Neuromodulatory connectivity defines the structure of a behavioral neural network
- National Institute of Mental Health, National Institutes of Health, United States
- National Institute of General Medical Sciences, National Institutes of Health, United States
Figures
Figure 1
ETHRA/CCAP neuronal activity modulates all phases of pupal ecdysis.
(A) Fluorescence confocal image of a pupal CNS wholemount. Neurons that express ETHRA, CCAP, and Bursicon are revealed by intersectional expression of UAS-6XEGFP (green, left) under the control of …
Figure 2
Bursicon and CCAP target distinct groups of neurons essential for pupal ecdysis.
(A) Pupal CNS wholemounts showing neurons targeted by Bursicon (Rk-Gal4, left) and CCAP (CCAP-R-Gal4, middle). Green, UAS-6XGFP. Right panel: Intersectional labeling with Rk-Gal4DBD∩CCAP-R-p65AD …
Figure 3
Stimulating Bursicon-expressing neurons induces Phase II-like activity in VNC-Rk neurons.
(A–A”) Pupal CNS wholemounts showing neurons that express Rk and either: (A) the motor neuron marker VGlut, (A’) ETHRA, or (A”) ETHRB, as revealed by Split Gal4 intersectional labeling. Reporters: …
Figure 4 with 1 supplement
ETH1-induced Ca++ activity in Rk-expressing neurons is triphasic.
(A) Ca++ activity in VNC-Rk neurons (measured within the dashed box, left, in an excised pupal CNS) shows a phasic response to ETH1 (black trace), distinct from the activity of control preparations …
Figure 4—figure supplement 1
The PhaseFinder program for automated analysis of Ca++ activity.
(A) Example of PhaseFinder’s peak detection algorithm. PhaseFinder first identifies peaks in a Ca++ trace using a built-in MatLab function. Custom code then runs a sliding window over the trace and …
Figure 5 with 1 supplement
Rk-expressing neurons act in central pattern generation.
(A–C) Analysis of ETH1-induced Ca++ activity in VNC-Rk neurons. (A) Images from two complete cycles of alternating Ca++ signal in VNC-Rk neurons during Phase 2. Images correspond to the indicated …
Figure 5—figure supplement 1
VNC-Rk responses to ETH1 differ.
(A) A Snapshot of ETH1-induced GCaMP6s activity (green) in VNC-Rk neurons. Circles indicate the 95 regions of interest (ROIs) selected for analysis of their response to ETH1. These regions were …
Figure 6 with 1 supplement
CCAP-R-expressing motor neurons act downstream of Rk-expressing neurons.
(A, A’) A late 3rd instar larval fillet in which body wall muscles are stained with phalloidin (magenta) and a UAS-6XGFP reporter (green) reveals the expression pattern of a …
-
Figure 6—source data 1
Ca++ Oscillation Frequencies for Rk and CCAP-R Motor Neurons.
- https://doi.org/10.7554/eLife.29797.019
Figure 6—figure supplement 1
CCAP-R- and ETHR-expressing neurons are largely distinct.
(A) Few neurons express both CCAP-R and ETHRA as revealed by intersectional labeling with the CCAPR-Gal4DBD∩ETHRA-p65AD hemidriver pair driving expression of UAS-6XGFP (green). The maximum …
Figure 7
ETHRB-expressing and non-CCAP/ETHRA neurons regulate Phase I.
(A) Pupal CNS wholemount showing the expression pattern of ETHRB-Gal4 (green, UAS-6XGFP). VNC, ventral nerve cord. Scale bar: 50 µm. (B) Similar to (A), but showing the expression pattern of …
Videos
Video 1
The pupal ecdysis sequence and its constituent motor programs.
Video speed: 20X.
Video 2
Activating ETHRA/CCAP neurons terminates execution of the Phase I motor pattern and induces Phase II.
ETHRA/CCAP neurons were activated using UAS-dTRPA1 by a one minute temperature shift to 29°C, followed by a return to 18°C. Video speed: 20X.
Video 3
Suppressing Rk- or CCAP-R-expressing neurons using UAS-Kir2.1 impairs pupal ecdysis behavior.
Shown are pupae in which: CCAP-R-expressing neurons (left), Rk-expressing neurons (right), or no neurons (middle) are suppressed. Video speed: 20X.
Video 4
Ca++activity in body wall muscles during pupal ecdysis.
GCaMP6s was expressed in muscle using the 24B-Gal4 driver. Solid line indicates boundary of the pupal case below the head. A non-muscle, ETH-induced signal in the salivary glands is also visible. …
Video 5
ETH-induced activity in VNC-Rk neurons oscillates across the midline during Phase 2.
Video record: collected at 1 Hz; video speed: 50X.
Video 6
ETH-induced activity in VNC-Rk neurons during Phase 3.
Video record: collected at 1 Hz; video speed: 50X.
Video 7
ETH-induced activity in VNC-Rk neurons during Phase 1.
Video record: total time 90 min, collected at 1 Hz; video speed: 50X.
Video 8
Suppressing ETHRB expressing neurons using UAS-Kir2.1 eliminates pre-ecdysis behavior.
Right: pupa in which ETHRB-expressing neurons are suppressed. Left: unsuppressed control animal. Video speed: 30X
Video 9
Suppressing non-CCAP/ETHRA neurons shortens Phase I behavior.
Left: pupa in which non-CCAP/ETHRA neurons are suppressed. Right: unsuppressed control animal. Video speed: 30X.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (D. melanogaster) | ETHRB-Gal4 (ETHRBMI00949-Gal4) | Diao et al. (2016) (doi: 10.1534/genetics.115.182121) | N/A | |
| Genetic reagent (D. melanogaster) | ETHRA-Gal4 (ETHRAMI00949-Gal4) | Diao et al. (2016) (doi: 10.1534/genetics.115.182121) | N/A | |
| Genetic reagent (D. melanogaster) | ETHRA-p65AD (ETHRAMI00949-p65AD) | Diao et al. (2016) (doi: 10.1534/genetics.115.182121) | N/A | |
| Genetic reagent (D. melanogaster) | ETHRB-p65AD | This paper | N/A | Split Gal4 hemidriver |
| Genetic reagent (D. melanogaster) | CCAP-R-Gal4 (CCAP-RMI05804-GAL4) | Diao et al. (2015) (doi: 10.1016/j.celrep.2015.01.059) | N/A | |
| Genetic reagent (D. melanogaster) | CCAP-R-Gal4DBD (CCAP-RMI05804-GAL4DBD) | This paper | N/A | Split Gal4 hemidriver |
| Genetic reagent (D. melanogaster) | CCAPR-p65AD (CCAP-RMI05804-p65AD) | This paper | N/A | Split Gal4 hemidriver |
| genetic reagent (D. melanogaster) | CCAP-Gal4DBD | Luan et al. (2006b) (PMID: 17088209) | N/A | |
| Genetic reagent (D. melanogaster) | Burs-LexA::VP16AD | This paper | N/A | LexA driver |
| Genetic reagent (D. melanogaster) | RK-Gal4 (Rkpan-Gal4) | Diao and White (2012) (doi: 10.1534/genetics.111.136291) | N/A | |
| Genetic reagent (D. melanogaster) | RK-Gal4DBD (RkTGEM-Gal4DBD) | This paper | N/A | Split Gal4 hemidriver |
| Genetic reagent (D. melanogaster) | RK-p65AD (RkTGEM-p65AD) | This paper | N/A | Split Gal4 hemidriver |
| Genetic reagent (D. melanogaster) | RK- LexA::QFAD (RkTGEM- LexA::QFAD) | This paper | N/A | Split Gal4 hemidriver |
| Genetic reagent (D. melanogaster) | VGlut-LexA::QFAD (VGlutMI04979-LexA::QFAD) | Diao et al. (2015) (doi: 10.1016/j.celrep.2015.01.059) | N/A | |
| Genetic reagent (D. melanogaster) | VGlut-Gal4DBD (VGlutMI04979-Gal4DBD) | Diao et al. (2015) (doi: 10.1016/j.celrep.2015.01.059) | N/A | |
| Genetic reagent (D. melanogaster) | UAS-GCaMP6S, insertions on Chromosomes II and III | Bloomington Drosophila Stock Center (BDSC) | 42746; 42749 | |
| Genetic reagent (D. melanogaster) | UAS-Kir2.1 insertions on Chromosomes II and III | Bloomington Drosophila Stock Center | 6596 | |
| Genetic reagent (D. melanogaster) | UAS-dTrpA1 | other | BDSC 26263 | Paul Garrity, Brandeis |
| Genetic reagent (D. melanogaster) | tubP-Gal80ts-20 | Bloomington Drosophila Stock Center | 7019 | |
| Genetic reagent (D. melanogaster) | UAS-P2X2 | other | N/A | Orie Shafer, Univ. of Michigan |
| Genetic reagent (D. melanogaster) | MiMIC CCAP-R[MI05804] | Bloomington Drosophila Stock Center | BDSC 40788 | |
| Genetic reagent (D. melanogaster) | UAS-6XEGFP on II and III | Bloomington Drosophila Stock Center | 52261; 52262 | |
| Genetic reagent (D. melanogaster) | UAS-6XmCherry on III | Bloomington Drosophila Stock Center | 52268 | |
| Genetic reagent (D. melanogaster) | 24B (How)-Gal4 | Bloomington Drosophila Stock Center | 1767 | |
| Genetic reagent (D. melanogaster) | {nosCas9} attP2 line | Ren et al. (2013) (doi: 10.1073/pnas.1318481110) | ||
| Genetic reagent (D. melanogaster) | W1118 | other | White lab stock | |
| Antibody | Rabbit polyclonal anti-pBurs | other | N/A | Aaron Hsueh/Willi Honegger, Used at 1:1000 |
| Antibody | Alexafluor555-conjugated guinea pig anti-mouse | Invitrogen | 1789887 | |
| Recombinant DNA reagent | U6b-sgRNA-short plasmid | Ren et al. (2013) (doi: 10.1073/pnas.1318481110) | ||
| Recombinant DNA reagent | pT-GEM(1) plasmid | Diao et al. (2015) (doi: 10.1016/j.celrep.2015.01.059) | ||
| Recombinant DNA reagent | pCAST-BursGal4DBD | Luan et al. (2012) (doi: 10.1523/JNEUROSCI.3707–11.2012) | ||
| Recombinant DNA reagent | pBS-KS-attB-SA-SD-0- T2A-P65AD vector | Diao et al. (2015) (doi: 10.1016/j.celrep.2015.01.059) | ||
| Recombinant DNA reagent | pBS-KS-ETHRMI00949- T2A-p65AD in 4B | This paper | See Supplementary file 1 | |
| Sequence-based reagent | guide RNA oligos for Rk gene: ttcgTAAGTGAACCTTCAATGTCT; aaacAGACATTGAAGGTTCACTTA | Integrated DNA Technologies, Inc. | N/A | |
| Sequence-based reagent | PCR primers for Rk left homology arm: acccaccggaccggtgcatgCAAC CTCGACCCTTCAGTTCC; GACCTGGGGCGGCCGCG ctagacattgaaggttcacttac; | Integrated DNA Technologies, Inc. | N/A | |
| Sequence-based reagent | PCR primers for Rk right homology arm: cctgggggcgcgccggtacGGTA ATATTACATTAATTATTCTAAC; GAACCTCCCCACTAGTG gagaaagggattgcagcaac; | Integrated DNA Technologies, Inc. | N/A | |
| Sequence-based reagent | Drosophilized LexA::VP16AD construct | Epoch Life Science, Inc. | N/A | |
| Sequence-based reagent | PCR primers for T2A-P65AD forward: cgcgccagcaagatcgaggg ccgcggcagcctg PCR primers for T2A-P65AD reverse: atgggattcagatcttta cttgccgccgcccag | Integrated DNA Technologies, Inc. | N/A | |
| Peptide, recombinant protein | Ecdysis Triggering Hormone 1 (ETH1) | GenScript | P11731308 | |
| Commercial assay or kit | ||||
| Chemical compound, drug | Alexa Fluor 594 Phalloidin | ThermoFisher, Scientific | A12381 | |
| Chemical compound, drug | ATP | Sigma | A9187 | |
| Software, algorithm | PhaseFinder | This paper | https://github.com/BenjaminHWhite/PhaseFinder | Detects pupal ecdysis Phases in Ca++ activity records |
Additional files
-
Supplementary file 1
Fly genotypes used listed by figure.
- https://doi.org/10.7554/eLife.29797.023
-
Supplementary file 2
Sequences of DNA constructs used to make ETHRB-p65AD and Burs-LexA::VP16AD lines.
- https://doi.org/10.7554/eLife.29797.024
-
Transparent reporting form
- https://doi.org/10.7554/eLife.29797.025
