAs. (B) Unfiltered KDEL-RIP RNA-Seq data. (C) ER-associated RNAs enriched by Fractionation-Seq (Reid and Nicchitta, 2012). (D) ER-associated RNAs enriched by proximity-dependent ribosome profiling (Jan et al., 2014). (E) True positive list: RNAs encoding established ER-resident proteins. (F) Column definitions.
- https://doi.org/10.7554/eLife.29224.016
-
Supplementary file 4
Additional analysis of ER and nuclear datasets.
(A) Mitochondrial mRNAs (nuclear-encoded) enriched at the ER membrane. (B) RNAs that may be enriched at the nuclear lamina. (C) Column definitions.
- https://doi.org/10.7554/eLife.29224.017
-
Supplementary file 5
Materials used in this study.
(A) Genetic constructs used in this study. (B) Antibodies used for immunofluorescence. RRID: Research Resource Identifier (https://scicrunch.org/resources). (C) qRT-PCR primers used in this study. (D) Column definitions.
- https://doi.org/10.7554/eLife.29224.018
-
Transparent reporting form
- https://doi.org/10.7554/eLife.29224.019
