Abstract
Several human diseases are associated with a lack of caveolae. Yet, the functions of caveolae and the molecular mechanisms critical for shaping them still are debated. We show that muscle cells of syndapin III KO mice show severe reductions of caveolae reminiscent of human caveolinopathies. Yet, different from other mouse models, the levels of the plasma membrane-associated caveolar coat proteins caveolin3 and cavin1 were both not reduced upon syndapin III KO. This allowed for dissecting bona fide caveolar functions from those supported by mere caveolin presence and also demonstrated that neither caveolin3 nor caveolin3 and cavin1 are sufficient to form caveolae. The membrane-shaping protein syndapin III is crucial for caveolar invagination and KO rendered the cells sensitive to membrane tensions. Consistent with this physiological role of caveolae in counterpoising membrane tensions, syndapin III KO skeletal muscles showed pathological parameters upon physical exercise that are also found in CAVEOLIN3 mutation-associated muscle diseases.
https://doi.org/10.7554/eLife.29854.001Introduction
Caveolae - uniform plasma membrane invaginations with ~70 nm diameter - were first described more than 60 years ago (Yamada, 1955). Yet, their functions are still matter of debate. For decades, they were considered as membrane trafficking compartments. More recent data suggested that caveolae may rather represent signaling platforms and/or mechanosensors (Nassoy and Lamaze, 2012; Parton and del Pozo, 2013; Shvets et al., 2014; Cheng and Nichols, 2016).
A main structural component of caveolar coats in muscles is caveolin3 (cav3). CAV3 mutations manifest in several human diseases, for example limb girdle muscular dystrophy (LGMD), rippling muscle disease (RMD), hyperCK(creatine kinase)emia, distal myopathy, hypertrophic cardiomyopathy, arrhythmogenic-long-QT syndrome and sudden-infant-death syndrome. Most patients with CAV3 mutations are heterozygous and the pathophysiology seems to be caused by the mutated protein acting dominant-negatively on WT-cav3 via self-association (Gazzerro et al., 2010). Consistently, also overexpression of dominant-negative mutants in mice caused symptoms resembling hypertrophic cardiomyopathy (Ohsawa et al., 2004).
Cav3 KO led to a lack of caveolae, size variability of muscle fibers and cases of necrosis considered as signs of muscle dystrophy (Hagiwara et al., 2000; Galbiati et al., 2001). Cav3 KO hearts were unaltered in one study (Galbiati et al., 2001), whereas another reported heart hypertrophy and dilation (Woodman et al., 2002). In zebrafish, cav3 knock-down caused notochord and myoblast fusion defects and impaired movement (Nixon et al., 2005). Cav3 interacts with a variety of signaling components and may also have roles in energy metabolism. It is therefore unclear whether the broad effects of CAV3 deficiency reflected by the different diseases and the in part contradictory effects of cav3 mutants are caused by aberrant signaling or caveolar dysfunctions. Similar limitations hampered the interpretations of cav1 analyses (Gazzerro et al., 2010; Le Lay and Kurzchalia, 2005).
Additionally, a variety of examinations of human mutations argue against simple correlations of caveolin availability and disease phenotypes or against simply correlating caveolae numbers and clinical symptoms. Patients with heterozygous V57M exchange showed hyperCKemia, yet, cav3 levels only were reduced by 62% (Alias et al., 2004). The heterozygous disease mutations CAV3 P28L and R27E did not lead to any significant reduction in caveolae density in quantitative electron microscopical analyses of patient biopsies (Timmel et al., 2015). Even in LGMD-1C patients with the severest cases of CAV3 missense mutations known (63TFT65del and P104L) showing full clinical symptoms, caveolae formation was not fully abolished but 7 or 24% of WT remained, as judged from the representative images presented (Minetti et al., 1998; Minetti et al., 2002).
Furthermore, the observation that the same CAV3 mutation can lead to different clinical phenotypes suggests additional, maybe indirect mechanisms (Fischer et al., 2003). Extensive quantitative analyses demonstrated that major portions of both of the endogenous non-muscle caveolins, cav1 and cav2, were not located at deeply invaginated classical caveolar profiles (Fujimoto et al., 2000). It thus seems possible that some CAV phenotypes may be linked to caveolins acting as membrane-associated scaffolds rather than to caveolae as such. Apart from such putatively distinct functions of caveolin, cav1-caveolar invaginations were highlighted as membrane tension buffers in a recent seminal paper (Sinha et al., 2011). Further, most recent papers support this view (Lo et al., 2015; Cheng et al., 2015).
Thus far, however, it has been impossible to clearly distinguish caveolin and caveolar functions. Caveolin-deficiencies obviously are unable to distinguish between these possibilities, as they lack both invaginated caveolae and caveolins (Hansen and Nichols, 2010; Nassoy and Lamaze, 2012; Parton and del Pozo, 2013; Shvets et al., 2014; Cheng and Nichols, 2016). Unfortunately, the same is true for deficiency of CAVIN-1, a caveolae-associated protein, which forms a flexible, net-like protein mesh around caveolin complexes (Stoeber et al., 2016) and has been introduced as factor critical for caveolae formation and function. CAVIN-1 KO phenotypically mimicked caveolin deficiency merely due to a concomitant, massive decrease of caveolin protein levels (Hill et al., 2008; Liu and Pilch, 2008; Liu et al., 2008).
We here describe that KO of syndapin III (also called PACSIN3), which encodes for the muscle-enriched isoform of the syndapin family of F-BAR proteins (Kessels and Qualmann, 2004; Qualmann et al., 2011), impairs caveolar invagination without affecting cav3 plasma membrane levels. This represents the desired possibility to dissect the physiological importance of caveolae from that of cav3 and to thereby reveal the cell biological and physiological functions of caveolar invaginations by comparing the syndapin III KO phenotypes to those attributed to cav3 deficiency. Our analyses unveil that - whereas some, mostly cardiac caveolinopathy phenotypes seem unrelated to impairments of caveolar invagination – in particular cellular integrity under strong mechanical stress was significantly affected in syndapin III KO muscles. Under physical exercise, failure to invaginate caveolae using the membrane-shaping protein syndapin III coincided with a widened caliber spectrum, detached nuclei and signs of inflammation and necrosis. This pathophysiology in syndapin III KO muscles is reminiscent of human myopathies associated with CAV3 mutation. Thus, syndapin III is crucial for caveolar invagination and thereby highlights that the physiological function of cav3-coated caveolae is to preserve muscle cell integrity upon acute membrane tensions, as they occur during physical exercise.
Results
Generation of syndapin III KO mice
Caveolins are required for caveolae formation. Bacterial reconstitutions, furthermore, suggested that caveolins also were sufficient for caveolar invagination (Walser et al., 2012). In this case, discrimination between caveolin and bona fide caveolar functions would be impossible. Recent observations, however, suggested that it might nevertheless be possible to unveil specifically the functions of caveolar invaginations. RNAi against the F-BAR protein syndapin II led to a reduction of deeply invaginated caveolae without affecting the presence of endogenous cav1 at the plasma membrane of NIH3T3 cells (Koch et al., 2012) and to increased levels of overexpressed cav1 in the TIRF-zone of HeLa cells (Hansen et al., 2011), respectively.
Toward addressing the role of caveolar invaginations in the various diseases associated with CAV3 mutations, we therefore studied the muscle-enriched member of the syndapin family (Kessels and Qualmann, 2004; Qualmann et al., 2011), syndapin III (Figure 1a), by generating syndapin III KO mice. The Cre/lox system was used to delete exons 5 and 6 leading to a premature stop. A mouse line lacking syndapin III was obtained via mating with constitutively and ubiquitously Cre recombinase-expressing mice (Figure 1b).

Generation of syndapin III KO mice.
(a) Murine syndapin III domain structure and putative remaining peptide upon syndapin III exon 5 and 6 deletion. (b) Generation of syndapin III KO mice. Scheme of the syndapin III gene comprising 11 exons (coding exon parts in black) and of targeting vector and strategy of Southern blot analyses. Homologous recombination (homologous regions in dark grey and black) resulted in floxed exons 5 and 6. (c–e) Merges of MIPs of NIH3T3 cells transfected with GFP (c), GFP-syndapin III1-70 peptide (putatively remaining upon KO; composed of aa1-70 of syndapin III and five unrelated aa resulting from the frameshift caused by exon 5,6 deletion) (d) and GFP-syndapin III F-BAR (e), respectively. Cotransfected plasma membrane-targeted mCherry (mCherryF) served as internal control for a membrane-bound protein. In (e), the GFP channel of a GFP-syndapin III F-BAR-transfected cell is shown in addition to the merge to visualize the tubular structures induced by syndapin III F-BAR. The inset in (e) shows an enlargement of the boxed area. Bars, 10 µm. For enlarged images see Figure 1—figure supplement 1. (f–h) Immunoblotting analyses of fractionations of transfected HEK293 cells showing that whereas plasma membrane-targeted mCherry (f–h, lower panel) and GFP-syndapin III F-BAR (h, upper panel) are readily detectable in the crude membrane fraction P2, both GFP and GFP-syndapin III1-70 are not (f,g, upper panels). (i) MIPs of NIH3T3 cells transfected with GFP-syndapin III F-BAR coexpressing mCherry-syndapin III1-70 showing undisturbed membrane localization, self-assembly and membrane tubulation abilities of GFP-syndapin III F-BAR. Bars, 10 µm. For enlarged images see Figure 1—figure supplement 2. (j) Southern blot analysis of exemplary ES cell clones (G10, transgenic; H7, WT). (k) Genotyping of the offspring of heterozygous mating identifies all possible genotypes. (l) Normal frequency of genotypes and genders of syndapin III KO mice. (m,n) RT-PCRs on heart (m) and skeletal muscle cDNA (n). (o) Immunoblottings of tissue homogenates (50 µg each) show the lack of syndapin III in KO tissues. GAPDH and β-actin, controls. (p–r) Immunofluorescence analyses of syndapin III and cav3 in transversal skeletal muscle sections from WT (p) and syndapin III KO mice (r) and quantitative colocalization analyses (q) in ROIs placed at plasma membrane (n = 240 ROIs from eight images) and intracellular areas (n = 160 ROIs from eight images) in confocal stacks of images of transversal sections of WT skeletal muscles. Data, mean ± SEM. Statistical significance, Mann-Whitney U test. Bars, 100 µm.
-
Figure 1—source data 1
This spreadsheet contains the data for all quantitative evaluations shown in the different panels of Figure 1 (i.e. of Figure 1l and q).
- https://doi.org/10.7554/eLife.29854.005
As schematically depicted in Figure 1a, any putative syndapin III translation product in the syndapin III KO line would be limited to a peptide comprising only the first 70 amino acids of syndapin III and five non-related amino acids. The anti-syndapin III isoform-specific antibodies raised against the non-F-BAR part of the protein (Koch et al., 2011) are not able to recognize such a putative peptide. Additional control examinations conducted clearly showed that the putative syndapin III1-70 peptide anyhow did not show any F-BAR domain functionalities, such as induction of membrane tubules (Figure 1c–e; Figure 1—figure supplement 1) and membrane binding (Figure 1f–h). Also, the putative syndapin III1-70 peptide did not interfere with key syndapin III F-BAR functions, as demonstrated by coexpression. GFP-syndapin III F-BAR still showed its normal distribution (Figure 1i; Figure 1—figure supplement 2). The observed lack of functionality is in line with the fact that such a putative peptide would only represent a minor fragment of the N-terminal F-BAR domain of syndapin III. Syndapin III exons 5,6 deletion thus leads to full syndapin III loss-of-function (Figure 1a–k).
Syndapin III KO mice were viable, developed without any obvious impairments and were fertile. Litter of heterozygous syndapin III KO mice showed normal Mendelian and gender distributions (Figure 1l). Analyses at both the mRNA and the protein level confirmed the successful KO of syndapin III (Figure 1m–o).
Furthermore, immunoblotting of tissue homogenates of WT and syndapin III KO mice firmly proved the specificity of the anti-syndapin III immunodetection. Anti-syndapin III immunoblotting exclusively detected syndapin III, as demonstrated by the lack of signal in syndapin III KO tissues (Figure 1o). Despite the fact that syndapin I and II also are expressed in some of the tissues analyzed (Kessels and Qualmann, 2004; Modregger et al., 2000), no further bands besides syndapin III were detected by the anti-syndapin III antibodies (Figure 1o).
Specific anti-syndapin III immunolabeling was also detected in immunofluorescence analyses of muscle tissues. Syndapin III KO tissues showed no anti-syndapin III immunodetections. Analyses of WT samples showed that syndapin III is enriched at the cav3-positive plasma membranes in sections of skeletal muscles (Figure 1p–r). Colocalization in transversal tissue sections hereby was very high at the plasma membrane (Pearson correlation coefficient 0.55 ± 0.01) and not existing at all in intracellular areas (Pearson correlation coefficient 0.08 ± 0.01), respectively (Figure 1q).
Syndapin III is crucial for invagination of cav3-coated caveolae
We next subjected primary cardiomyocytes from hearts of WT and syndapin III KO mice to fixation, thin sectioning and transmission electron microscopy (TEM). Cardiomyocytes from newborn WT pups showed plasma membrane areas with high frequencies of profiles resembling those of caveolae (Figure 2a,a’). In contrast, the plasma membranes of cardiomyocytes from syndapin III KO mice largely lacked deeply invaginated structures (Figure 2b,b’).

Syndapin III KO leads to a loss of plasma membrane invaginations with caveolar morphology.
(a–b’) TEM of 50 nm sections of chemically fixed primary cardiomyocytes isolated from WT (a,a’) and syndapin III KO mice (b,b’), respectively. Marked are deep membrane invaginations hit by the orientation of the section in a way that they can be recognized as caveolar profiles (black arrows), deep invaginations with (often due to non-perpendicular sectioning) unclear opening (arrows with question marks) and more shallow membrane indentations of unclear nature (arrowheads). Note that syndapin III KO membrane stretches (b,b’) have fewer invaginations. Bars, 100 nm. (c) Quantitative analyses of plasma membrane stretches for the presence and frequency of deeply invaginated profiles with caveolar appearance corresponding to structures in images marked with arrows. Data, mean ± SEM. Statistical significance, two-tailed Student’s t test. WT, eight membrane stretches; KO, 13 membrane stretches from different cells. (d) Immunoblotting analyses of tissue homogenates from WT and syndapin III KO mice with anti-syndapin I antibodies show expression of syndapin I only in the brain but no ectopic expression in heart or skeletal muscles of syndapin III KO mice. 40 µg protein each was loaded per lane. Anti-GAPDH signals served as controls. (e–h) Quantitative western blot analyses of homogenates of hearts (e,f) and skeletal muscles (g,h) from WT and syndapin III KO mice addressing putative changes of syndapin II expression levels. Data, mean ± SEM. n = 12 each. (i) Schematic 3D-view onto a membrane field with caveolae, shallow circular indentations, a longitudinal indentation and orientations of putative random sections (colored) leading to non-representative and often unclear image data calling for views onto wide fields of membrane and 3D-information to ensure more reliable quantitative analyses.
-
Figure 2—source data 1
This spreadsheet contains the data for all quantitative evaluations shown in the different panels of Figure 2 (i.e. of Figure 2c,f and h).
- https://doi.org/10.7554/eLife.29854.007
Quantitative analyses of plasma membrane stretches from these sections suggested that indeed deeply invaginated membrane profiles with caveolar appearance were largely absent from syndapin III KO cardiomyocytes. WT membranes showed about 2 caveolae/µm membrane stretch. Syndapin III KO mice displayed 0.29 caveolae/µm, that is only 15% of WT (Figure 2c).
Immunoblottings with anti-syndapin I antibodies demonstrated that the crucial role of syndapin III in membrane invagination was not compensated for by ectopic expression of the mostly neuronal syndapin I (Qualmann et al., 1999) in heart or skeletal muscles (Figure 2d). Quantitative western blotting analyses of syndapin II showed that also the expression levels of the more ubiquitously expressed syndapin family member, syndapin II (Qualmann and Kelly, 2000), remained unchanged in both heart and skeletal muscles (Figure 2e–h). Thus, the identified syndapin III KO phenotype specifically and exclusively reflected a loss of the functions of syndapin III and not of other members of the syndapin family.
Thin sectioning of fixed cells is a standard technique, but we were concerned that several caveats of this classical method may compromise our data. First, lipids cannot be fixed well chemically and caveolae are known to be induced, morphologically changed and/or promoted by chemical fixation (Severs, 1988) shedding doubt on the numbers and caveolar morphologies we obtained using chemically fixed samples. Second, the membrane profiles we observed were not always clearly identifiable as caveolae. Therefore, especially in WT samples, many of them had to be excluded from the quantitation (Figure 2a,a’; question marks). Unambiguous identification of caveolar structures would require 3D-information and immunolabeling. However, even serial sectioning using 50 nm thin sections and 3D-reconstruction would fail to provide reliable 3D-information on 70-nm wide structures. Furthermore, immunolabeling of thin sections is inefficient, as only the section surfaces are accessible for immunodetection. Indeed, even in cases of exceptionally high labeling efficiencies reported, anti-caveolin immunolabeling of sections with caveolae selected for superimposition analyses only reached an average of 2.5 gold particles/caveola (Ludwig et al., 2013). Unlabeled caveolae would severely compromise our quantitative analyses. Third, even if caveolae are efficiently recognized, quantitative analyses of membrane topologies would be restricted to areas defined by the length of a membrane segment multiplied by the thickness of the ultrathin section (50 nm), that is would merely represent 0.05 µm2 area per µm membrane stretch evaluated (Figure 2i, colored lines). Furthermore, we noticed WT plasma membrane stretches without any caveolar profiles, whereas others showed accumulations (Figure 2a,a’). Caveolar frequency thus also largely depends on the random orientation of sections in relation to caveolae-enriched regions (Figure 2i).
In order to i) preserve membrane topologies by rapid freezing, ii) image perpendicular views of large plasma membrane fields, iii) obtain 3D-information and iv) be able to probe wide areas of the plasma membrane with antibodies, we therefore established immunogold labeling protocols for freeze-fractured primary cardiomyocytes. The P-halves of the fractured membranes provide full antibody access to the entire cytosolic membrane surface (P-face). Labeling densities can thus reach high values. This will ensure the identification of most caveolar membrane profiles as caveolae. The cooling rates used exceeded 4000 K/s, that is membrane topologies were preserved within milliseconds, whereas chemical fixation takes minutes, that is >100,000 times longer. TEM analyses of such membranes provided perpendicular views onto large membrane fields and rotation shadowing provided 3D-information (Figure 3a,b).

Syndapin III KO leads to impairments in the formation of cav3-coated caveolae.
(a,b) Details of wide-field TEM images of anti-syndapin III immunogold-labeled P-faces of freeze-fractured plasma membranes of cardiomyocytes (CDMC) from WT (a) and syndapin III KO mice (b). (c) Blinded, quantitative evaluations of the anti-syndapin III labeling distribution on full areas of freeze-fractured membranes. (a–c) WT, 15.8 µm2 from 20 images; KO, 27 µm2 from 20 images (two independent cardiomyocyte preparations each pooled from two animals/genotype). (d-i’) Electron micrographs of coimmunolabeled control surfaces (d,e) and P-faces of WT (h,h’,h’’; for the picture, from which the details in h’ and h’’ were taken, see Figure 3—figure supplement 1) and syndapin III KO cells (i,i’) as well as blinded quantitative evaluations of labeling densities (f,g; n = 20 images each condition) demonstrating the specificity of the labelings at the P-face of WT cardiomyocytes. Syndapin III (15 nm gold, red labels) is present at caveolae highlighted by anti-cav3 labeling (10 nm gold, blue labels). Labelings at caveolae are marked by black arrows, at shallow indentations by grey arrows and at flat membrane areas by grey arrowheads. Bars, 100 nm. For non-color-marked EM micrographs see Figure 3—figure supplement 2. (j) Analyses of the fractions of caveolae-like profiles (deep and shallow) and of non-caveolar invaginations that were either unlabeled or labeled for cav3, syndapin III and both, respectively (n = 92 WT invaginations). (k,l) Blinded quantitative analyses of the relative densities of caveolae (deep, 70 nm in diameter invaginations formally confirmed as caveolae by anti-cav3 labeling) (k), and of shallow indentations (l), which also were anti-cav3-positive. n = 20 images each; in total, 132 cav3-positive structures were scored. (m) Densities of the (rare) non-caveolar invaginations in WT and syndapin III KO cardiomyocytes (due to the low abundance of such structures (n = 8), n.s.). (n–p) Quantitative analyses of anti-cav3 immunogold labels at deep caveolar invaginations (n; highly significantly decreasing in accordance with the reduced density of (cav3-marked) caveolae), in total (o; n.s) and within cav3 cluster ROIs (150 nm in diameter) (p; n.s.) at the plasma membrane of WT and syndapin III KO cardiomyocytes. (j-o) WT, 29.2 µm2 membrane from 20 images; KO, 35.6 µm2 from 20 images (two independent preparations of two animals each). In (p), 107 (KO) and 50 (WT) cav3 cluster ROIs (150 nm diameter,≥4 anti-cav3 immunogold labels) were analyzed. Data, mean ± SEM. Statistical significance, one-way Anova with Tukey’s post-test (f,g) and two-tailed Student’s t test (k–p), respectively. For further characterization of the primary cardiomyocyte cultures in respect of syndapin III, cav1, cav3 localizations and colocalizations and for phenotypical analyses of cav3 vs. cav1-positive cells see Figure 3—figure supplement 3.
-
Figure 3—source data 1
This spreadsheet contains the data for all quantitative evaluations shown in the different panels of Figure 3 (i.e. of Figure 3f,g,j–p).
- https://doi.org/10.7554/eLife.29854.012
P-faces of freeze-fractured membrane replica from WT and syndapin III KO mice showed specific anti-syndapin III immunogold labeling in WT samples. Specificity controls included incubations of E-faces, unrelated surfaces (ice areas) in the samples and syndapin III KO controls with primary and secondary antibodies evaluated quantitatively (Figure 3a–f).
Anti-syndapin III immunolabeling was largely associated with areas of membrane curvature (Figure 3a,b). Of all syndapin III immunolabels, 77% were associated with membrane invaginations (Figure 3c). The vast majority of them was of caveolar appearance, that is deeply invaginated, circular and uniform in diameter (about 60 nm), with bottoms lighter than the surrounding plasma membrane and dark shadows. The caveolar nature of the deeply invaginated structures was then formally proven by anti-syndapin III and cav3 double-immunogold labeling procedures (Figure 3d–i’; Figure 3—figure supplements 1 and 2). These analyses thus firmly proved that syndapin III and cav3 colocalized at caveolae of cardiomyocytes.
The immunolabelings of the freeze-fractured samples yielded high anti-cav3 labeling densities of in average 7.1 anti-cav3 labels/deeply invaginated caveola. This ensured the reliable identification of caveolar membrane profiles as caveolar structures independently of their morphology and interestingly unveiled that also circular, shallow indentations showed colocalizations of cav3 and syndapin III. They showed bottoms with the same grey value as the plasma membrane, an only light shadow and an estimated depth of only ~10 nm. Additionally, some cav3 clusters and colocalized syndapin III were also found at completely flat membrane topologies (Figure 3h’,h’’; grey arrows; Figure 3—figure supplements 1 and 2).
Quantitative analyses showed that 58% of all observed invaginations were anti-syndapin III-labeled caveolae-like invaginations (deep and shallow) with 35% being colabeled for cav3 and syndapin III (Figure 3j).
Strikingly, scoring extended membrane areas (64.8 µm2 in total) unveiled that whereas the density of shallow cav3-immunopositive indentations was unchanged, specifically the density of cav3-marked, deep invaginations – that is classical caveolae - was severely reduced in syndapin III KO cardiomyocytes when compared to cardiomyocytes prepared from WT mice (Figure 3i,i’,k,l; Figure 3—figure supplement 2). This low density of caveolae observed in cardiomyocytes isolated from syndapin III KO mice corresponded well to the reduced caveolae numbers seen in many human caveolinopathies.
In contrast to caveolae, non-caveolar invaginations were rare (Figure 3j) and their densities were not statistically significantly changed upon syndapin III KO (Figure 3m).
Analyses of the distribution of cav3 showed that cav3 at deeply invaginated caveolae decreased in accordance to the reduction of deeply invaginated caveolae upon syndapin III KO (Figure 3n). Interestingly, however, even with far less abundant caveolae, the cav3 immunolabeling at the plasma membrane still persisted upon syndapin III KO (Figure 3i,i’; Figure 3—figure supplement 2). The overall anti-cav3 immunolabeling density at the plasma membrane of WT and syndapin III KO cardiomyocytes remained about the same (Figure 3o).
Furthermore, the anti-cav3 immunolabeling also largely remained clustered in syndapin III KO cells despite the fact that caveolar invagination was impaired (Figure 3i,i’; Figure 3—figure supplement 2). The density of the cav3 labeling within ROIs of 150 nm diameter covering caveolae as well as cav3 clusters at shallow or flat membranes also was unchanged in syndapin III KO cells when compared to WT cells (Figure 3p).
Taken together, the lack of deep caveolar invaginations in syndapin III KO cardiomyocytes was not a consequence of a lack of cav3 at the plasma membrane but strongly suggested a crucial role of syndapin III in the invaginating process of cav3-coated caveolae.
Importantly, syndapin III KO specifically resulted in a loss of invaginated cav3-positive caveolae. This specificity for cav3 caveolae coincided with an overlap of syndapin III with cav3 but not with cav1 in immunohistological and EM analyses (Figure 3—figure supplement 3a,b). Likewise, cav3 showed no overlap with cav1 (Figure 3—figure supplement 3c-f). This argued for a differential expression of cav3 and syndapin III in muscle and cav1 in non-muscle cells. Consistently, cav1-coated caveolae found in the primary cell cultures were unaffected by syndapin III KO, that is were invaginated normally (Figure 3—figure supplement 3f). It can therefore be firmly concluded that syndapin III is important specifically for invagination of cav3-coated caveolae found in muscle cells.
Impairment of caveolar invagination upon syndapin III KO does not lead to dissociation of CAVIN-1 from the plasma membrane and reveals that cav3 and CAVIN-1 are not sufficient for caveolae formation
CAVIN-1 forms a flexible, net-like protein mesh around caveolin complexes (Stoeber et al., 2016) and has been introduced as factor critical for caveolae formation (Hill et al., 2008; Liu and Pilch, 2008; Liu et al., 2008). Thus, we next evaluated whether the striking reduction of caveolar invaginations upon syndapin III KO may just be an indirect effect caused by some loss of CAVIN-1 function. Quantitative western blot analyses, however, demonstrated that the expression levels of CAVIN-1 were unchanged in both hearts and skeletal muscles of syndapin III KO mice (Figure 4a,b). Also, the expression of the other CAVIN proteins (Cheng et al., 2015) as well as that of the non-muscle caveolin, cav1, was unchanged (Figure 4c–f).

Impairment of caveolar invagination by syndapin III KO does not lead to dissociation of CAVIN-1 from the plasma membrane.
(a,b) Quantitative western blot analyses of homogenates of hearts and skeletal muscles from WT and syndapin III KO mice showing that the levels of the important cav3 coat component CAVIN-1 are unaffected. (c-f) Quantitative western blot analyses of homogenates of hearts (c,d) and skeletal muscles (e,f) from WT and syndapin III KO mice addressing components suggested to play roles in caveolae formation that may be redundant or related to the critical role of syndapin III in caveolar invagination (normalized to GAPDH). Data, mean ± SEM. N = 12 each genotype. (g,h) Electron micrographs of anti-CAVIN-1 immunogold labeling (green labels) of freeze-fractured cardiomyocytes isolated from WT (g) and syndapin III KO mice (h) (in combination with a low concentration immunolabeling of cav3 (blue labels) to prove that indeed a membrane of a (cav3-positive) cardiomyocyte is examined). Note that CAVIN-1’s membrane association and its ability to form clusters is not impaired in syndapin III KO cells. Examples of clustered labeling of CAVIN-1 at (cav3-positive) deeply invaginated caveolae are marked by black arrows, at shallow indentations by grey arrows and at flat membrane areas by grey arrowheads. For non-color-marked EM micrographs see Figure 4—figure supplement 1. Bars, 100 nm. (i,j) Quantitative analyses of the labeling densities in WT and syndapin III KO samples at the plasma membrane in general (i) and specifically within CAVIN-1 clusters (j). (k,l) Analyses of the density of CAVIN-1 clusters at the plasma membrane (k) and of the percent of clusters without cav3 signal in WT and syndapin III KO cardiomyocytes (l). Data, mean ± SEM. Twenty images each (i–l). Statistical analysis, unpaired Student’s t test.
-
Figure 4—source data 1
This spreadsheet contains the data for all quantitative evaluations shown in the different panels of Figure 4 (i.e. of Figure 4a,b,d,f,i,j,k and l).
- https://doi.org/10.7554/eLife.29854.015
To additionally firmly rule out that a lack of the important coat component CAVIN-1 at specifically the plasma membrane may cause the caveolar impairments observed, we next quantitatively visualized CAVIN-1 by immunolabeling of freeze-fractured syndapin III KO and WT cardiomyocytes. In WT cardiomyocytes, CAVIN-1 localized to deeply invaginated, shallowly invaginated and flat membrane areas. As expected, anti-CAVIN-1 immunogold signals were colocalized with the signals of anti-cav3 antibodies, which we used at low concentration to formally prove that the plasma membranes analyzed indeed correspond to cardiomyocytes and not to other cell types (Figure 4g; Figure 4—figure supplement 1).
Surprisingly, CAVIN-1’s membrane association, its ability to form clusters and its colocalization with cav3 seemed not to be impaired upon syndapin III KO (Figure 4h; Figure 4—figure supplement 1). These results were unexpected, as CAVIN-1 was suggested to dissociate from flattened membranes, as evaluated by immunofluorescence analyses of clusters of overexpressed CAVIN-1-mCherry fusion proteins in HeLa cells subjected to hypoosmotic shock (Sinha et al., 2011).
However, quantitative evaluations of our ultra-high-resolution imaging experiments clearly confirmed that CAVIN-1 levels at the plasma membrane were not reduced upon syndapin III KO and/or the presence of predominantly flat cav3 clusters caused by the loss of syndapin III. Instead, the CAVIN-1 density at the plasma membrane even moderately increased by about 30% (Figure 4i). The CAVIN-1 density within CAVIN-1 clusters rose accordingly (Figure 4j). Since also the density of CAVIN-1 clusters found was increased (Figure 4k), these increases of CAVIN-1 in clusters at syndapin III KO plasma membranes of cardiomyocytes obviously came at the expense of the disperse labeling. Many of these additional CAVIN-1 clusters at the plasma membrane, however, were negative for cav3 (Figure 4l).
Taken together, all of our examinations thus strongly suggest that the loss of cav3-caveolae can be specifically attributed to syndapin III loss-of-function. Our observations also unveiled that even a combination of cav3 and CAVIN-1 residing at the plasma membrane is insufficient for caveolar invagination, if syndapin III is lacking.
Syndapin III shapes liposomes into tubules with caveolar diameters and localizes to the rim of cav3 coats
To shed light on the mechanisms, by which syndapin III may shape the plasma membrane into caveolar invaginations, two important questions needed to be addressed: Does syndapin III have the ability to generate membrane curvatures that resemble the 70 nm diameters of caveolae? And if so, would syndapin III integrate everywhere into the cav3 coat to control its topology or rather act as a locally restricted curvature-inducer? The first question seemed critical, as in vitro-reconstitutions with liposomes analyzed by negative-staining procedures suggested that a fragment of syndapin III can induce membrane curvatures but the diameters were very invariant (around 110 nm [Bai et al., 2012]), that is they did not fit caveolar diameters. However, our analyses with full-length syndapin III using two different methods of evaluation, freeze-fracture/TEM as well as cryoTEM, showed that syndapin III had mechanistic properties in line with its caveolar localization and function. Both tagged and untagged full-length syndapin III formed tubules with an average diameter of about 80 nm (Figure 5a–e). The observed diameter range of 75–90 nm corresponded very well to the membrane topologies that were immuno-positive for syndapin III in vivo. Cav3-caveolae had diameters of 60–80 nm (Figure 3).

Syndapin III shapes liposomes into tubules with caveolar diameters and localizes to the rim of cav3 coats.
(a–c) Analyses of tubules induced by incubating liposomes with syndapin III (a,b) and GST (c), respectively, by freeze-fracturing/TEM (a) as well as by cryo-TEM (b,c). (d,e) Quantitative analyses of tubule diameter distributions (d) and averages of diameters (e) induced by syndapin III and GST-syndapin III, respectively. Data in (e), mean +SEM. (d,e) n= 50 (GST-syndapin III) and n = 38 (syndapin III) freeze-fractured tubuli. (f) High resolution, 80 kV top view of a deeply invaginated caveolar structure of a WT cardiomyocyte immunolabeled for syndapin III (15 nm gold) and cav3 (10 nm gold). Bar, 50 nm. (g,h) Corresponding 120 kV tomogram images (g) and views from a 3D-reconstruction (h) show that syndapin III is at the edge of the cav3 coat (34 caveolae analyzed; two full 3D-segmentations; invaginated membrane, green; immunogold labels cav3, yellow; syndapin III, red). Bars in f–h), 50 nm.
-
Figure 5—source data 1
This spreadsheet contains the data for all quantitative evaluations shown in the different panels of Figure 5 (i.e. of Figure 5d and e).
- https://doi.org/10.7554/eLife.29854.017
The fact that syndapin III seemed to prefer curvatures that are less than those observed for established cav3 coats suggested that syndapin III may not be an integral part of invaginated cav3 coats but may reside at areas that are about 10 nm wider. EM tomograms and 3D-segmentations of membrane topology in combination with the 3D-detection of immunogold labels indeed demonstrated that syndapin III was not found at the lateral walls or at the bottom of caveolar invaginations but was restricted to areas of membrane curvature transition from the caveolar invagination to the continuum of the plasma membrane (Figure 5f–h; Videos 1 and 2).
Electron tomogram data set of the caveolar invagination shown in Figure 5f,g.
Cav3 and syndapin III are indicated by the electron-dense gold particles (anti-syndapin III, 15 nm; anti-cav3, 10 nm). Reconstruction and tomographic sectioning carried out with IMOD software. Bar, 50 nm.
Rotation of the 3D segmentation of a syndapin III and cav3-coated caveolar invagination shown in Figure 5h.
Syndapin III is indicated by the red spheres and cav3 is indicated by the yellow spheres. The Pt/C layer of freeze-fractured cardiomyocyte plasma membrane is indicated (green). Segmentation carried out with IMOD software. Bar, 50 nm.
Syndapin III organizes cav3-coated caveolae and cav3-associated lipid domains
Coprecipitations from heart lysates confirmed that the syndapin III F-BAR-domain interacts with cav3 coats. Interestingly, similar to the caveolin coat component CAVIN-1 showing only weak – if any – interactions with caveolin (Hill et al., 2008; Liu and Pilch, 2008; Mohan et al., 2015), the interactions were rather weak and therefore suggested that syndapin III may not represent a general and integral part of cav3 coats (Figure 6a).

Syndapin III is involved in the organization of cav3-containing membrane domains.
(a) Coprecipitation of endogenous cav3 from heart lysates with the indicated immobilized GST-fusion proteins of syndapin III. (b,c) GFP-syndapin III F-BAR domain but not GFP clusters with cav3 at the membrane of primary cardiomyocytes. Boxed areas, higher magnification insets. Bars, 10 µm. (d–k) Syndapin III KO changes the biophysical properties of cav3-containing DRMs. Immunoblottings of cav3 and syndapin III (d–g) and proteins representing Golgi (GM130), cytosol (GAPDH), plasma membrane (IRTK) and ER (PDI) (j,k) in TritonX-100-resistant membrane preparations from heart and skeletal muscles from WT (d,e) and syndapin III KO mice (f,g,j,k). Quantitative analyses (h,i) demonstrate the shift of cav3-containing TritonX-100-resistant membranes from fractions F4 +F5 to F6 +F7 in heart (d,f,h) and from F3 +F4 to F5 +F6 in skeletal muscle (e,g,i) upon syndapin III KO. Hearts, n = 3 each genotype; skeletal muscles, n = 9 each genotype. Data, mean ± SEM. Statistical significances, two-way ANOVA and Bonferroni post-test. For individual comparisons of WT and KO fractions see Figure 6—figure supplement 1.
-
Figure 6—source data 1
This spreadsheet contains the data for all quantitative evaluations shown in the different panels of Figure 6 and of the corresponding Figure 6—figure supplement 1 (i.e. of Figure 6h and i and Figure 6—figure supplement 1a–d).
- https://doi.org/10.7554/eLife.29854.022
However, similar to syndapin II and cav1 in some cell lines (Koch et al., 2012; Senju et al., 2011), overexpression of the F-BAR-domain of syndapin III led to colocalization of endogenous cav3 at F-BAR-enriched sites at the plasma membrane of primary cardiomyocytes (Figure 6b,c). Syndapin III may thus modulate membrane topologies and thereby organize cav3 coats at muscle cell membranes.
Caveolae are associated with cholesterol-enriched lipid domains (Harder et al., 1997). Preparations of TritonX-100-resistant membranes (DRMs) demonstrated that cav3 and syndapin III both floated together (Figure 6d,e).
Interestingly, cav3 showed an altered distribution upon syndapin III KO (Figure 6f–i; Figure 6—figure supplement 1). In WT heart samples, syndapin III and cav3 floated to fraction F4+F5. Syndapin III KO fractions F4+F5 were devoid of cav3 but cav3 mainly floated to fractions F6+F7 (Figure 6d,f,h; Figure 6—figure supplement 1a,b). Related shifts of cav3 toward higher densities were observed for preparations from syndapin III KO skeletal muscles (Figure 6e,g,i; Figure 6—figure supplement 1c,d). These anti-cav3-immunopositive density gradient positions of syndapin III KO DRMs still were distinct from all other cellular compartments tested (Figure 6j,k).
Together, these data strongly suggest that syndapin III plays a critical role in organizing caveolar coats and associated lipid environments.
Dissecting the functions of caveolae from those of cav3
Caveolin KO analyses suggested that caveolae represent crucial signaling hubs (Hansen and Nichols, 2010). The physiological defects in caveolin-deficient mice may thus in part relate to the observed ERK1/2 hyperactivation rather than to the cellular functions of caveolar invaginations. Furthermore, cav3 KO was reported to impair lipid raft associations of the dystrophin-glycoprotein complex and to result in its loss (Woodman et al., 2002).
We therefore vigorously tested syndapin III KO mice for these phenotypes. Relative phosphoERK1/2 levels were not altered upon syndapin III KO (Figure 7a,b).

Not all described cav3 loss-of-function phenotypes are found upon syndapin III KO and may thus not reflect impairments of caveolar invagination.
(a,b) Quantitative immunoblot analyses of ERK1/2 and phosphoERK1/2 in heart homogenates of WT and syndapin III KO mice (normalized to WT) show no alteration of MAPK signaling (pERK1/2/ERK1/2 signals). Data represent mean ± SEM; n = 12 each. (c–f) Unchanged subcellular localization of both dystrophin and β-dystroglycan in sections of skeletal muscles from syndapin III KO mice. Bars, 50 µm. (g–j) Levels of dystrophin and β-dystroglycan are unchanged in heart and skeletal muscle homogenates upon syndapin III KO (normalized to WT). Data represent mean ± SEM; n = 12 each.
-
Figure 7—source data 1
This spreadsheet contains the data for all quantitative evaluations shown in the different panels of Figure 7 (i.e. of Figure 7b,h and j).
- https://doi.org/10.7554/eLife.29854.024
Dystrophin impairments were not observed either. No localization defects of dystrophin and β-dystroglycan could be detected in sections of skeletal muscles from syndapin III KO mice (Figure 7c–f). Also dystrophin and β-dystroglycan expression levels were unaltered upon syndapin III KO in both heart and skeletal muscle (Figure 7g–j).
Syndapin III-mediated caveolar invagination counterpoises mechanical stress and thereby ensures cellular integrity
Increases of membrane tension, as mimicked by applying hypoosmotic stress, led to fewer GFP-cav1-coated caveolae in HeLa and MLEC cells (Sinha et al., 2011). Our TEM analyses of freeze-fractured NIH3T3 cells, which we labeled for cav1 (in average 13.9 anti-cav1 labels/caveola (iso)), confirm that the immediate cell response to increased membrane tensions induced by hypoosmotic conditions is a reduction of caveolar invaginations (Figure 8—figure supplement 1a–d). In NIH3T3 cells, cav1 hereby remained at the plasma membrane (Figure 8—figure supplement 1e–h). These data strongly support a role of caveolae as mechanosensors buffering mechanical stress.
The observed counteractions do not just reflect abilities of cav1-expressing transformed, immortal cell lines, such as HeLa, MLEC (Sinha et al., 2011) or NIH3T3 (this study) but primary mouse cardiomyocytes showed a similar behavior. The induced mechanical stress dramatically reduced deeply invaginated, cav3-positive structures (−75%) (Figure 8a–d). Again, the anti-cav3 labeling density at the plasma membrane remained constant upon hypoosmotic flattening of caveolae (Figure 8e). The distribution of cav3 changed in accordance with the flattened membrane topology (Figure 8f–h).

Syndapin III-mediated caveolar invagination counterpoises membrane tensions and thereby ensures cell integrity.
(a,b) Anti-cav3-labeled P-faces of freeze-fractured plasma membranes of cardiomyocytes from WT mice incubated for 5 min in isoosmotic (iso) (a) and hypoosmotic conditions (hypo; hypo15 buffer) (b). Bars, 200 nm. (c,d) A dramatic reduction of deeply invaginated caveolar structures was observed upon the induced, cell swelling-mediated rise in membrane tension caused by hypo conditions. (e–h) Quantitation of the anti-cav3 labeling distribution in total and in relations to deeply invaginated, shallow and flat membrane topologies (relative to isoosmotic condition). Data (c–h), mean ± SEM. iso, 148.8 µm2 membrane area from 43 images, 251 caveolar invaginations; hypo, 124.6 µm2 membrane area from 36 images, 66 caveolar invaginations, two independent cardiomyocyte preparations and assays. Statistical significance, two-tailed Student’s t test. For related examinations of caveolar flattening upon induction of membrane tensions in NIH3T3 cells please see Figure 8—figure supplement 1. (i–o) Trypan Blue assays with WT (i–k) and syndapin III KO cardiomyocytes (l–n) subjected to membrane tensions mimicked by mild hypoosmotic stress (5 min hypo30; j,m) and stronger hypoosmotic stress (5 min hypo15; k,n) unveiling a higher vulnerability of syndapin III KO cells under conditions increasing membrane tensions. Note the increased abundancy of Trypan Blue-positive, ruptured cardiomyocytes upon hypoosmotic stress. Bar in n (for i–n), 50 µm. (o) Quantitative data, mean ± SEM of 18 blinded experiments (about 100 cells each assay) from six independent preparations of cardiomyocytes/genotype. One-way Anova with Tukey’s post-test.
-
Figure 8—source data 1
This spreadsheet contains the data for all quantitative evaluations shown in the different panels of Figure 8 and of the corresponding Figure 8—figure supplement 1 (i.e. of Figure 8c–h and of the Figure 8—figure supplement 1c–h).
- https://doi.org/10.7554/eLife.29854.027
A function of caveolae in buffering mechanical stress leads to the prediction that a lack of invaginated caveolae will render myocytes vulnerable to abrupt changes of membrane tensions. To test this hypothesis experimentally in primary cells, we compared the structural integrity of WT and syndapin III KO cardiomyocytes under such conditions using Trypan Blue (Figure 8i–o). WT cells were able to fully cope with moderate stress (hypo30) and were only moderately affected by stronger hypoosmotic stress (hypo15) (Figure 8i–k,o). In contrast, syndapin III KO cardiomyocytes showed a significantly higher vulnerability under both conditions (Figure 8l–o).
Severe impairment of caveolar invagination has no obvious cardiac consequences
Interestingly, the inability of syndapin III KO mice to invaginate caveolae had no obvious consequences for heart function and integrity. Syndapin III KO mice were viable and heart sections of juvenile mice did not show any hypertrophic cardiac myocytes (Figure 9a–c). Heart weights (data not shown separately) and heart/body weight ratios were unaltered (Figure 9d,e). Left ventricle wall thickness also did not differ from WT (Figure 9f–h)

Impairment of caveolar invagination upon syndapin III KO in heart tissue has no consequences on cardiac integrity.
(a–c) Wheat germ agglutinin stainings of 8 µm cryosections of hearts of 20 weeks old syndapin III KO mice (b) show no signs of cellular damage or alteration of cross-sectional areas of cardiac myocytes when compared to WT (a). Bars, 50 µm. Quantitative data (c) represent mean ± SEM. WT, 273 cells, 6 animals; KO, 378 cells, 7 animals. Statistical significance was tested using two-tailed Student’s t test. p=0.7462 (n.s.). (d,e) Ratios (x1000) of heart and body weights of about 4-month-old female (d) and male (e) mice. WT, eight female and male mice each; KO, seven female and nine male mice. Statistical significance, two-tailed Student’s t test. Female mice, p=0.3132 (n.s.); male mice, p=0.1377 (n.s.). (f–h) H&E stainings of WT and syndapin III KO heart cryosections show no left ventricular wall thickening upon syndapin III KO. Bars, 500 µm. Quantitative data represent mean ± SEM. WT, seven animals; KO, nine animals. Statistical significance, two-tailed Student’s t test. p=0.9451 (n.s.). (i–l) H&E stainings of paraffin sections of aged WT and syndapin III KO myocard (three animals each) display no signs of cellular damage or of necrosis irrespective of whether mice were trained or not. Bar, 50 µm. (m,n) Details of wide-field views of P-faces of freeze-fractured heart tissues double-immunogold labeled for cav3 and syndapin III. Note that, also in heart tissue, the formation of caveolae is impaired upon syndapin III KO. In WT, syndapin III and cav3-immunopositive caveolae are marked (long black arrows; shallow, cav3-positive indentation, short grey arrow). Bar, 100 nm. (o,p) Quantitative determinations of caveolae (o) and of shallow, cav3-positive membrane indentations (p) in WT and syndapin III KO hearts. (q) Quantitative assessment of the anti-cav3 labeling densities at membranes of freeze-fractured syndapin III KO hearts relative to WT (n.s.). (r) Quantitative western blotting of TritonX-100-resistant membrane fractions from WT and syndapin III KO hearts showing unchanged cav3 levels. 25 µg protein loaded each. n = 6 each genotype. (s,t) Quantitative assessment of the cav3 immunolabeling at caveolae (s) and shallow indentations (t). Note that the observed decreases are in accordance with the reduced abundance of these structures (compare s,t) vs. (o,p). (o–q, s,t) WT, 72.7 µm2 membrane from 21 images; KO, 72.7 µm2 membrane from 21 images from two independent cardiomyocyte preparations (from two hearts) each genotype. In total, 107 cav3-positive structures scored. Data, mean ± SEM. Statistical significance, two-tailed Student’s t test.
-
Figure 9—source data 1
This spreadsheet contains the data for all quantitative evaluations shown in the different panels of Figure 9 (i.e. of Figure 9c–e,h and o–t).
- https://doi.org/10.7554/eLife.29854.029
Even at >64 weeks of age, sections of syndapin III KO hearts did not show signs of cardiomyocyte hypertrophy or necrosis. Physical exercise-induced necrosis was not detectable either (Figure 9i–l).
These data raised the questions whether i) the impairment of caveolar invagination upon syndapin III KO merely is a phenomenon of dissociated cells or whether ii) caveolar compensation of membrane tensions, as mimicked by hypoosmotic stress in cell lines (Sinha et al., 2011) (Figure 8—figure supplement 1) and in primary cardiomyocytes (Figure 8a–h), is physiologically irrelevant. It was therefore required to confirm or dismiss impairments of caveolar invagination upon syndapin III KO at the tissue level.
In line with our data in primary cardiomyocytes (Figures 2 and 3), we observed almost no caveolar profiles in sections of fixed syndapin III KO tissue subjected to TEM (our unpublished results). To again circumvent the technical caveats of quantitative analyses using this conventional method, we established freeze-fracturing and immunolabeling procedures for muscle tissues. Our analyses of freeze-fractured and immunolabeled syndapin III KO hearts clearly demonstrated that, also in the tissue context, caveolar invagination was severely impaired (Figure 9m,n). Quantitative analyses showed that the effects even were slightly stronger than in dissociated cells. Upon syndapin III KO, only 11.7% of the caveolae found in WT remained. Even the density of the shallow, cav3-positive indentations was significantly decreased in syndapin III KO hearts (Figure 9o,p).
Consistent with the observations in dissociated cells, the anti-cav3 labeling density at membranes of freeze-fractured syndapin III KO hearts in total remained unchanged (Figure 9q). The unchanged presence of cav3 at the membrane was in line with unchanged cav3 levels in TritonX-100-resistant membrane fractions from heart observed by quantitative western blotting (Figure 9r). In accordance with the reduced densities of caveolae and cav3-positive indentations, cav3 labeling at deep and shallowly invaginated caveolar structures was strongly decreased (Figure 9s,t).
We thus concluded that the syndapin III KO-mediated impairment of caveolar invagination is not limited to isolated, cultured cells but is also valid in hearts of syndapin III KO mice but not critical for this organ.
Impairments in caveolar invagination lead to human disease-related skeletal muscle defects
LGMD-1C, distal myopathy and RMD are degenerative, skeletal muscle-associated diseases associated with mutations in CAV3 (Gazzerro et al., 2010). Skeletal muscles subjected to freeze-fracturing and immunogold labeling procedures clearly showed that specific anti-syndapin III immunolabeling is present at caveolae of skeletal muscles (Figure 10a; compare Figure 10b). A significant portion of the caveolae found in muscle tissues were immunopositive for syndapin III (Figure 10c). Non-caveolar invaginations were very rare and their density did not show any significant change upon syndapin III KO (Figure 10c,d).

Syndapin III KO causes impairments in caveolar invagination in skeletal muscle.
(a,b) Double-immunogold labeled, freeze-fractured skeletal muscles of WT and syndapin III KO mice (syndapin III, 15 nm gold; cav3, 10 nm gold) show that caveolar invagination is impaired in tissues of syndapin III KO mice. Bar, 200 nm. (c) Analyses of the fractions of caveolar-like profiles (deep and shallow) and non-caveolar invaginations labeled for cav3, syndapin III and both in freeze-fractured muscles. In total, 291 invaginations from WT skeletal muscles were evaluated. (d) Densities of the (extremely rare) non-caveolar invaginations in WT and syndapin III KO cardiomyocytes (low abundance of such structures, in total only n = 2 (WT) and n = 3 (KO) found; n.s.). (e–j) Colocalization analyses based on confocal images of longitudinal sections of skeletal muscles immunostained for cav3 and syndapin III. (e,f) Example images. Encircled is a ROI for colocalization analyses at puncta (e); (f) shows magnification and (g) shows the corresponding Pearson correlation coefficient (n = 60 ROIs). (h–j) Quantitative analyses of anti-cav3 immunofluorescence signals at the plasma membrane ((h); n = 230 ROIs each genotype in transversal sections), in intracellular volumes ((i); n = 160 ROIs each genotype in transversal sections) and in cav3 puncta ((j); n = 60 each genotype in longitudinal sections). (k) Quantitative immunoblotting of TritonX-100-insoluble material showed no differences in cav3 and cav1 levels upon syndapin III KO. 25 µg protein loaded each. WT, 12 animals; KO, 12 animals. (l) Quantitative analyses of immunogold-labeled, freeze-fractured skeletal muscle fibers showing no difference in anti-cav3 labeling density between WT and syndapin III KO muscles at the plasma membrane. (m,n) Example of 3D surface rendering (using IMARIS) of confocal image stacks of the anti-cav3 immunolabeling shown in overview (e) for determination of the frequency of syndapin III-positive cav3 puncta. Yellow spheres, syndapin III-positive; white spheres, syndapin III-negative cav3 3D surface rendered puncta. (n) Quantitative analyses of the frequencies of spatial overlap of syndapin III with cav3 at the level of light microscopy (14 ROIs). (o,p) Quantitation of the densities of deep caveolae and shallow indentations in electron micrographs of freeze-fractured skeletal muscles show severe impairments of caveolar invagination in vivo. (q,r) The relative density (WT = 100%) of the anti-cav3 labeling associated with invaginated, caveolar membrane topologies of syndapin III KO muscle membranes changes in accordance with the reduced densities of invaginated caveolar structures. WT, 128 µm2 membrane from 37 images; KO, 69.2 µm2 membrane from 20 images from two muscle preparations. In total, 400 cav3-positive structures scored. (s,t) Analyses of the density of cav3 clusters at the plasma membrane of freeze-fractured skeletal muscle fibers (s) and of the anti-cav3 immunogold labeling density in cluster ROIs (t). Analyses in (s) were done by image and expressed as clusters/µm2 (Nassoy and Lamaze, 2012). n = 20 images each genotype. (t) n = 377 ROIs (WT) and 148 ROIs (KO). Data, mean ± SEM. Statistical significance, two-tailed Student’s t-test.
-
Figure 10—source data 1
This spreadsheet contains the data for all quantitative evaluations shown in the different panels of Figure 10 (i.e. of Figure 10c,d,g-l and n-t).
- https://doi.org/10.7554/eLife.29854.031
The presence of syndapin III at caveolae was corroborated by confocal microscopy analyses of longitudinal sections of skeletal muscle. Syndapin III clearly colocalized with cav3 puncta of different sizes and the Pearson correlation coefficient was clearly positive (Figure 10e–g).
Quantitative analyses of anti-cav3 immunofluorescence signals at the plasma membrane, intracellularly and in the cav3 puncta at the plasma membrane showed no differences between WT and syndapin III KO muscles (Figure 10h–j). Quantitative western blotting of TritonX-100-resistant membrane fractions from skeletal muscle were in line with the quantitative visual examinations and showed no difference between genotypes (Figure 10k). Also quantitative evaluations of EM images recorded from anti-cav3 immunostained freeze-fractured muscles showed that the amount of cav3 at the plasma membrane was not reduced upon syndapin III KO (Figure 10l).
3D rendering of confocal image stacks of longitudinally cut muscle fibers showed that 32% of all cav3 spheres were positive for syndapin III (Figure 10m,n). These data are somewhat reminiscent of an estimation of the syndapin II isoform (Pacsin2) being colocalized with about a third of cav1 clusters in HeLa cells (Hansen et al., 2011).
Yet, despite the fact that syndapin III is only found at a (albeit significant) fraction of caveolae at a given time and despite the undisturbed presence of cav3 at the plasma membrane, the density of deeply invaginated caveolae was dramatically reduced upon syndapin III KO (Figure 10o). Also the shallow, cav3-positive indentations were strongly reduced albeit not as dramatically as the deeply invaginated caveolae (Figure 10o,p).
The distribution of cav3 changed accordingly. The amount of cav3 at deep and shallow cav3-marked caveolar invaginations was strongly reduced (Figure 10q,r). Interestingly, cav3 clusters still persisted, that is cav3 did not largely disperse despite the flat membrane topologies and the lack of caveolae in syndapin III KO skeletal muscle fibers. Instead, freeze-fractured skeletal muscles from syndapin III KO mice still showed about 70% of the cav3 cluster density observed in WT muscles (Figure 10s) and the cav3 density within the persisting cav3 cluster ROIs only showed a minor reduction (−7%; Figure 10t). Taken together, syndapin III KO thus seems to moderately impair cav3 clustering but does not affect the cav3 abundance within the clusters that are formed and does not interfere with the presence of cav3 at the plasma membrane in general (Figure 10l).
Surprisingly, despite a relatively severe loss of deeply invaginated caveolae upon syndapin III KO, detailed pathomorphological examinations using for example acidic phosphatase, periodic acid-Schiff, Congo Red, ATPase, iron, lactate dehydrogenase and hematoxylin and eosin (H&E) stainings did not unveil any dramatic defects of syndapin III KO muscles (H&E, Figure 11a,b).

Syndapin III KO leads to skeletal muscle phenotypes reminiscent of clinical symptoms found in patients with myopathies associated with CAV3 mutation.
(a–f) Histological examinations of cryosections of musculus gastrocnemius from >64 weeks old WT and syndapin III KO mice (three animals each). Whereas no clear signs of cellular damage or disintegration were observed by H&E staining under untrained conditions (a,b), syndapin III KO mice displayed a higher frequency of detached nuclei upon training (c), arrows). (e,f) Acidic phosphatase stainings clearly demonstrate necrotic events (asterisks in c) and e). Bars, 50 µm. (g,h) Quantitative evaluations of the frequency of detached nuclei. (i,j) Percental distribution of fiber cross sectional areas (in 50 µm2 intervals) in WT and syndapin III KO muscles. Arrows highlight areas of the caliber spectra with striking differences (black, more frequent in syndapin III KO; grey, more frequent in WT). (k,l) Quantitation of the mean cross sectional areas of muscle fibers in trained and untrained mice of both genotypes. N-numbers (g–l), untrained WT, 849; untrained KO, 952; trained WT, 949; trained KO, 1244 fibers. Data, mean (i,j); error bars omitted for clarity) and mean ± SEM (g,h,k,l), respectively. Statistical significance, 2-tailed Student’s t-test.
H&E staining of sections of WT and syndapin III KO muscle fibers, however, revealed a sign of necrosis in one section from syndapin III KO muscles (our unpublished data). This minor indication for muscular defects in syndapin III KO mice and the fact that also some of the human CAV3-associated myopathies show relatively mild symptoms and late onset (Gazzerro et al., 2010), respectively, prompted us to next subject aged mice to physical exercises. Strikingly, we observed genotype-dependent signs of muscle damage. H&E stainings of musculus gastrocnemius cryosections from syndapin III KO mice subjected to physical exercise showed necrotic fibers invaded by immune cells as well as inflammation secondary to degeneration (Figure 11c–f; asterisk in Figure 11c). Acidic phosphatase analyses highlighting the lysosomal activity of immune cells proved that necrotic events occur in muscles of trained syndapin III KO mice (Figure 11e; asterisks). In contrast, irrespective of whether mice were trained or not, WT muscles did not display a single case of necrosis (Figure 11b,d,f).
Interestingly, syndapin III KO muscles were furthermore marked by a training-induced increase of detached nuclei. In humans, detached nuclei are a clear pathophysiological finding (Gazzerro et al., 2010). Whereas WT muscles did not show any increase in the frequency of detached nuclei upon training (about 1% in murine musculus gastrocnemius), detached nuclei were about three times more frequent in trained syndapin III KO muscles (Figure 11g,h).
Consistent with syndapin III KO-induced muscles defects, fine analyses of both untrained and trained syndapin III KO muscles showed altered caliber spectra (Figure 11i,j). Untrained syndapin III KO muscles showed an expansion of the caliber spectrum. Especially weakly established fibers showed a notable abundance in syndapin III KO mice (Figure 11i,k).
Interestingly, this increased abundance of fibers with only small cross-sections in syndapin III KO mice was compensated for by hypertrophy upon training (Figure 11i–l). This training-induced hypertrophy of syndapin III KO muscles, however, obviously was accompanied with increased rates of detached nuclei (Figure 11h) and of inflammation and necrosis (Figure 11e).
Thus, syndapin III KO-induced impairment of caveolar invagination was associated with observations reminiscent of the human skeletal muscle diseases linked to CAV3 mutation.
Discussion
Caveolae can be found in almost all body cells; yet, their functions still remain matter of debate. For decades, they were considered as endocytic structures. More recent data suggested that caveolae may represent signaling hubs or mechanosensing membrane reservoirs (Sinha et al., 2011). Model systems with caveolin-deficiency are unable to distinguish between these possibilities, as they lack both invaginated caveolae and caveolins (Hansen and Nichols, 2010; Nassoy and Lamaze, 2012; Parton and del Pozo, 2013; Shvets et al., 2014; Cheng and Nichols, 2016). Also KO of the caveolin-associated component CAVIN-1 merely mirrored cav1-deficiencies by leading to reduced caveolin levels (Hill et al., 2008; Liu and Pilch, 2008; Liu et al., 2008; Bastiani et al., 2009).
Dissecting the functions of caveolar invaginations from those of caveolins in vivo would require a situation, in which caveolins are maintained at the plasma membrane and nevertheless caveolar invaginations are severely impaired. This demand seemed impossible to meet, as overexpression experiments in bacteria suggested that caveolins are not only crucial but also sufficient for caveolae formation (Walser et al., 2012). Our quantitative analyses of syndapin III KO cardiomyocytes, heart and skeletal muscles show that syndapin III KO does not affect the presence of cav3 at the plasma membrane but specifically impaired caveolar invagination to an extent resembling the reductions of caveolae found in human patients with CAV3 mutations (Gazzerro et al., 2010; Alias et al., 2004; Timmel et al., 2015; Minetti et al., 1998; Minetti et al., 2002). These observations finally made it possible to dissect the functions of caveolae as cell biological structure from those of caveolin proteins at the plasma membrane and to thereby address the physiological relevance of caveolar invaginations at the whole animal level. Although it is a general limitation of all gene KO studies that phenotypes, such as those observed for cav3 or syndapin III KO at caveolae, formally never prove a direct involvement of the lacking protein at these sites, several lines of experimental data support the conclusion that the dramatic caveolar phenotypes we observed in syndapin III KO heart and muscle cells reflect a direct involvement of syndapin III in the underlying, required membrane shaping process. First, syndapin III colocalized with cav3-enriched membrane domains at the light microscopical level and at cav3-marked caveolae at the ultra-structural level, that is showed the localization required for caveolar function. Second, syndapin III interacts with cav3 in coprecipitation experiments and the syndapin III F-BAR domain enriched together with cav3 in distinct plasma membrane areas. Efficient subcellular recruitment of interaction partners to membranes has also been observed for other syndapin family members (Braun et al., 2005; Kessels and Qualmann, 2002; Schwintzer et al., 2011; Schneider et al., 2014; Hou et al., 2015). Third, syndapins associate with phosphatidylserine using their F-BAR-domains (Qualmann et al., 2011; Itoh et al., 2005; Dharmalingam et al., 2009) and caveolar microdomains are enriched for phosphatidylserine (Fairn et al., 2011). This suggests that syndapin III-mediated membrane associations and nanocluster formation (Schneider et al., 2014) may help to establish membrane domains promoting cav3 assembly. In support of this, syndapin III floated with cav3-enriched DRMs and syndapin III deficiency changed the biophysical properties of cav3-associated DRMs. Fourth, an active role of syndapin III in this process is suggested by syndapin III’s ability to induce tubule formation. The induced membrane tubules were about 80 nm in diameter and thereby fitted with membrane curvatures found at caveolae. Fifth, syndapin III localized specifically to necks of cav3-coated caveolar invaginations – sites, which can be expected to represent zones of curvature modulation during invagination. Finally, caveolar necks have a complex topology with negative membrane curvatures being turned into positive ones. Syndapins have a unique, curved but also tilde-like shape and may thus especially prefer and/or promote the complex membrane topologies found at caveolar necks (Qualmann et al., 2011). Syndapin III thus seems to use its membrane-shaping properties to promote caveolar invagination and caveolar organization. It is conceivable that a key step in this process will be the initiation of membrane curvature in at first minimal membrane areas. This would explain how few syndapin III molecules at the neck of caveolae would suffice for triggering invagination and why not all caveolae at all times were syndapin III-positive. It is likely that this function critically required for caveolar invagination can then be propagated further by the self-assembly of cav3 (and other coat components) into bent coats.
Whether CAVIN-1 plays some role in such propagation or stabilization of caveolar invaginations or whether it simply exerts its critical role by stabilizing caveolin proteins can neither be answered by the conducted CAVIN-1 loss-of-function studies (Hill et al., 2008; Liu and Pilch, 2008; Liu et al., 2008) nor by our phenotypical analyses of syndapin III KO. Yet, two somewhat unexpected conclusions can be drawn firmly. First, even a combination of the two coat proteins cav3 and CAVIN-1 – both not reduced, that is still available, at the plasma membrane in syndapin III KO muscle cells - is not sufficient for efficient caveolar invagination. Second, in contrast to previous immunofluorescence studies with overexpressed CAVIN-1-mCherry and cav1-EGFP in HeLa cells (Sinha et al., 2011), our quantitative ultra-high-resolution studies show that CAVIN-1 is not dissociating from the plasma membrane of muscle cells when caveolae are flat but CAVIN-1 remained and its levels even increased at the plasma membrane. Our data thereby seem to be in line with a previous report showing only slightly increased cav1/CAVIN-1 ratios together with strongly increased cav1 values, which thus can be interpreted as increased CAVIN-1 levels in the TIRF zone of fixed, syndapin II RNAi-transfected HeLa cells (Hansen et al., 2011). Furthermore, CAVIN-1 could still be detected in cav3-enriched nanodomains, which also remained present at the predominantly flat plasma membranes found in syndapin III KO cells.
It remains to be shown whether the apparent discrepancy of our quantitative data showing that both cav3 and CAVIN-1 are still available at the plasma membrane, when membrane topologies are flat, with a part of the literature on cav1-based caveolae suggesting a dissociation or dispersion of these coat components from their membrane nanodomains is caused by the improved resolution in our study, by the fact that we studied the endogenous proteins and/or is a specialty of cav3-caveolae and muscle cells.
It will furthermore be interesting to evaluate in detail whether similar to cav3 also cav1/cav2 in non-muscle cells would critically rely on membrane-shaping factors, too. Reports of recent years suggest that these components could for example be syndapin II and/or its binding partners, the EHD proteins (Hansen et al., 2011; Morén et al., 2012; Yeow et al., 2017).
Caveolae were hypothesized to act as mechanosensitive signaling hubs (Shvets et al., 2014). A significant portion of the plethora of physiological defects in caveolin-deficient mice may be mediated by MAPK hyperactivation (Woodman et al., 2002). We neither observe such hyperactivation nor any changes in dystrophin and β-dystroglycan expression levels or distribution upon impairment of caveolar invagination by syndapin III KO. We, furthermore, did not observe cardiac myocyte hypertrophy and left ventricular wall thickening in syndapin III KO mice. Since syndapin III KO did not mirror these cav3 KO phenotypes, they either require a complete loss of all caveolae or they reflect a lack of cav3 protein as membrane-associated hub rather than dysfunctions of caveolae as invaginated cell biological structure. It thus is attractive to consider the idea that not all phenotypes and clinical symptoms observed upon cav3 deficiency may be due to currently untreatable caveolar dysfunctions, but to quite some extent may represent derailed, that is presumable treatable, signaling processes. Also the fact that even LGMD-1C patients with the severest cases of CAV3 missense mutations known (63TFT65del and P104L) showing full clinical symptoms do not exhibit a complete impairment of caveolae formation (Minetti et al., 1998; Minetti et al., 2002) clearly argues in favor of the view that a complete loss of caveolae is not a prerequisite for the development of caveolinopathy symptoms. Instead, it seems that a severe reduction is sufficient for mirroring the caveolar defects in caveolinopathies. Syndapin III KO led to a severe impairment of caveolar invagination but did not alter cav3 levels at the plasma membrane of isolated cardiomyocytes, heart and skeletal muscle and thereby represents a valuable model for dissection of caveolae and caveolin functions.
Our work shows that cav3-coated caveolae serve as membrane reservoirs of muscle cells and that syndapin III plays a crucial role in forming a membrane buffer reservoir represented by invaginated caveolae. A lack of these membrane reservoirs within the plasma membrane can be expected to render cells vulnerable to all conditions associated with mechanic stress. Indeed hypoosmotic swelling caused syndapin III KO cardiomyocytes to rupture, whereas WT cells responded by caveolar flattening and thereby counteracted the membrane tensions induced.
Muscles are faced with abrupt changes of membrane tension and CAV3 mutations cause muscle diseases, such as LGMD-1C and RMD (Gazzerro et al., 2010). Interestingly, caveolae morphology and density at the plasma membrane of rat myofibers were found to be unchanged upon different modes of contractile activity as well as upon myofiber stretching within normal myofiber limits but were greatly reduced by the more severe mechanical forces occurring during tearing of myofibers (Poulos et al., 1986; Dulhunty and Franzini-Armstrong, 1975). The muscle fibers of untrained syndapin III KO mice displayed an extended caliber spectrum being a sign of impaired muscle integrity. Yet, syndapin III KO-induced impairment of caveolar invagination did not have dramatic consequences for muscular integrity as long as mice were just housed in cages. When mice were subjected to physical exercise, however, the severe reduction of deeply invaginated caveolar structures upon syndapin III KO was associated with observations of hypertrophy, centronuclear myopathy and necrosis, that is were reminiscent of the clinical symptoms of human muscle diseases linked to CAV3 mutation (Gazzerro et al., 2010).
Taken together, it seems that muscular caveolar invaginations are largely dispensable for life. This is in line with the viability of cav3 KO mice (Hagiwara et al., 2000; Galbiati et al., 2001; Woodman et al., 2002). Yet, our studies unveil that muscular caveolae help to preserve muscle cells from the abrupt tear forces. Our data thereby shed light on the exact cellular functions impaired in caveolinopathies and strongly suggest that, when caveolae as membrane tension compensators are impaired, physical exercise-inducible hypertrophy is counterproductive to compensate the weakness of muscle fibers.
Materials and methods
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (mouse and rat) | PACSIN3/syndapin III | this paper | ||
Strain, strain background (Mus musculus) | C57BL/6J | Jackson Labs (Bar Harbor, Maine) | IMSR_JAX:000664 | |
Genetic reagent (Mus musculus) | 129/SvJ mouse genomic λ library | Stratagene (San Diego, California) | ||
Cell line (Mus musculus) | NIH3T3 | Cell Lines Services GmbH (Eppelheim, Germany) | CVCL_0594 | |
Cell line (human) | HEK293 | Cell Lines Services GmbH | CVCL0045 | |
Transfected construct (rat) | GFP-syndapin III F-BAR (aa 1–336; extended F-BAR) | this paper | ||
Transfected construct (mouse) | Syndapin III aa1-70 peptide (plus five unrelated aa encoded by exon5/6 deletion-induced frame shift and multiple stop codons) | this paper | ||
antibody | guinea pig anti-syndapin I, rabbit anti-syndapin II, rabbit anti-syndapin III, anti-GST | Koch et al. (2011), EMBO J 30:4955–4969., Qualmann et al. (1999), Mol Biol Cell 10:501–513. Koch et al. (2012), Histochem Cell Biol 138: 215-230., Qualmann and Kelly (2000), J Cell Biol 148:1047–1062 | anti-syndapin I, II, III 1:1000 (western blot); 1:50 (FRIL) | |
Antibody | goat anti-GAPDH (polyclonal) | Santa Cruz (Dallas, Texas) | sc48167 AB_1563046 | 1:1000 |
Antibody | mouse anti-cav3 (monoclonal ) | Santa Cruz | sc-5310, AB_626814 | 1:500 (western blot), 1:50 (IHC), 1:50 (FRIL) |
Antibody | goat anti-cav3 (polyclonal) | Santa Cruz | sc-7665 AB_637945 | 1:500 (western blot), 1:50 (IHC) |
Antibody | mouse anti-cav1 (monoclonal) | Santa Cruz | sc-53564, AB_628859 | 1:500 (western blot), 1:50 (IHC), 1:50 (FRIL) |
Antibody | rabbit anti-cav1 (polyclonal) | Santa Cruz | sc-894 AB_2072042 | 1:1000 (western blot), 1:200 (IHC), 1:50 (FRIL) |
Antibody | rabbit anti-IRTK (polyclonal) | Santa Cruz | sc-710, AB_631106 | 1:1000 (western blot) |
Antibody | mouse anti-CAVIN-1 (monoclonal) | BD Bioscience (Franklin Lakes, New Jersey) | 611258, AB_398788 | 1:50 (FRIL) |
Antibody | mouse anti-PDI (monoclonal) | Stressgene (Farmingdale, New York) | ADI-SPA-891, AB_10615355 | 1:1000 (western blot) |
Antibody | mouse anti-β-actin (monoclonal) | Sigma | A5441, AB_476744 | 1:5000 (western blot) |
Antibody | mouse anti-β-tubulin (monoclonal) | Sigma | T4026, AB_477577 | 1:1500 (western blot) |
Antibody | rabbit anti-CAVIN-1 (polyclonal) | Proteintech (Rosemont, Illinois) | 18892–1-AP,AB_10596795 | 1:1000 (western blot), 1:100 (IHC), 1:50 (FRIL) |
Antibody | rabbit anti-CAVIN-3 (polyclonal) | Proteintech | 16250–1-AP AB_2171894 | 1:1000 (western blot) |
Antibody | goat anti-CAVIN-2 (polyclonal) | R & D Systems (Minneapolis, Minnesota) | AF5759AB_2269901 | 1:200 (western blot) |
Antibody | rabbit anti-CAVIN-4 (polyclonal) | Sigma | HPA020987AB_1853080 | 1:400 (western blot) |
Antibody | mouse anti-β-dystroglycan (monoclonal) | Leica Biosystems (Wetzlar, Germany) | NCL-b-DG,AB_442043 | 1:1000 (western blot); 1:200 (IHC) |
Antibody | mouse anti-dystrophin (monoclonal) | Leica Biosystems | NCL-DYS1,AB_442080 | 1:200 (western blot); 1:50 (IHC) |
Antibody | mouse anti-GM130 (monoclonal) | BD Biosciences | 610822AB_398141 | 1:1000 (western blot) |
Antibody | mouse anti-β-catenin (monoclonal) | BD Biosciences | 610153, AB_397554 | 1:1000 (western blot) |
Antibody | mouse anti-ERK1/2 (monoclonal) | Cell Signalling (Danvers, Massachusetts) | #9107AB_2235073 | 1:5000 (western blot) |
Antibody | mouse anti-pERK1/2 (monoclonal) | Cell Signalling | #9106, AB_331768 | 1:1000 (western blot) |
Antibody | mouse anti-GFP (monoclonal) | Clontech (Mountain View, California) | 632380,AB_10013427 | 1:8000 (western blot) |
Antibody | rabbit anti-Cherry(polyclonal) | Abcam (Cambridge, UK) | ab167453AB_2571870 | 1:1000 (western blot) |
Antibody | Alexa Fluor555-labeled wheat germ agglutinin (WGA) | Molecular Probes (Eugene, Oregon) | W32464 | 1:2000 (IF) |
Antibody | Alexa Fluor488-labeled wheat germ agglutinin (WGA) | Molecular Probes | W11261 | 1:2000 (IF) |
Antibody | Alexa Fluor488-labeled goat anti-guinea pig | Molecular Probes | AB_142018 | 1:1000 (IF) |
Antibody | Alexa Fluor568-labeled goat anti-guinea pig | Molecular Probes | AB_141954 | 1:1000 (IF) |
Antibody | Alexa Fluor488-labeled donkey anti-mouse | Molecular Probes | AB_141607 | 1:1000 (IF) |
Antibody | Alexa Fluor568-labeled donkey anti-mouse | Molecular Probes | AB_2534013 | 1:1000 (IF) |
Antibody | Alexa Fluor647-labeled goat anti-mouse | Molecular Probes | AB_141725 | 1:1000 (IF) |
Antibody | Alexa Fluor488-labeled donkey anti-rabbit | Molecular Probes | AB_141708 | 1:1000 (IF) |
Antibody | Alexa Fluor568-labeled goat anti-rabbit antibodies | Molecular Probes | AB_143011 | 1:1000 (IF) |
Antibody | Alexa Fluor647-labeled goat anti-rabbit antibodies | Molecular Probes | AB_141775 | 1:1000 (IF) |
Antibody | Alexa Fluor680-labeled donkey-anti-goat | Molecular Probes | AB_141494 | 1:10000 (western blot) |
Antibody | Alexa Fluor680-labeled goat-anti-rabbit | Molecular Probes | AB_2535758 | 1:10000 (western blot) |
Antibody | Alexa Fluor680-labeled goat-anti-mouse | Molecular Probes | AB_1965956 | 1:10000 (western blot) |
Antibody | goat anti-rabbit-peroxidase | Dianova (Hamburg, Germany) | AB_2337945 | 1:10000 (western blot) |
Antibody | goat anti-guinea pig-peroxidase | Dianova | AB_2337405 | 1:10000 (western blot) |
Antibody | goat anti-mouse-peroxidase | Dianova | AB_2338523 | 1:10000 (western blot) |
Antibody | DyLight800-conjugated goat anti-rabbit | Pierce/Thermo (Waltham, Massachusetts) | AB_2556775 | 1:10000 (western blot) |
Antibody | DyLight800-conjugated goat anti-mouse | Pierce | AB_2556774 | 1:10000 (western blot) |
Antibody | IRDy 800CW-conjugated donkey anti-goat | BioTrend (Köln, Germany) | AB_220102 | 1:10000 (western blot) |
Antibody | anti-guinea pig antibodies coupled to IRDye680 | LI-COR Bioscience (Lincoln, Nebraska) | AB_10956079 | 1:10000 (western blot) |
Antibody | anti-guinea pig antibodies coupled to IRDye800 | LI-COR Bioscience | AB_1850024 | 1:10000 (western blot) |
Antibody | gold-labeled goat anti-rabbit (10 nm) | British Biocell International (Cardiff, UK) | AB_1769130 | 1:50 (FRIL) |
Antibody | gold-labeled goat anti-rabbit (15 nm) | British Biocell International | AB_1769134 | 1:50 (FRIL) |
Antibody | gold-labeled goat anti-mouse (10 nm) | British Biocell International | AB_1769156 | 1:50 (FRIL) |
Antibody | gold-labeled goat anti-mouse (15 nm) | British Biocell International | AB_2715551 | 1:50 (FRIL) |
Recombinant DNA reagent | rat syndapin III full length (aa 1–424) in pGEX-5X1 (plasmid) | Braun et al. (2005) Mol Biol Cell, 16:3642–3658. | ||
Recombinant DNA reagent | rat syndapin III F-BAR (aa 1–336; extended F-BAR) in pGEX-5X1 (plasmid) | this paper | ||
Recombinant DNA reagent | rat syndapin III ∆F-BAR (aa 336–424) in pGEX-5X1 (plasmid) | this paper | ||
Recombinant DNA reagent | rat syndpin III SH3 (aa 366–424) in pGEX-5X1 (plasmid) | this paper | ||
Recombinant DNA reagent | rat syndapin III ∆SH3 (aa 1–365) in pGEX-5X1 (plasmid) | this paper | ||
Recombinant DNA reagent | GFP-rat syndapin III F-BAR (aa 1–336; extended F-BAR) in pEGFP-C2 (plasmid) | this paper | ||
Recombinant DNA reagent | mouse syndapin III aa1-70 peptide (plus five unrelated aa encoded by exon5/6 deletion-induced frame shift and multiple stop codons) plasmids including pGEM-T, mCherry-pCMV-Tag2b, pEGFP-C2 and pGEX-5X-1 | this paper | ||
Peptide, recombinant protein | rat GST-syndapin III full length (aa 1–424) and rat syndapin III full-length (untagged) | Braun et al. (2005) Mol Biol Cell 16:3642–3658 (for plasmid and (uncut) GST-fusion protein) | Untagged syndapin III was obtained from GST-syndapin III upon cleavage of the GST tag with 6 U precission protease/mg protein and overnight dialysis against 20 mM HEPES, 150 mM NaCl, 2 mM EDTA und 2.5 mM DTT pH 7.4 at 4°C. | |
Peptide, recombinant protein | rat GST-syndapin III F-BAR (GST+Sdp III aa 1–336; extended F-BAR) | this paper | ||
Peptide, recombinant protein | rat GST-syndapin III ∆F-BAR (GST+Sdp III aa 336–424) | this paper | ||
Peptide, recombinant protein | rat GST-syndapin III SH3 (GST+SdpIII aa 366–424) | this paper | ||
Peptide, recombinant protein | rat GST-syndapin III ∆SH3 (GST+Sdp III aa 1–365) | this paper | ||
Commercial assay or kit | NucleoSpin Plasmid | Macherey-Nagel (Düren, Germany) | 740.588.250 | |
Commercial assay or kit | NucleoBond Xtra Midi | Macherey-Nagel | 740.410.100 | |
Commercial assay or kit | Rediprime II Random Prime Labelling System | GE Healthcare (Chicago, Illinois) | #RPN1633 | |
Chemical compound, drug | α P32 dCTP | GE Healthcare (Chicago, Illinois) | ||
Software, algorithm | AxioVision 4.8.2 | Zeiss (Oberkochen, Germany) | SCR_002677 | |
Software, algorithm | ZEN 2012 | Zeiss | SCR_013672 | |
Software, algorithm | Prism6 | GraphPad (La Jolla, California) | SCR_002798 | |
Software, algorithm | imageJ | other | SCR_003070 | open source software |
Software, algorithm | IMOD package | Kremer et al. (1996) Journal of Structural Biology, 116, 71–76 | SCR_003297 | open source software |
Software, algorithm | IMARIS 8.4 | Bitplane (Zürich, Switzerland) | SCR_007370 | |
Other | DAPI stain | Molecular Probes | (1:10000) |
Generation of syndapin III KO mice
Request a detailed protocolThe targeting vector was constructed using a clone isolated from a 129/SvJ mouse genomic λ library (Stratagene). An BamHI/blunt/HindIII fragment of approximately 2.6 kbp of this clone including exons 1–2 of the syndapin III gene was combined with a PCR-generated, approximately 4 kbp large HindIII/SnaBI fragment including exons 3–11 and cloned into the pKO‐DTA plasmid (Lexicon Genetics) containing a phosphoglycerate kinase (pgk) promoter‐driven diphtheria toxin A cassette.
A pgk promoter‐driven neomycin resistance cassette flanked by frt sites and a loxP site was inserted into the DraIII site of intron 6. A second loxP site together with an additional HindIII site was inserted into the EcoRI site in intron 4. The EcoRI site was destroyed upon insertion.
R1 mouse embryonic stem (ES) cells were electroporated with NotI-linearized targeting vector. Neomycin‐resistant ES cell clones were analyzed by Southern blotting. A P32-labeled 425‐bp probe (NC_000068.6 Mus musculus chromosome 2, nt4262‐4686) was used to analyze EcoRI-digested DNA isolated from 288 neomycin-resistant ES cell clones (WT, 4,500 bp band, nt 3928–8419; transgene, approx. 5,700 bp band, nt 3928–9532 + 130 bp piece of neo cassette due to a EcoRI site in the neo cassette).
Two correctly targeted ES cell clones (G10, D6) were injected into C57BL/6J blastocysts to generate chimeras. Syndapin III KO mice were obtained via mating with mice ubiquitously expressing modified Cre recombinase under the transcriptional control of the human cytomegalovirus minimal promoter PBi-2 (Schwenk et al., 1995) to remove exons 5 and 6 together with the selection cassette.
For genotyping, DNA of mouse tail biopsies was extracted using 10 mM Tris/HCl pH 8.0, 100 mM NaCl, 0.8 mg/ml proteinase K (overnight, 55°C). After inactivation of the reaction (10 min, 95°C), a high‐speed supernatant (5 min, 20,000 x g) was analyzed by PCR (Fwd1, 5′‐cacgttagcaatggcagtgt‐3′; Rev1, 5′‐ggcgggtttgctaacttaaa‐3′ and Rev2, 5′‐tgttggaggcagaatgtcaa‐3′). The primer pair Fwd1/Rev1 amplified a 206 bp WT allele, and the primer pair Fwd1/Rev2 a 164 bp KO allele. RNA isolation and reverse transcription PCR was done as described before (Haag et al., 2012). Two micrograms of DNase-treated total RNA from heart and skeletal muscle were reverse transcribed using oligo(dT)-primers and RevertAid H Minus Reverse Transcriptase. Controls omitting reverse transcriptase (- Rev.Tr.) were run in parallel. Syndapin III expression was analyzed by PCR using the following primers: syndapin III Fwd, 5’-atggctccagaggaggacgcc-3’; Rev, 5’-ccccccagcactggccg-3’ and GAPDH Fwd, 5’-attgacctcaactacatggtctaca-3’; Rev, 5’-ccagtagactccacgacatactc-3’.
All animal procedures were performed in strict compliance with the EU directives 86/609/EWG and 2007/526/EG guidelines for animal experiments and were approved by the local government (permission numbers: 02-011/10 for generation and establishment of syndapin III KO mice; 02-057/14 (18.09.2014)/Änderungsbescheid I (19.02.2015) for motor training; Thüringer Landesamt für Verbraucherschutz, Bad Langensalza; Germany).
Animals were housed under 14 hr light/10 hr dark conditions with ad libitum access to food and water. Syndapin III KO (-/-) mice were backcrossed on C57BL/6J.
Trained mice (age matched WT and syndapin III KO male mice with a C57BL/6J background of >93.7%) received 10 running sessions at a speed of 20 cm/s (1 hr per mouse and per week) prior to histological examination of muscle integrity.
Antibodies
Anti-syndapin III, anti-syndapin II, anti-syndapin I and anti-GST antibodies and their affinity purification were described previously (Koch et al., 2011; Koch et al., 2012; Qualmann and Kelly, 2000; Qualmann et al., 1999). Polyclonal goat anti-GAPDH antibodies (sc48167), monoclonal mouse and polyclonal goat anti-cav3 (sc-5310; sc-7665), monoclonal mouse and polyclonal rabbit anti-cav1 (sc-53564; sc-894) as well as polyclonal rabbit anti-IRTK antibodies (sc-710) were from SantaCruz. Anti-CAVIN-1 antibodies (611258) were from BD Bioscience. Monoclonal anti-PDI antibodies (ADI-SPA-891) were from Stressgene. Monoclonal mouse anti-β-actin (A5441) and anti-β-tubulin (T4026) antibodies were from Sigma. Polyclonal rabbit anti-CAVIN-1 and 3 antibodies (18892–1-AP; 16250–1-AP) were from Proteintech, polyclonal goat anti-CAVIN-2 antibodies (AF5759) were from R&D Systems and polyclonal rabbit anti-CAVIN-4 antibodies (HPA020987) were from Sigma. Monoclonal mouse anti-β-dystroglycan and anti-dystrophin antibodies were from Leica (NCL-b-DG; NCL-DYS1). Monoclonal anti-GM130 and anti-β-catenin antibodies were from BD Biosciences (610822; 610153). Monoclonal mouse anti-ERK1/2 and anti-pERK1/2 (#9107; #9106) were from Cell Signaling. Monoclonal mouse anti-GFP (632380) and polyclonal anti-mCherry antibodies (ab167453) were from Clontech and Abcam, respectively.
Alexa Fluor®555- and Alexa Fluor 488-labeled wheat germ agglutinin (WGA) was purchased from Molecular Probes. Fluorescently labeled secondary antibody conjugates used for this study included, Alexa Fluor®488- and 568-labeled goat anti-guinea pig antibodies, Alexa Fluor®488 and 568-labeled donkey anti-mouse as well as Alexa Fluor®647-labeled goat anti-mouse antibodies, Alexa Fluor®488-labeled donkey anti-rabbit, Alexa Fluor®568 and 647-labeled goat anti-rabbit antibodies and Alexa Fluor680-labeled donkey-anti-goat, goat anti-rabbit and goat anti-mouse antibodies (Molecular Probes); goat anti-rabbit, anti-guinea pig and anti-mouse-peroxidase antibodies (Dianova); DyLight800-conjugated goat anti-rabbit and anti-mouse antibodies (Pierce), IRDye800CW-conjugated donkey anti-goat antibodies (BioTrend) anti-guinea pig antibodies coupled to IRDye680 and IRDye800, respectively, (LI-COR Bioscience).
Gold-labeled goat anti-rabbit (10 nm and 15 nm) and goat anti-mouse (10 nm and 15 nm) secondary antibodies were from British Biocell International.
Plasmids and recombinant fusion proteins
Request a detailed protocolSyndapin III full length (aa 1–424) was cloned from a rat cDNA library and inserted into pGEX-5X1 as described previously (Braun et al., 2005). Syndapin III F-BAR (aa 1–336; extended F-BAR), ∆F-BAR (aa 336–424), SH3 (aa 366–424) and ∆SH3 (aa 1–365) were generated by PCR with appropriate primers and GST-syndapin III as template and were cloned into pGEX vectors. All PCR-generated constructs were sequenced to verify that their sequences were correct.
GST fusion proteins were prepared as described previously (Qualmann et al., 1999). Untagged syndapin III was obtained from GST-syndapin III upon cleavage of the GST tag with 6 U precission protease/mg protein as described (Zobel et al., 2015) and overnight dialysis against 20 mM HEPES, 150 mM NaCl, 2 mM EDTA und 2.5 mM DTT pH 7.4 at 4°C.
GFP-syndapin III F-BAR (aa 1–336; extended F-BAR) was generated by subcloning into pEGFP-C2.
Plasma-membrane-targeted fluorescent proteins were described previously (Schneider et al., 2014).
Syndapin III1-70 peptide (plus five unrelated aa encoded by exon5/6 deletion-induced frame shift and multiple stop codons) was generated by PCR and cloning into pGEM-T (Promega). The construct was subcloned (EcoRI/SalI) into mCherry-pCMV-Tag2b, pEGFP-C2 and pGEX-5X1, respectively.
Morphological analysis of cardiac myocyte cross-sections and ventricular wall thickness
Request a detailed protocolTo analyze cardiac myocyte cross-sections, 20 weeks old WT and syndapin III KO mice were killed by cervical dislocation. Beginning at 1000 µm from the apex, hearts were cut in 8 µm thick slices using a cryostat (CM3050S Leica Biosystems).
Cardiomyocytes lining the left ventricle from at least two sections per animal were stained with WGA and cardiac myocyte cross-sections were determined (Fluar 40x/1.30 Oil M27 objective; Zeiss Apotome2/Axio Observer.Z1; AxioCam MR Rev3 camera). The analysis was done using ImageJ software (ImageJ).
Left ventricular wall thickness was determined using cardiac cryosections from 20 weeks old mice stained with H&E that were imaged by using a EC Plan-Neofluar 5x/0.16 objective (microscope and camera as above). Pictures were taken as tiles with 20% overlap. Based on a stitched image (ZEN 2012 software (Zeiss)), the wall thickness was calculated as half the difference of the outer and inner diameter of the left ventricle using the ZEN 2012 software (Zeiss).
Immunofluorescence analyses of heart and skeletal muscle sections
Request a detailed protocolHeart and musculus quadriceps and gastrocnemius samples, respectively, were from 12 to 15 weeks old WT and syndapin III KO mice. After processing for cryosectioning 20 µm thick transversal and 40 µm thick longitudinal sections were blocked with 5% goat serum in 0.1 M phosphate buffer (pH 7.4) and 0.25% Triton X-100 for 1 hr and incubated with primary antibodies in the above buffer at 4°C for 12 hr. Secondary antibodies were applied for 2 hr. Subsequent to DAPI staining, sections were embedded in Fluoromount-G.
Confocal images of tissue sections were recorded digitally with a Leica TCS SP5 confocal microscope operated under identical settings.
Quantitative analyses of anti-cav3 intensities were done with ImageJ. Rectangular ROIs of about 5 × 20 µm were placed at the plasma membranes of two adjacent fibers and ROIs for intracellular measurements (complete intracellular area of a fiber) were drawn with about 5 µm distance from plasma membrane at confocal sections of transversally sectioned immunostained muscle fibers. Determinations of anti-cav3 intensities at membrane-associated puncta were done using longitudinal sections. Quantitative analyses of cav3 and syndapin III were done using the ImageJ plugin Coloc2 (version 3.0.0). ROIs were predefined in an unbiased manner in the anti-cav3 channel for all measurements and analyzed for syndapin III immunosignals subsequently.
3D surface rendering of anti-cav3 immunolabeling was done using IMARIS 8.4 (Bitplane). ROIs (14 in total, 2 per image) were defined in an unbiased manner using the anti-cav3 channel in confocal image stacks of longitudinal muscle cryosections. Cav3 spots were generated with a defined diameter of 0.5 µm. The generated spheres were then filtered for syndapin III presence or absence (expressed as percent of all cav3 spots (averaged per image) for quantitative analyses) and color-coded (for visual presentation).
Muscle pathology examinations
Request a detailed protocolMice were killed by cervical dislocation. 7 × 7 mm biopsies from musculus gastrocnemius were cryoconserved and 4% PFA-fixed/paraffin-embedded, respectively. Cryosections (10 µm) were used for H&E, trichrome, sudan black, periodic acid–Schiff, ATPase (pH 4.2, 4.6, 9.4), acidic phosphatase, succinate dehydrogenase, cytochrome oxidase, NADH-tetrazolium reductase, myoadenylate deaminase, phosphofructokinase, ATPase, iron and lactate dehydrogenase stainings. Paraffin sections (4 µm) were used for H&E, Congo Red, periodic acid–Schiff and Elastic van Gieson (EvG) stainings according to standard procedures.
Images were taken with a Zeiss Observer Z.1, a 20x/0.5 objective and AxioVision 4.8.2 software. Analyses of the percent of detached nuclei and of the caliber spectra were conducted using H&E stainings. Caliber spectra were done with ImageJ and the select wand and freehand selection tools to mark muscle fibers.
Osmotic stress assay, transfection and immunofluorescence analyses of cardiomyocytes
Request a detailed protocolCardiomyocytes were prepared, transfected with lipofectamine and subjected to immunofluorescence analysis as described (Lygren et al., 2007; Schwintzer et al., 2011).
Cardiomyocytes from WT and syndapin III KO mice were subjected to iso buffer (20 mM HEPES pH 7.4, 1 mM CaCl2, 1 mM MgCl2, 5 mM KCl supplemented with 10.5 mM glucose, 28.8 µM BSA and 150 mM NaCl), to hypo15 buffer (iso buffer with 15 mM instead of 150 mM NaCl), and to hypo30 buffer (iso buffer with 30 mM instead of 150 mM NaCl), respectively, for 5 min. Cells incubated in iso and hypo15 buffer were analyzed by freeze-fracturing and EM (similar experiments were conducted with NIH3T3 cells). Analyses were conducted by an independent experimentator in a blinded manner.
In further assays, cardiomyocytesc from WT and syndapin III KO mice were subjected to iso conditions and to hypo30- and hypo15-induced mild and stronger membrane tension stress and were stained with Trypan Blue. Ruptured cells were counted systematically in a blinded study (about 100 cells/assay; 18 assays).
Cell culture and immunofluorescence analyses of cell lines
Request a detailed protocolCulturing of NIH3T3 cells and HEK293 cells (Cell Lines Services GmbH) was essentially done as described (Kessels et al., 2001). All cell lines are regularly tested for mycoplasma and were mycoplasma-negative. Transfections were done using TurboFect according to the instructions of the supplier (Thermo Scientific).
Fluorescence microscopy of NIH3T3 cells fixed 24 hr after transfection (4% PFA for 7 min) was done using a Zeiss AxioObserver.Z1 microscope equipped with an ApoTome2 and Plan-Apochromat 63x/1.4 and 40x/1.3 objectives and an AxioCam MRm CCD camera (Zeiss). Digital images were recorded by ZEN2012 software and image processing was done using Adobe Photoshop.
Biochemical analyses
Request a detailed protocolTissue homogenizations and quantitative immunoblotting were essentially performed as described (Schwintzer et al., 2011).
Heart and skeletal muscle pieces (from musculus quadriceps and gastrocnemius) were first ground to powder under liquid N2.
TritonX-100 insoluble material was obtained by centrifugation at 100000 x g for 1 hr at 4°C, washing was done by resuspension and repeated centrifugation (15 min).
For DRM preparations, homogenates were prepared in protease inhibitor-supplemented MES buffer (50 mM MES pH 6.5, 150 mM NaCl, 1 mM EDTA, 0.1 mM MgCl2). After TritonX-100 addition (1% final), the homogenates were incubated with gentle shaking at 4°C for 30 min. Samples were centrifuged (1000 x g for 5 min at 4°C), and the postnuclear supernatants were adjusted to 40% sucrose by the addition of 2 ml of 80% sucrose in MES buffer, overlayed with a 5–30% linear sucrose gradient and centrifuged for 16 hr (284000 x g (40000 rpm, SW40 Ti)) and for 24 hr (174600 x g (32000 rpm, SW32 Ti)), respectively. 12 fractions à 1 ml were collected (from top). Proteins were precipitated by 75% ethanol and immunoblotted.
For immunoblotting with anti-pERK1/2 antibodies, hearts from 12 weeks old WT and syndapin III KO mice were homogenized in lysis buffer II (50 mM HEPES pH 7.4, 150 mM NaCl, 1 mM EDTA, 0.1 mM MgCl2, protease inhibitors) with phosphatase inhibitors via sonication. 50 µg protein were immunoblotted and analyzed quantitatively in relation to anti-GAPDH and anti-ERK1/2 signals, respectively.
Fractionations addressing the membrane association of GFP, GFP-syndapin III F-BAR and of the putative GFP-syndapin III1-70 (aa1-70 peptide of syndapin III plus five aa due to frame shift) were done with lysates of transfected HEK293 cells. After passage through a syringe with a 25G cannula in 5 mM HEPES pH 7.4, 0.32 M sucrose and 1 mM EDTA centrifugation (1000 x g, 4°C, 10 min) resulted in fraction S1 and P1. Centrifugation of S1 (12000 x g, 4°C, 10 min) yielded fractions S2 and the crude membrane fraction P2. Cotransfected plasma membrane-targeted mCherry (mCherryF) served as internal control for a membrane-bound protein.
For coprecipitation analyses, heart homogenates in lysis buffer II were centrifuged at 100000 x g at 4°C for 30 min. Membrane-containing pellets were solubilized by 1% TritonX-100 in PBS, incubated 30 min at RT and centrifuged (20 min, 17000 x g, 4°C). Supernatants were transferred to agarose-coupled GST-fusion proteins and after 3 hr at 4°C the samples were washed, eluted with SDS sample buffer and immunoblotted.
Protein/liposome binding assays and EM analyses of liposomes
Request a detailed protocolFreeze fracturing of liposomes incubated with proteins (2 µM) was done as described (Beetz et al., 2013). Cryo-TEM of liposomes coated with GST-syndapin III and syndapin III and of control incubations was performed on holey carbon film-covered copper grids. Liquid ethane-frozen samples (~−180°C) were transferred into a pre-cooled cryo-transmission electron microscope operated at 120 kV (Philips CM 120) using a cryo-transfer unit (Gatan 626-DH). Images were recorded with a 1K CCD Camera (FastScan F114, TVIPS).
Freeze-fracture replica were viewed using a Zeiss EM 902A transmission electron microscope run at 80 kV (Zeiss). Images were recorded digitally using an 1 k FastScan-CCD-camera (TVIPS camera and software).
Tubule diameters were analyzed using ImageJ. For diameter distribution analyses, measured diameters were grouped in 5 nm-step categories (0–5 nm,>5 to 10 nm,>10 to 15 nm and so on).
Cardiomyocyte fixation, sectioning and processing for EM analyses
Request a detailed protocolPrimary cardiomyocytes isolated from WT and syndapin III KO mice were fixed by adding 2.5% glutaraldehyde in 0.1 M cacodylate buffer. After 1 hr, the cells were collected by centrifugation at 600 x g and washed 3x with PBS. After post-fixation in 1% osmiumtetroxide for 1 hr, dehydration in ascending ethanol series with post-staining in uranylacetate was performed. The samples were embedded in epoxy resin (Araldite) and finally sectioned ultrathin using a LKB Ultratome III (LKB). After mounting on coated copper grids and post-staining with lead citrate for 10 min, the sections were examined in a TEM (EM 902A, Zeiss) at 80 kV. Images were recorded digitally using an 1 k FastScan-CCD-camera (TVIPS camera and software). Plasma membrane sections of about 2 µm length each were analyzed for the presence or absence of caveolar membrane profiles. Data were expressed as caveolae/length of membrane stretch. Images were processed using Adobe Photoshop software.
Freeze-fracturing of cardiomyocytes, of NIH3T3 cells and of heart and skeletal muscle tissues
Request a detailed protocolFreeze-fracturing of NIH3T3 cells and primary cardiomyocytes was essentially done as described (Koch et al., 2012; Schneider et al., 2014).
To obtain freeze-fracture replica directly from skeletal muscles and hearts, heart and musculus gastrocnemius were isolated and cut longitudinal in 300 μm-thick slices using a McIlwain Tissue Chopper. Sections were transferred into PBS and frozen in 20% (w/v) BSA between a copper head sandwich profile. Copper sandwiches were freeze-fractured, shadowed with carbon and platinum/carbon, and incubated in 0.2% collagenase II in DMEM at 37°C overnight. After washing, replica were incubated in 5% (w/v) SDS and 30 mM sucrose in 10 mM Tris/HCl, pH 8.4 overnight.
Immunolabeling and TEM of freeze-fractured plasma membranes
Request a detailed protocolReplica were immunolabeled and analyzed by TEM as described (Schneider et al., 2014). Quantitative evaluations were performed by an independent experimentator and in a blinded manner using samples from several independent freeze-fracturing experiments. Cav1, cav3, CAVIN-1 and syndapin III labeling densities were determined per 3.47 µm2 image and analyzable ROI, respectively, and expressed as % of the corresponding WT and isoosmotic condition, respectively, of each assay (set at 100%). Immunolabels were only considered as localized to a caveolar invagination if localized <50 nm from the (inner) caveolar rim. In total, 1087 µm2 membrane were scored for quantitative analyses and 2889 caveolin-positive invaginations were evaluated.
Cluster analyses of cav3 and CAVIN-1 immunogold signals were done using circular ROIs of 150 nm diameter around caveolae (70 nm (inner caveolar diameter) + 2×10 nm (PM curvature zone around the caveolae) + 2×30 nm (maximally possible primary/secondary antibody extension and gold particle size). Four or more immunosignals per ROI were considered as cluster.
Electron tomography of freeze-fractured caveolae
Request a detailed protocolFor electron tomography, replica specimens were placed in a tilt-rotate specimen holder (Model 626; Gatan) and tomographic data sets were recorded using a Philips CM120 operated at 120 kV. Images were captured every 2° over a −70° to 56° range using a 2K CCD camera (TecCam F216, TVIPS).
The tilted views were aligned using the positions of the gold particles as fiducial points. Tomograms were computed and analyzed with the software IMOD Package (Kremer et al., 1996).
Statistical analyses
Request a detailed protocolPrism6 was used for testing for normal data distribution and for statistical analysis (for methods used for statistical significance calculations please see the figure legends accompanying the respective data panel). *p<0.05, **p<0.01,***p<0.001 throughout.
References
-
1
A novel mutation in the caveolin-3 gene causing familial isolated hyperCKaemiaNeuromuscular Disorders 14:321–324.https://doi.org/10.1016/j.nmd.2004.01.006
-
2
Rigidity of wedge loop in PACSIN 3 protein is a key factor in dictating diameters of tubulesJournal of Biological Chemistry 287:22387–22396.https://doi.org/10.1074/jbc.M112.358960
-
3
MURC/Cavin-4 and cavin family members form tissue-specific caveolar complexesThe Journal of Cell Biology 185:1259–1273.https://doi.org/10.1083/jcb.200903053
-
4
A spastic paraplegia mouse model reveals REEP1-dependent ER shapingJournal of Clinical Investigation 123:4273–4282.https://doi.org/10.1172/JCI65665
-
5
EHD proteins associate with syndapin I and II and such interactions play a crucial role in endosomal recyclingMolecular Biology of the Cell 16:3642–3658.https://doi.org/10.1091/mbc.E05-01-0076
-
6
Caveolae protect endothelial cells from membrane rupture during increased cardiac outputThe Journal of Cell Biology 211:53–61.https://doi.org/10.1083/jcb.201504042
-
7
Caveolae: one function or many?Trends in Cell Biology 26:177–189.https://doi.org/10.1016/j.tcb.2015.10.010
-
8
F-BAR proteins of the syndapin family shape the plasma membrane and are crucial for neuromorphogenesisJournal of Neuroscience 29:13315–13327.https://doi.org/10.1523/JNEUROSCI.3973-09.2009
- 9
-
10
High-resolution mapping reveals topologically distinct cellular pools of phosphatidylserineThe Journal of Cell Biology 194:257–275.https://doi.org/10.1083/jcb.201012028
-
11
Consequences of a novel caveolin-3 mutation in a large German familyAnnals of Neurology 53:233–241.https://doi.org/10.1002/ana.10442
-
12
Isoforms of caveolin-1 and caveolar structureJournal of Cell Science 113:3509–3517.
- 13
-
14
Caveolinopathies: from the biology of caveolin-3 to human diseasesEuropean Journal of Human Genetics 18:137–145.https://doi.org/10.1038/ejhg.2009.103
- 15
-
16
Caveolin-3 deficiency causes muscle degeneration in miceHuman Molecular Genetics 9:3047–3054.https://doi.org/10.1093/hmg/9.20.3047
-
17
Pacsin 2 is recruited to caveolae and functions in caveolar biogenesisJournal of Cell Science 124:2777–2785.https://doi.org/10.1242/jcs.084319
-
18
Exploring the caves: cavins, caveolins and caveolaeTrends in Cell Biology 20:177–186.https://doi.org/10.1016/j.tcb.2010.01.005
-
19
Caveolae, DIGs, and the dynamics of sphingolipid-cholesterol microdomainsCurrent Opinion in Cell Biology 9:534–542.https://doi.org/10.1016/S0955-0674(97)80030-0
- 20
- 21
- 22
- 23
-
24
Syndapins integrate N-WASP in receptor-mediated endocytosisThe EMBO Journal 21:6083–6094.https://doi.org/10.1093/emboj/cdf604
-
25
The syndapin protein family: linking membrane trafficking with the cytoskeletonJournal of Cell Science 117:3077–3086.https://doi.org/10.1242/jcs.01290
- 26
- 27
-
28
Computer visualization of three-dimensional image data using IMODJournal of Structural Biology 116:71–76.https://doi.org/10.1006/jsbi.1996.0013
-
29
Getting rid of caveolins: phenotypes of caveolin-deficient animalsBiochimica et Biophysica Acta (BBA) - Molecular Cell Research 1746:322–333.https://doi.org/10.1016/j.bbamcr.2005.06.001
- 30
-
31
A critical role of cavin (polymerase I and transcript release factor) in caveolae formation and organizationJournal of Biological Chemistry 283:4314–4322.https://doi.org/10.1074/jbc.M707890200
-
32
The caveolin-cavin system plays a conserved and critical role in mechanoprotection of skeletal muscleThe Journal of cell biology 210:833–849.https://doi.org/10.1083/jcb.201501046
- 33
- 34
-
35
Impairment of caveolae formation and T-system disorganization in human muscular dystrophy with caveolin-3 deficiencyThe American Journal of Pathology 160:265–270.https://doi.org/10.1016/S0002-9440(10)64370-2
- 36
-
37
All three PACSIN isoforms bind to endocytic proteins and inhibit endocytosisJournal of Cell Science 113 Pt 24:4511–4521.
-
38
Cavin3 interacts with cavin1 and caveolin1 to increase surface dynamics of caveolaeJournal of Cell Science 128:979–991.https://doi.org/10.1242/jcs.161463
-
39
EHD2 regulates caveolar dynamics via ATP-driven targeting and oligomerizationMolecular Biology of the Cell 23:1316–1329.https://doi.org/10.1091/mbc.E11-09-0787
-
40
Stressing caveolae new role in cell mechanicsTrends in Cell Biology 22:381–389.https://doi.org/10.1016/j.tcb.2012.04.007
- 41
- 42
-
43
Caveolae as plasma membrane sensors, protectors and organizersNature Reviews Molecular Cell Biology 14:98–112.https://doi.org/10.1038/nrm3512
-
44
Ultrarapid freezing reveals that skeletal muscle caveolae are semipermanent structuresJournal of Ultrastructure and Molecular Structure Research 96:114–124.https://doi.org/10.1016/0889-1605(86)90012-1
-
45
Syndapin isoforms participate in receptor-mediated endocytosis and actin organizationThe Journal of Cell Biology 148:1047–1062.https://doi.org/10.1083/jcb.148.5.1047
-
46
Let's go bananas: revisiting the endocytic BAR codeThe EMBO Journal 30:3501–3515.https://doi.org/10.1038/emboj.2011.266
-
47
Syndapin I, a synaptic dynamin-binding protein that associates with the neural Wiskott-Aldrich syndrome proteinMolecular Biology of the Cell 10:501–513.https://doi.org/10.1091/mbc.10.2.501
-
48
ProSAP1 and membrane nanodomain-associated syndapin I promote postsynapse formation and functionThe Journal of Cell Biology 205:197–215.https://doi.org/10.1083/jcb.201307088
- 49
- 50
-
51
Essential role of PACSIN2/syndapin-II in caveolae membrane sculptingJournal of Cell Science 124:2032–2040.https://doi.org/10.1242/jcs.086264
-
52
Caveolae: static inpocketings of the plasma membranedynamic vesicles or plain artifact? J Cell Sci 90:341–348.
-
53
News from the caves: update on the structure and function of caveolaeCurrent Opinion in Cell Biology 29:99–106.https://doi.org/10.1016/j.ceb.2014.04.011
- 54
- 55
-
56
Cavin 1 function does not follow caveolar morphologyAmerican Journal of Physiology - Cell Physiology 308:C1023–C1030.https://doi.org/10.1152/ajpcell.00329.2014
- 57
-
58
Caveolin-3 knock-out mice develop a progressive cardiomyopathy and show hyperactivation of the p42/44 MAPK cascadeJournal of Biological Chemistry 277:38988–38997.https://doi.org/10.1074/jbc.M205511200
-
59
The fine structure of the gall bladder epithelium of the mouseThe Journal of Cell Biology 1:445–458.https://doi.org/10.1083/jcb.1.5.445
- 60
- 61
Decision letter
-
Suzanne R PfefferReviewing Editor; Stanford University School of Medicine, United States
In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.
[Editor's note: Please note that due to the subsequent change of two figures into the figure supplements (the original Figure 4 was changed to Figure 3—figure supplement 3 and the original Figure 9 was changed to Figure 8—figure supplement 1), the figure numbers mentioned in both the reviews and the author responses do not correspond to the figures in the final article. Figures 5-8 now correspond to Figures 4-7 and Figures 10-13 now correspond to Figures 9-11.]
Thank you for submitting your article "Deciphering caveolar functions by syndapin III KO-mediated impairment of caveolar invagination" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom, Suzanne Pfeffer, is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Andrea Musacchio as the Senior Editor.
The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.
Summary
In their study, the authors analyzed the physiological function of syndapin III (also called PACSIN III), which they found to localize to caveolae in cardiomyocytes and muscle. For this, they generated a syndapin III knockout (KO) mouse model and investigated the morphology of caveolae in heart and muscle sections. Surprisingly, syndapin III KO myocytes revealed a severe reduction of caveolae. However, the authors could not find a severe cardiac or muscle phenotype, as described for caveolin3 knockout mouse models, which essentially lack caveolae in muscle and heart. The authors suggest that the syndapin III KO mouse can be used as a tool to dissect the function of caveolae independently from the function of caveolin3 and/or cavin1.
This is an extensive manuscript which could be very important for the caveolae field and beyond, since the lack of muscular caveolae in syndapin III ko mice suggests an unexpected function of syndapin III in the generation of caveolae. However, additional experiments will add much to the potential significance of the story, and are essential because the results presented here are so unexpected. Furthermore, there are numerous experiments for which the presentation can be improved.
Essential revisions
The reviewers were not yet completely convinced that the proposed model of syndapin-III as a curvature generator for caveolae is correct because there are still some normally shaped caveolae left in the ko animals; they thought that a BAR domain containing protein might stabilize the neck of a membrane invagination, as many other BAR domain proteins do, rather than generate the invagination. To address this issue, the reviewers suggest inclusion of some light microscopy-based experiments to quantify caveolin and cavin levels at the plasma membrane, at the plasma membrane in punctae, and at intracellular membranes in wt and ko cells. If possible, they felt that monitoring the dynamics of caveolae by transfecting cardiomyocytes with a caveolin3-GFP construct should be a rather straightforward experiment and would add a great deal to the present story (as long as it is expressed at low levels).
The reviewers have gone to great lengths to suggest specific manuscript improvements, thus I am attaching the detailed comments in full, to aid in the revision process.
1) The authors failed to mention that a model for syndapin II within caveolae was already described by Senju et al., 2015 and Hansen et al., 2011. Both studies showed that PACSIN II binds to EHD2 and is therefore recruited to caveolae, most probably to stabilize caveolar structures within the plasma membrane and not as trigger for the invagination process during caveolae generation. Hansen et al. also found a reduction of caveolae after knockdown of PACSIN II, but, in contrast to the present study, an increase of caveolin and cavin proteins in the membrane whereas in the current study, only cavin1 staining was increased in EM stainings of syndapin III KO cells. Thus, instead of invoking a decreased formation of caveolae in the absence of syndapin III, one could explain the syndapin III ko phenotype also by an increased uptake of caveolae in the absence of syndapins III. The authors should address this issue by directly looking at caveolar dynamics in primary wt and syndapins III ko cardiomyoctes or muscle cells overexpressing caveolin-3.
2) Figure 3: A double staining of syndapin III and caveolin3 was used to prove the localization of syndapin III to caveolae. However, in the KO example picture (i), it is difficult to see the cav3 staining. More micrographs, especially for the KO, and the same magnifications for wt and KO should be used to support the result. Furthermore, the authors found no significant difference between WT and KO cav3 staining at the plasma membrane (m). However, electron microscopy may not be the best method to quantitatively evaluate protein densities if different cellular structures (e.g. invaginations versus flat membranes) with potentially different accessibilities of the antibody epitopes are stained. As described in point 1, some light microscopy-based methods would be desirable to support the claims of the authors. Are Cav3 and cavin 1 still clustered?
3) Surface invaginations, caveolae, and syndapin III.
The authors use freeze-fracture and immunogold analysis to detect caveolae and the presence of syndapin III and caveolin3 at invaginations. A number of quantifications are shown, but rather than absolute quantifications, only relative quantifications between wt/ko are shown. What should in addition be shown are
- The fraction of invaginations positive for cav3 over total invaginations (are all total invaginations actual caveolae?
- The fraction of invaginations positive for sdp III over total invaginations
- The fraction of invaginations positive for both cav3 and sdp3 over total invaginations.
The cell types used in Figure 3, Figure 9 and Figure 12 might have other invaginations (clathrin-coated, non-coated), whose abundance should not be affected by Sdp III KO.
Since EM techniques allow only for fractions of cell surface areas to be examined, it would be informative to additionally determine the fraction of Sdp III-positive cav1- or cavin1-positive puncta on the surface of cultured cells using immunofluorescence of endogenous proteins (as in #2 above).
4) Caveolar and non-caveolar functions of caveolar coat components.
Knockout of Syndapin III/Pacsin3 causes loss of morphological caveolae, but not of caveolins or cavins. Based on this finding, the authors strongly emphasize that this situation uniquely allows them to disentangle the regulatory/signaling functions of caveolar coat components from the physiological role of caveolae as invaginated membrane structures. However, in this study they do not directly compare syndapin III/Pacsin3 knockout mice with caveolin3 knockout mice side-by-side and rely for their comparison on data from other studies. The authors state that "… syndapin III KO skeletal muscles showed pathological parameters upon physical exercise that are also found in CAVEOLIN3 mutation-associated diseases.", i.e. the effects of syndapin III KO are similar to a loss of caveolin3 function. We are surprised that such strong emphasis is placed on the separation of the functions of caveolar invaginations vs coat components, when no dramatic differences were found. This point could be addressed by text changes alone.
5) DRM association of dystrophin and dystroglycan (Figure 8).
The authors cite previous work that loss of caveolin3 has been associated with loss of DRM association of the dystrophin-glycoportein complex and therefore aimed at testing whether syndapin III KO caused a similar defect. In their experiments, however, even in wt animals, neither dystrophin nor β-dystroglycan floated on density gradients (Figure 7). Since there was no DRM association in lysates from WT tissues, it is impossible to determine or conclude whether syndapin III is necessary for DRM association of dystrophin or β-dystroglycan. DRM association depends on the sample/detergent ratio, the precise lysis conditions, and is therefore difficult to interpret, even more so when no DRM association is observed. In our view panels c-f do not provide significant insight and should be removed from the manuscript.
6) DRM association of cav3 and flotillin (Figure 6).
Figure 6 shows that Sdp III KO causes a change in flotation behavior of caveolin3 where the floating fraction(s) shift by two fractions towards the bottom of the gradient in Sdp III KO tissues: From fraction 3 to 5 in skeletal muscle, and from 4-6 in the heart. Flotillin1, which should not be associated with caveolar membranes, also shifts by two fractions towards the bottom of the gradient in KO tissues. The authors find support for their model that Sdp III is required specifically for organizing cav3-containing membrane domains. One could equally conclude that Sdp III is required for organizing flotillin1-containing membrane domains. Could the authors explain why they are convinced Sdp III is not involved in organizing flotillin1-containing membrane domains?
However, rather than questioning the specific role of Sdp III in caveola formation, to me this demonstrates how little can be concluded from DRM association assays. Flotillin1 might associate with caveolin-containing membranes post lysis during the centrifugation and its co-floating and shifting with cav3 may not have any biological meaning. Figure 6D-I in our view add little information to the manuscript. In the future (not required here), a more informative way for assessing the assembly state of the caveolar coat could be velocity gradients as used by the Helenius and Nichols labs (PMID: 20070607, PMID: 24013648).
7) The manuscript contains many experiments, but the organization is sometimes confusing and difficult to follow. For example, the authors often jump in between tissue and cell culture experiments for heart and muscle. It may be easier to show the immuno-stainings of syndapins III in heart and muscle directly behind the cardiomyocyte stainings (e.g. combine Figure 1, 4, 11, 12). It would also be easier to first describe the localization of syndapin III at caveolae before showing the reduced caveolar numbers in syndapin III ko cells. The previously described localization of syndapin II at caveolae should be mentioned in the Introduction.
Figure 1: The immunofluorescence experiments in C-E and I are difficult to recognize, the size of the pictures should be increased. Also the pictures in P and Q are difficult to analyze – it would be helpful if colocalisation of syndapin III and caveolin3 was investigated in more detail, e.g. using increased magnification during confocal microscopy, colocalisation analysis within ImageJ or ZEN software (see above).
Figure 2: As the authors acknowledge, the displayed EM pictures are of rather bad quality, so that caveolae cannot be precisely distinguished. Are these pictures essential?
Figure 2: The western blots for syndapin I (D) are difficult to interpret because the GAPDH signal used as loading control is very weak and no GAPDH band can be detected for the heart lysates – the authors used 50 ug/lane, so there should be a very strong signal for GAPDH. Further, the number of investigated WT and KO mice used for the western blot analysis is missing in the figure legends.
Figure 5: In G/H, the colocalization of cavin1 and caveolin3 is difficult to see. Further, the authors mentioned clustered cavin1 protein which is also not well seen in the two examples. The graphs A-F can be reduced in size and more detailed EM labeling pictures for both wt and KO can be shown in the supplement to support the results.
Figure 6: The 3D reconstruction images show the localization of syndapin III within caveolae. The authors therefore claim that syndapin III is responsible for the invagination process. However, for this model, it is quite surprising to see that only two molecules of syndapin III are detected, and only at one side/part of the caveolae. How can invagination be supported by syndapin III, if it is not found around the whole neck of caveolae? The authors should comment on this in their discussion.
Figure 8: The authors wrote in the figure legend: ' not all described cav3 loss-of-function[…]' If we understand the results described in this study, none of the previously published cav3 KO phenotypes was found in the syndapin III KO mouse?
Figure 11: Picture G, KO heart section is not well chosen, because the right ventricle is somehow cut or enrolled.
Figure 13: The muscle cell size in KO sections (C) seems to be increased. Did the author further analyze this?
Discussion:
In the Introduction, the authors suggest that caveolae and caveolin 3 function can now be better dissected, but the discussion for this is quite vague and could be extended (e.g. what do we learn?). Do the authors envisage a similar scenario for caveolin1-related caveolae in different tissue in relation to PACSIN II?
Materials and methods:
Statistical analysis should be described in more detail in the Materials and methods part, e.g. which statistical test and methods were used (t -test vs. Mann-Whitney-U test, distribution analysis of the data sets,..).
Legends for Videos 1 and 2 refer to the wrong figure (it should be Figure 6, not Figure 5).
https://doi.org/10.7554/eLife.29854.035Author response
Essential revisions
The reviewers were not yet completely convinced that the proposed model of syndapin-III as a curvature generator for caveolae is correct because there are still some normally shaped caveolae left in the ko animals; they thought that a BAR domain containing protein might stabilize the neck of a membrane invagination, as many other BAR domain proteins do, rather than generate the invagination. To address this issue, the reviewers suggest inclusion of some light microscopy-based experiments to quantify caveolin and cavin levels at the plasma membrane, at the plasma membrane in punctae, and at intracellular membranes in wt and ko cells.
We thank you for this positive assessment. We are happy to – besides the plethora of controls and comparisons already presented in the initial manuscript – provide further evidence that the fact that syndapin III KO leads to disruption of caveolar invagination of caveolae is not due to a reduction in cav3 levels (as it has been described for other caveolin coat-associated proteins) in our revised manuscript, which we herewith would like to submit.
We understand that beyond the classical thin sectioning and transmission electron microscopy and the biochemistry, which we used as additional techniques in parallel to our more innovative approach to label and quantitatively analyze caveolae by freeze-fracturing and TEM, the reviewers would like to see some more standard corroborative immunofluorescence analyses. We agree that this even further solidifies our study. The revised manuscript now contains several of such analyses.
Although the resolution of light microscopy is of course not sufficient to visualize single caveolae (which are only 70 nm in diameter, i.e. way below the resolution of light microscopy) and the membrane topologies within the nanodomains showing clustered cav3 signal cannot be visualized either, the lack of information on individual sites is compensated for by the power of signal averaging and intensity measurements. The revised manuscript now also by light microcopy shows that - fully consistent with our quantitative EM data in cardiomyocytes, in heart and in skeletal muscles and the biochemical evaluations – cav3 levels did not change upon syndapin III KO. Imaging of endogenous cav3 in sections of muscle tissue demonstrate that neither at the plasma membrane, intracellularly nor directly within puncta at the plasma membranes there were any changes in cav3 levels (newly added quantitative data panels in revised Figure 1 and Figure 12).
In addition, we were also able to answer the reviewers questions about the frequency of labeling overlap using 3D surface renderings of image stacks obtained by confocal microscopy (newly added Figure 12M, N). However, since this information is much more powerfully addressed by ultra-high resolution studies, the revised manuscript now additionally contains quantitative EM data on this (newly added Figures 3J, M and Figure 12C, D).
Furthermore, we also quantitatively analyzed the distribution of cav3 and of CAVIN-1 in detail in order to be able to describe how syndapin III KO affects the abundance and organization of caveolar coat components (newly added Figure 3P, Figure 5J-L and Figure 12S, T).
If possible, they felt that monitoring the dynamics of caveolae by transfecting cardiomyocytes with a caveolin3-GFP construct should be a rather straightforward experiment and would add a great deal to the present story (as long as it is expressed at low levels).
As discussed above, we agreed to corroborate and accordingly expanded our mostly EM work by additional light microscopy data in the revised manuscript. However, we felt that this is most informative in the real physiological context and therefore concentrated on examining endogenous cav3 and syndapin III in skeletal muscle tissues of WT and syndapin III KO mice, in which we subsequently also reveal phenotypes related to caveolinopathies in human patients.
The analyses of overexpressed GFP-cav3 in some cultured cells seemed not advisable as this would be scientifically questionable, as for example Hayer et al., 2010 (J. Cell Biol.) have revisited and extensively analyzed live imaging approaches and documented that life-imaging with GFP-caveolin leads to all sorts of artifacts, mainly to aberrant localizations of the fusion protein to non-caveolar surface pools as well as to different organelles of endosomal nature. Since the authors explicitly stated that even low expression (only 4-5 h after transfection!) is enough to cause these mislocalizations, we omitted work in this direction but rather concentrated on the endogenous protein and on the physiologically relevant situation in skeletal muscles.
We hope that you as editors and the reviewers will be content with the additional light microscopy imaging data of cav3 and syndapin III in muscles, which we added to the revised manuscript
The reviewers have gone to great lengths to suggest specific manuscript improvements, thus I am attaching the detailed comments in full, to aid in the revision process.
Thank you very much. We carefully went through all of them and improved the manuscript accordingly. Besides the above mentioned additional analyses and text changes, this also led to an increase of Figure Supplements from previously 1 to now 7 (plus 2 videos). We hope that you and the reviewers will appreciate our efforts and enjoy reading the improved manuscript.
1) The authors failed to mention that a model for syndapin II within caveolae was already described by Senju et al., 2015 and Hansen et al., 2011. Both studies showed that PACSIN II binds to EHD2 and is therefore recruited to caveolae, most probably to stabilize caveolar structures within the plasma membrane and not as trigger for the invagination process during caveolae generation.
We would like to refer the reviewer to the text of our manuscript. Although exclusively focusing on syndapin II in cell lines and not on the muscle-enriched isoform syndapin III, Hansen et al., 2011 was of course cited (introductory start of results). Careful reading of the paper published by Hansen et al., however, makes clear that these authors did not favor a caveolae stabilization model. Quote: “Rather, pacsin 2 appears to be specifically required for these microdomains to adopt the characteristic curved caveolar membrane profile”. Work of the Suetsugu lab on syndapin II was cited as well (Senju et al., 2011) in our quite extensive literature list (61 ref.).
We are aware of the fact that syndapin II binds to EHD2 and may thereby be recruited to caveolae; thank you for this note. Syndapin III, however, is different. As we have already shown in 2005 (Braun et al., 2005), syndapin I and II interact with EHD proteins but syndapin III does not because it lacks the required binding interface. This information is now included in the revised manuscript (including the additional references on this).
Hansen et al. also found a reduction of caveolae after knockdown of PACSIN II, but, in contrast to the present study, an increase of caveolin and cavin proteins in the membrane whereas in the current study, only cavin1 staining was increased in EM stainings of syndapin III KO cells.
Careful reading of the Hansen et al., 2011 paper leaves one with a picture more complicated than summarized by the reviewer, it seems. Hansen et al. indeed described some reduction of caveolae (defined as morphological profiles resembling caveolae in 2D) upon Pacsin2 RNAi. In contrast to that, however, the mean fluorescence intensity of the anti-cav1 and of the anti-cav2 staining per cell in TIRF images was reported as increased in the portion of RNAi cells selected for analysis due to their lower Pacsin2 epifluorescence. However, there was no statistical significance reported despite a 2fold (cav2) to 3fold (cav1) increase (Figure 6 in Hansen et al., 2011).
The CAVIN-1 data (Figure 7 in Hansen et al., 2011) is even harder to interpret, as it is presented as cav1/CAVIN-1 ratio. The curve maximum of intensity distributions per cell was shifted from about 0.33 in control to 0.42 in RNAi cells – thus by about a third (yet, this increase was described as decrease in the legend and text) – again lacking a statistical significance. It furthermore remains somewhat unclear to the reader what the cav1/CAVIN-1 ratio increase from 0.33 to 0.42 means for the absolute summed up CAVIN-1 signal per cell and for the anti-CAVIN-1 signal per cell membrane area (density) considering that cav1 levels were increased by factor 3. From this, it has to be concluded that there must have been more CAVIN-1 because with factor 3 more cav1 the maximum in the cav1/CAVIN-1 distribution curve (Figure 7 in Hansen et al., 2011) would have had to rise to about 0.9 instead of only reaching 0.42 in Pascin2 RNAi cells. Since the findings reported in Hansen et al., 2011 are difficult to report and interpret, the revised manuscript now very carefully describes and cites these particular observations of Hansen et al., 2011. We hope that the reviewer is content with the description and wording.
Apart from that, it has to be noted that Hansen et al. studied Pacsin2/syndapin II in HeLa and NIH3T3 cells and not syndapin III in muscle cells, as we did. The reviewer pointed out him/herself, that syndapin II will use molecular mechanisms completely different from those of syndapin III, as syndapin II can interact with the caveolar component EHD2, whereas syndapin III is unable to associate with EHD proteins (Braun et al., 2005).
Thus, instead of invoking a decreased formation of caveolae in the absence of syndapin III, one could explain the syndapin III ko phenotype also by an increased uptake of caveolae in the absence of syndapins III. The authors should address this issue by directly looking at caveolar dynamics in primary wt and syndapins III ko cardiomyoctes or muscle cells overexpressing caveolin-3.
We have carefully thought about the idea of the reviewer. It remained somewhat unclear to us how to relate the idea of a putatively increased uptake to the fact that we observed constant levels or even slightly increased levels of cav3 and CAVIN-1 at the plasma membrane (which are in line with increased or similar levels of cav1 and CAVIN-1 in HeLa cells described by Hansen et al. 2011).
Furthermore, one has to take into account two aspects: First, TIRF formally does not show internalization (which in other cell biological uptake processes e.g. can be proven by pH-sensitive tools or assays tracking chemical labeling access from the outside) but just addresses presence or disappearance from a TIRF zone, which is about 100-200 nm in depth. It thus usually remains open whether the fluorescence signal dissolves in the membrane (lateral dispersion of coat components), complexes disassemble in 3D (i.e. including dispersion into the cytosol), or whether a given signal leaves the TIRF zone by trafficking of some membrane compartment. Also, it remains unclear what the start situation is. Since the width of the PM is only 6-10 nm, not 200 nm, cortically localized, vesicle-docked components can reside in a TIRF zone without ever having been part of the PM.
Second, analyses of overexpressed GFP-cav3 seemed not advisable for two reasons: i) Hayer et al. 2010 (J. Cell Biol.) have revisited and extensively analyzed live imaging approaches and documented that live-imaging with GFP-caveolin leads to all sorts of artifacts, mainly to aberrant localizations of the fusion protein to non-caveolar surface pools as well as to different organelles of endosomal nature. The authors explicitly stated that even low expression (only 4-5 h after transfection!) is enough to cause these mislocalizations. ii) The low transfection rates achievable with primary cardiomyocytes or even with cultured muscle cell, as suggested by the reviewer, would lead to low n-numbers of cells accessible for analysis.
We thus rather concentrated on the endogenous protein and on the physiologically relevant situation in skeletal muscles to further address the idea of the reviewer that caveolae internalization is changed upon syndapin III KO and analyzed the intensity of intracellular cav3. The intracellular cav3 levels in muscle cells turned out to be unchanged, as addressed by quantitative immunofluorescence analyses of skeletal muscle sections (newly added Figure 12I of the revised manuscript).
These data are in line with the biochemical and EM data presented in our manuscript. The findings that the Triton-insoluble pool of cav3 was not changed (Figure 11R, 12K) and that the plasma membrane-associated pool was not changed in syndapin III KO animals (Figure 3O, 11Q and 12H,L) can only be related to the also unchanged general expression levels of cav3 (Figure 5), if also the intracellular pool of cav3 was unchanged.
2) Figure 3: A double staining of syndapin III and caveolin3 was used to prove the localization of sydapin III to caveolae. However, in the KO example picture (i), it is difficult to see the cav3 staining. More micrographs, especially for the KO, and the same magnifications for wt and KO should be used to support the result.
As documented by the bars (in both h and i panels 100 nm), the magnifications of WT and KO are identical.
We acknowledge that the anti-cav3 labels (10 nm gold) in Figure 3H and I – although highlighted by arrowheads – may have been hard to see. We have therefore now highlighted them with blue color (and the anti-syndapin III labels with red color) (revised Figure 3H,I).
We hope that the reviewer will agree with us that this makes it much easier to see the localization of cav3 and cav3 clusters as well as the cav3/syndapin III colocalization at caveolar structures, at shallow membrane indentations and at flat membrane areas. The unlabeled raw data sets are presented in the additionally added Figure 3—figure supplement 2 of the revised manuscript.
As far as some more data on colocalization of syndapin III with cav3 is concerned, we would also like to refer the reviewer to the quantitative analyses of confocal images of transversal muscle sections in the newly added Figure 1Q of the revised manuscript and to the analyses of longitudinal sections shown in the newly added Figure 12E-J. Furthermore we specified the frequency of colabeling at cav3 puncta in such longitudinal sections at the light microscopical level (newly added Figure 12M,N). Furthermore, we used quantitative electron microscopy to work this out in more detail (newly added Figure 3J (cardiomyocytes) and Figure 12C (skeletal muscle) of the revised manuscript).
Since the reviewer also requested to show even larger membrane areas to document the reduction of cav3-positive caveolar invaginations upon syndapin III KO (already the previous manuscript presented an enlarged membrane area when compared to WT to visualize this finding of our quantitative analyses), we furthermore added another KO picture to Figure 3I so that the revised Figure 3 now contains the panels I and I’. Besides this addition to the main manuscript, we also added the WT image of the large membrane area, from which the small insets (Figure 3H’ and H’’) have been taken, to the Supplements (newly added Figure 3—figure supplement 1).
Furthermore, the authors found no significant difference between WT and KO cav3 staining at the plasma membrane (m). However, electron microscopy may not be the best method to quantitatively evaluate protein densities if different cellular structures (e.g. invaginations versus flat membranes) with potentially different accessibilities of the antibody epitopes are stained. As described in point 1, some light microscopy-based methods would be desirable to support the claims of the authors.
As the reviewer considered it important to corroborate the findings we obtained by sophisticated EM methods not only by standard EM techniques and biochemical examinations but also by further light microscopical analyses, the revised manuscript now further strengthens our results with several light microscopical evaluations: The cav3 levels at the plasma membrane of muscle cells remained identical upon syndapin III KO and the intracellular cav3 levels also remained identical upon syndapin III KO (consistent with EM and quantitative biochemical examinations showing similar general expression and Triton-resistant levels of cav3) (newly added Figure 12H,L of the revised manuscript).
Quantitative, confocal analyses of longitudinal muscle sections furthermore revealed that also the cav3 content in “puncta” at the plasma membrane was similar in WT and syndapin KO muscle fibers (newly added Figure 12J of the revised manuscript).
In general, different accessibilities of antibodies at different places could of course always be a problem. This criticism of the reviewer, however, applies to all antibody-based methods in life sciences.
Furthermore, immunofluorescence labeling and imaging due to its low sensitivity for single molecules and due to its low resolution (especially in Z) is susceptible to thresholding and 3D artefacts.
More classical imaging methods, such as confocal microscopy, TIRF or even TEM of sections fail to firmly prove that an antibody label, i.e. the protein of interest, is not just by chance in the vicinity of the membrane (confocal, about 100-300 nm; TIRF area, 100-200 nm; TEM, resolution easily reaches 1-2 nm but antibody extensions are about 20 nm and no selection is obtained at the level of sample preparation). As explained in the manuscript, these disadvantages are circumvented by freeze-fracturing (only membrane-inserted material remains) and immunogold labeling (excellent resolution in Y,X and by shadowing, table tilting and/or tomography also good resolution in Z). Thus, quantitative analysis of immunogold labeled, freeze-fractured replica is a very accurate method of analysis.
Are Cav3 and cavin 1 still clustered?
As mentioned in the revised manuscript, Figure 3I, Figure 4F and Figure 5H suggest that this still is the case for both cav3 and CAVIN-1 at the plasma membrane in cardiomyocytes. More importantly, also in the tissue context (Figure 11N (heart) and Figure 12B (skeletal muscle)), cav3 clusters prevail upon syndapin III KO.
As this aspect may be of some mechanistic importance, we conducted a detailed cav3 cluster analysis directly in tissue samples of skeletal muscles. Interestingly, syndapin III KO led to a small (-7%) but significant drop of the density of cav3 within clusters accompanied with a reduction of cav3 clusters at the plasma membrane. Thus, syndapin III either directly or indirectly seems to have some importance for cav3 clustering, too (newly added Figure 12S,T).
Additional CAVIN-1 analyses at freeze-fractured muscle membranes unfortunately were not possible for technical reasons and/or CAVIN-1 in muscle cells shows too low expression. In fact, confocal immunofluorescence analyses of skeletal muscles suggested that CAVIN-1 expression is low at plasma membranes of muscle cells suggesting that a large part of the anti-CAVIN-1 immunosignal that one can e.g. see in western blotting of muscle samples predominantly may actually stem from satellite and endothelial cells (our unpublished results). We were, however, able to address the clustering of CAVIN-1 in dissociated syndapin III KO cardiomyocytes. Importantly, CAVIN-1 clusters clearly remained present in syndapin III KO and the density of CAVIN-1 immunolabels in the clusters increased accordingly to the overall increase of CAVIN-1 at the plasma membrane (newly added Figure 5J). Thus, even clustered cav3 and CAVIN-1 at the plasma membrane is not sufficient for bringing about caveolae, if syndapin III is absent.
In fact the CAVIN-1 cluster densities even increased (newly added Figure 5K). This may be caused by the increased levels of CAVIN-1 at the plasma membrane already described in the previous version of the manuscript (Figure 5I). An increased percentage of the more abundant CAVIN-1 clusters in syndapin III KO cardiomyocytes, however, were cav3-negative (newly added Figure 5L).
3) Surface invaginations, caveolae, and syndapin III.
The authors use freeze-fracture and immunogold analysis to detect caveolae and the presence of syndapin III and caveolin3 at invaginations. A number of quantifications are shown, but rather than absolute quantifications, only relative quantifications between wt/ko are shown. What should in addition be shown are
- The fraction of invaginations positive for cav3 over total invaginations (are all total invaginations actual caveolae?
The revised manuscript now shows that 58% of all invaginations in cardiomyocytes are anti-cav3-labelled. It also shows that only 9% are non-caveolar structures (newly added Figure 3J,M of revised manuscript).
In skeletal muscles, non-caveolar structures only account for 1% of all invaginations. 96% of all invaginations are anti-cav3 labelled (newly added Figure 12C,D of revised manuscript).
- The fraction of invaginations positive for sdp III over total invaginations
In cardiomyocytes, 91% of all invaginations are deep caveolae and shallow indentations of caveolar appearance marked by cav3. 58% of all invaginations are syndapin III-positive and have caveolae-like (deep and shallow) profiles (the majority of them also proven as caveolae by associated cav3 signals) (newly added Figure 3J).
An additional 1% are anti-syndapin III-positive non-caveolar structures (newly added Figure 3J and M).
In skeletal muscles, anti-syndapin III labeling is less effective but still 20% of all invaginations (99% caveolar; 96% further proven by cav3 association) are syndapin III-positive deep and shallow caveolar profiles.
An additional 0.5% represent syndapin III-positive invaginations of non-caveolar nature (newly added Figure 12C and D)
- The fraction of invaginations positive for both cav3 and sdp3 over total invaginations.
The cell types used in Figure 3, Figure 9 and Figure 12 might have other invaginations (clathrin-coated, non-coated), whose abundance should not be affected by Sdp III KO.
Double labelings are of course usually not so easy at the high resolution of EM but 35% of all caveolae are double-positive for sdp3&cav3 in cardiomyocytes (newly added Figure 3J). In muscles, 19% of all invaginations are double-positive for syndapin III and cav3, i.e. almost all syndapin III-positive structures also are positive for cav3 (newly added Figure 12C).
In both cases, all of these double-labelled invaginations are of caveolar morphology (newly added Figure 3J and 12C).
Additional analyses at the light microscopical level confirmed this. 32% of all cav3-enriched fields/puncta at the plasma membrane of longitudinal muscle sections were positive for syndapin III (newly added Figure 12M,N).
Hansen et al., 2011 reported that in cell lines “Co-staining of pacsin 2 and caveolin 1 revealed that many, but not all, caveolin 1 puncta also contain pacsin 2 (Figure 2A). Approximately 35% of caveolin 1 puncta were positive for pacsin2”. Thus, our quantitative data for muscle tissues and cav3/syndapin III seem to be consistent with the estimation reported for the syndapin II isoform and cav1 in non-muscle cells at the light microscopical level.
The (very low) abundance of the non-caveolar invaginations we detected was not significantly affected by syndapin III KO. In both cardiomyocytes and skeletal muscle tissue, there was no statistically significant difference between WT and KO (newly added Figures 3M and 12D).
Since EM techniques allow only for fractions of cell surface areas to be examined, it would be informative to additionally determine the fraction of Sdp III-positive cav1- or cavin1-positive puncta on the surface of cultured cells using immunofluorescence of endogenous proteins (as in #2 above).
The reviewer probably means cav3 and not cav1, as we have demonstrated that cav1 and syndapin III are not coexpressed. Figure 4 shows that cav1 is only present in non-muscle cells and cav3 and syndapin III are expressed in muscle cells.
In case of cav3, as already described above, we conducted such immunofluorescence analyses during our revision work and observed that at the level of light microscopical resolution 32% of all anti-cav3 puncta are immunopositive for endogenous syndapin III in confocal microscopy analyses of longitudinal muscle sections (please see newly added Figure 12M,N). As also already mentioned above, this is somewhat reminiscent of the estimation reported by Hansen et al., 2011 for syndapin II/Pacsin2 and cav1.
4) Caveolar and non-caveolar functions of caveolar coat components.
Knockout of Syndapin III/Pacsin3 causes loss of morphological caveolae, but not of caveolins or cavins. Based on this finding, the authors strongly emphasize that this situation uniquely allows them to disentangle the regulatory/signaling functions of caveolar coat components from the physiological role of caveolae as invaginated membrane structures. However, in this study they do not directly compare syndapin III/Pacsin3 knockout mice with caveolin3 knockout mice side-by-side and rely for their comparison on data from other studies. The authors state that "… syndapin III KO skeletal muscles showed pathological parameters upon physical exercise that are also found in CAVEOLIN3 mutation-associated diseases.", i.e. the effects of syndapin III KO are similar to a loss of caveolin3 function. We are surprised that such strong emphasis is placed on the separation of the functions of caveolar invaginations vs coat components, when no dramatic differences were found. This point could be addressed by text changes alone.
We hope that the changes we made to the revised manuscript will help to prevent such misunderstandings. The skeletal muscle defects mirror cav3 defects, i.e. indeed reflect the loss of caveolar functions.
In contrast, e.g. in the heart and in the case of ERK1/2 signaling, the results of syndapin III KO – despite the strong reduction of caveolar structures – do NOT mirror the effects of caveolin deficiency. This strongly suggest that those impairments observed upon caveolin deficiency rather reflect a lack of caveolin at the membrane (or are indirect consequences of this) rather than reflecting a loss of caveolar structures and their functions. Thus, here we can for the first time dissect biological functions of caveolar invagination from those merely reflecting caveolin presence. For understanding the pathophysiology of caveolinopathies this is of utmost importance. Also, it may focus therapeutic efforts at parameters one may actually have a chance of influencing.
5) DRM association of dystrophin and dystroglycan (Figure 8).
The authors cite previous work that loss of caveolin3 has been associated with loss of DRM association of the dystrophin-glycoportein complex and therefore aimed at testing whether syndapin III KO caused a similar defect. In their experiments, however, even in wt animals, neither dystrophin nor β-dystroglycan floated on density gradients (Figure 8 C,E). Since there was no DRM association in lysates from WT tissues, it is impossible to determine or conclude whether syndapin III is necessary for DRM association of dystrophin or β-dystroglycan. DRM association depends on the sample/detergent ratio, the precise lysis conditions, and is therefore difficult to interpret, even more so when no DRM association is observed. In our view panels c-f do not provide significant insight and should be removed from the manuscript.
The reviewer is right. Indeed we found it quite surprising that the DRM association of dystrophin and β-dystroglycan reported in the literature obviously is not robust and therefore a hard to interpret caveolin loss-of-function phenotype. Although we think that the reviewer will agree with us that the results we obtained were correctly described in the previous version of the manuscript, we omitted these findings from the revised manuscript, as the reviewer requested (please see revised Figure 8).
6) DRM association of cav3 and flotillin (Figure 7).
Figure 7 shows that Sdp III KO causes a change in flotation behavior of caveolin3 where the floating fraction(s) shift by two fractions towards the bottom of the gradient in Sdp III KO tissues: From fraction 3 to 5 in skeletal muscle, and from 4-6 in the heart. Flotillin1, which should not be associated with caveolar membranes, also shifts by two fractions towards the bottom of the gradient in KO tissues. The authors find support for their model that Sdp III is required specifically for organizing cav3-containing membrane domains. One could equally conclude that Sdp III is required for organizing flotillin1-containing membrane domains. Could the authors explain why they are convinced Sdp III is not involved in organizing flotillin1-containing membrane domains?
However, rather than questioning the specific role of Sdp III in caveola formation, to me this demonstrates how little can be concluded from DRM association assays. Flotillin1 might associate with caveolin-containing membranes post lysis during the centrifugation and its co-floating and shifting with cav3 may not have any biological meaning. Figure 7D-I in our view add little information to the manuscript. In the future (not required here), a more informative way for assessing the assembly state of the caveolar coat could be velocity gradients as used by the Helenius and Nichols labs (PMID: 20070607, PMID: 24013648).
We thank the reviewer for his/her advice on future biochemical examinations using velocity gradients instead of classical DRM association assays.
We agree with the reviewer that DRM association assays indeed often are difficult to interpret and that flotillin associations even may be post lysis. Although this would still suggest that some alterations of the protein/lipid composition and/or the organization of cav3-containing membrane domains occur upon syndapin III KO (and only this point was made by the flotillin observation in the previous manuscript), we followed the advice of the reviewer and let out the flotillin data to not confuse readers (revised Figure 7D-G).
Whether the flotillin effects are post-lysis artifacts, are indirectly somehow dependent on cav/lipid/syndapin III nanodomains or are independently caused by syndapin III KO, can currently not be answered and would be way beyond the scope of the current manuscript focusing on caveolar invagination and caveolar function in vivo.
7) The manuscript contains many experiments, but the organization is sometimes confusing and difficult to follow. For example, the authors often jump in between tissue and cell culture experiments for heart and muscle. It may be easier to show the immuno-stainings of syndapins III in heart and muscle directly behind the cardiomyocyte stainings (e.g. combine Figure 1, 4, 11, 12).
The reviewer is right that our manuscript contains a lot of data and it is acknowledged that some of the figures, such as Figure 4 and 9 (maybe even Figure 8 and 11 as well) in other high-profile journals only accepting fewer main figures could probably have been supplementary figures rather than integrated into the main manuscript as it is the policy of eLife.
Our report starts with the discovery of a striking cell biological phenotype of a new KO mouse and then in detail and step by step unveils the mechanistic principles behind these impairment to provide a full picture of the cell biological and molecular details. Finally, after the cell biology is understood, the manuscript then reports on examinations addressing the physiological relevance at the animal level. In your eyes, this design of our study and this structure of our manuscript is very much appropriate for a high-ranking journal, such as eLife, which publishes comprehensive studies on important cell biological processes.
To organize the data a little bit more according to the cellular system analyzed and less according to scientific question, as the reviewer suggested, we have moved the biochemical examinations of cav3 in heart and skeletal muscles, which previously was part of the cardiomyocyte-Figure 3 into the figures that deal with heart tissue analyses (Figure 11) and with examinations of cav3 and caveolar functions in skeletal muscle tissues (Figure 12), respectively (inserted panels Figure 11R and 12K (from Figure 3N,O).
It would also be easier to first describe the localization of syndapin III at caveolae before showing the reduced caveolar numbers in syndapin III ko cells.
The localization of syndapin III at caveolae is shown before the reduced numbers of caveolae in syndapin III cells are examined and described in detail. Please see Figure 3 and Figure 3—figure supplements and the respective Results text of the revised manuscript.
The previously described localization of syndapin II at caveolae should be mentioned in the Introduction.
We tried to move cited work on other syndapin isoforms – especially on syndapin II and cav1 – forward from Results and Discussion into the Introduction. However, the introduction focuses on CAV3 mutations and caveolinopathies and not on syndapins. Therefore, we did not find a reasonable solution for including information on the other syndapin isoforms and their similar and different functions and their different protein properties without disrupting the flow of the Introduction or expanding its length significantly. We hope the reviewer will be content with the changes we made to the revised manuscript to discuss work on syndapin II.
Figure 1: The immunofluorescence experiments in c-e and i are difficult to recognize, the size of the pictures should be increased.
All of these panels have been slightly increased in size in the revised manuscript (see revised Figure 1C-E, I). In addition, the localization of syndapin III in membrane folds and mCherry-F-marked plasma membrane domains can now be seen better in a magnified inset placed into the revised Figure 1E.
The increased Figure 1C-E and Figure 1I panels can in addition be found at significantly higher magnification in the Supplements (newly added Figure 1—figure supplement 1 and Figure 1—figure supplement 2).
Also the pictures in p and q are difficult to analyze – it would be helpful if colocalisation of syndapin III and caveolin3 was investigated in more detail, e.g. using increased magnification during confocal microscopy, colocalisation analysis within ImageJ or ZEN software (see above).
We have done this in two ways. First, we did not just run colocalization analyses on the images 1p and 1q shown, as the reviewer suggested, but conducted systematic analyses of transversal muscle sections and in total analyzed 230 PM ROIs and 160 intracellular ROIs. For the plasma membrane, the Pearson coefficient was positive and very high (0.55). Intracellularly, the correlation was just random, i.e. around zero (0.08). These quantitative analyses of the localization of cav3 and syndapin III in confocal image stacks of transversally cut skeletal muscles are now included in the revised manuscript (newly added Figure 1Q).
Second, we have analyzed the frequency of syndapin III in cav3-positive membrane domains in more detail using EM (newly added Figure 3J (cardiomyocytes) and newly added Figure 12C (skeletal muscle)) as well as by additionally employing confocal immunofluorescence microscopy of longitudinal sections of skeletal muscles to further increase the resolution of such light microscopical colocalization studies (newly added Figure 12E-G,J). Also these different colocalization studies were evaluated quantitatively.
The confocal microscopy analyses clearly showed the presence of syndapin III at a subpopulation of caveolae (Pearson coefficient for 60 puncta ROIs in longitudinal sections still positive, 0.3; newly added Figure 12E-G). Depending on the biological systems analyzed, the frequencies of syndapin III labeling also were very good. 32% of the endogenous anti-cav3 puncta were also positive for syndapin III at the lower light microscopical resolution (newly added Figure 12m,n). At the EM, level, syndapin III immunolabeling was observed at 20% of all invaginations in cryo-preserved and freeze-fractured skeletal muscles (all of caveolae-like profile; 19% also proven to represent caveolar structures by cav3 association; newly added Figure 12C) and at 59% of all invaginations in cardiomyocytes (58% caveolae-like syndapin III-positive, only 1% non-caveolar and syndapin III-positive; newly added Figure 3J).
Figure 2: As the authors acknowledge, the displayed EM pictures are of rather bad quality, so that caveolae cannot be precisely distinguished. Are these pictures essential?
We hope that also the reviewer will acknowledge that it is not the images presented that are of bad quality but that this type of analysis just has several technique-immanent limitations. This is also what we wrote in the manuscript. The pictures therefore just highlight these technique-immanent limitations.
Furthermore, TEM of sections is a standard method used in the field and we therefore had to compare our phenotypical analysis with this standard technique additionally to presenting the much more informative, quantitative analysis of large areas of membrane by immunolabeling of freeze-fractured samples – i.e. use a more sophisticated method only few labs in the world have established.
Figure 2: The western blots for syndapin I (d) are difficult to interpret because the GAPDH signal used as loading control is very weak and no GAPDH band can be detected for the heart lysates – the authors used 50 ug/lane, so there should be a very strong signal for GAPDH. Further, the number of investigated WT and KO mice used for the western blot analysis is missing in the figure legends.
GAPDH in heart indeed was very weak. We have redone this and have replaced Figure 2D by a data set, which shows GAPDH more clearly in all tissue tested (revised Figure 2D).
The missing n-number information has been added to the legends of Figure 2, 5 (both n=12 each genotype) and 11 (n=6 each genotype) in the revised manuscript.
Figure 5: In G/H, the colocalization of cavin1 and caveolin3 is difficult to see. Further, the authors mentioned clustered cavin1 protein which is also not well seen in the two examples.
We acknowledge that in particular the anti-cav3 labels (10 nm gold) were hard to see in Figure 5G and H. We have therefore now highlighted them with blue color (and the anti-CAVIN-1 labels with green color) (revised Figure 5G,H). The unlabeled raw data is presented in the additionally added Figure 5—figure supplement 1.
Some examples of CAVIN-1 clusters are marked by arrowheads.
The graphs a-f can be reduced in size and more detailed EM labeling pictures for both wt and KO can be shown in the supplement to support the results.
The graphs in A,B,D and F were reduced in sized and both the 10 nm and the 15 nm immunogold in the EM pictures were labelled in the revised Figure 5. Further images for both WT and KO have been added (see newly added Figure 5—figure supplement 1).
Figure 6: The 3D reconstruction images show the localization of syndapin III within caveolae. The authors therefore claim that syndapin III is responsible for the invagination process. However, for this model, it is quite surprising to see that only two molecules of syndapin III are detected, and only at one side/part of the caveolae. How can invagination be supported by syndapin III, if it is not found around the whole neck of caveolae? The authors should comment on this in their discussion.
Obviously much less syndapin than caveolin coat proteins are needed for invagination. This is expected because syndapin III is not a general coat component, as seen in the tomographs.
It is conceivable that induction of membrane curvature at a nanodomain (generated by syndapin III self-association) is enough to trigger caveolin coat assembly and/or bending. Once such an invagination is triggered, the coat component cav3 (presumably with the help of further factors) may then propagate this further. As requested by the reviewer, this is now discussed in more detail in the revised manuscript.
Figure 8: The authors wrote in the figure legend: ' not all described cav3 loss-of-function[…]' If we understand the results described in this study, none of the previously published cav3 KO phenotypes was found in the syndapin III KO mouse?
Please see our answer above, this may be a misunderstanding. As shown in Figure 13, syndapin III KO does cause phenotypes reminiscent of muscle dystrophies seen in caveolinopathies. Thus, there are certain caveolin loss-of-function phenotypes that are clinically important and mirrored very well by syndapin III KO.
In contrast, some other phenotypes previously also attributed to the lack of caveolae were not seen upon a loss of caveolar invaginations in syndapin III KO, i.e. may rather reflect a loss of caveolin membrane hubs as such but not the functions of caveolae as such. These data are summarized in Figure 8 as far as molecular/cell biological findings are concerned (in both heart and muscle). Besides the missing changes in ERK1/2 signaling, detailed analyses did not show the reported changes in the membrane association and the levels of dystrophin/β-dystroglycan (Figure 8). Figure 11 follows this up at the physiological level and finds no phenocopy in the heart (Figure 11).
Figure 11: Picture g, KO heart section is not well chosen, because the right ventricle is somehow cut or enrolled.
Indeed, the heart section that was presented in Figure 11G in the previous manuscript for left ventricle analyses was not optimal for the other, the right ventricle. We replaced Figure 11G,F by a new pair of images (see revised Figure 11F,G).
Figure 13: The muscle cell size in KO sections (c) seems to be increased. Did the author further analyze this?
The caliber spectrum was analyzed in detail. We would like to refer the reviewer to Figure 13I-L.The caliber spectrum is changed in untrained syndapin III KO mice. These defects can be compensated for by training but this comes at the expense of detached nuclei and events of cellular damage in the tissue (Figure 13H and 13C-F).
Discussion:
In the Introduction, the authors suggest that caveolae and caveolin 3 function can now be better dissected, but the discussion for this is quite vague and could be extended (e.g. what do we learn?). Do the authors envisage a similar scenario for caveolin1-related caveolae in different tissue in relation to PACSIN II?
This is now covered in more detail in the discussion of the revised manuscript.
Syndapin II is quite different from syndapin III, as for example syndapin II interacts with EHD proteins and syndapin III does not (Braun et al., 2005). EHD2 seems to play some important role for caveolae, too. Thus, it is an open question whether syndapin II has functions in cav1-positive cell systems that are similar to and as critical as those of syndapin III in muscle cells.
Apart from that, it also is an open question whether syndapin II loss-of-function phenotypes, that manifest at the cellular level (Hansen et al., 2011; Koch et al., 2012), have consequences at the physiological level that are similar and/or as clear as those observed for syndapin III KO in our study. To a large part, this may depend on whether membrane shaping proteins that are functionally/structurally somewhat related to syndapin II will be able to take over (some of) syndapin II’s functions in cav1 expressing cells.
As we demonstrated in our study, for syndapin III and cav3 such compensatory mechanisms seem not to exist.
Materials and methods:
Statistical analysis should be described in more detail in the Materials and methods part, e.g. which statistical test and methods were used (t -test vs. Mann-Whitney-U test, distribution analysis of the data sets,..).
The statistical tests are specified for all individual figure panels in the figure legends. We also added the information that besides testing for statistical significance also testing for normal distribution of data (=> t-test) or not (=> Mann-Whitney-U) has been done with Prism6.
Legends for Videos 1 and 2 refer to the wrong figure (it should be Figure 6, not Figure 5).
We apologize for this embarrassing error in the legends of the supplementary movies and sincerely thank the reviewer for his/her thorough review and for pointing this out. The mistake has been corrected in the revised manuscript.
https://doi.org/10.7554/eLife.29854.036Article and author information
Author details
Funding
Deutsche Forschungsgemeinschaft
- Christian A Huebner
Deutsche Forschungsgemeinschaft (KE685/3-2)
- Michael M Kessels
Deutsche Forschungsgemeinschaft (QU116/6-2)
- Britta Qualmann
Deutsche Forschungsgemeinschaft (RTG1715)
- Britta Qualmann
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
This work was supported by grants from the Deutsche Forschungsgemeinschaft to CAH, MMK and BQ. We thank R Ahuja, A Büschel, K Häßler, A Hübner, A Kreusch, B Schade, M Öhler, C Scharf, K Schorr, T Laudage, F Steiniger, D Koch and D Wolf for technical help and support as well as C Hennings and J von Maltzahn for advice.
Ethics
Animal experimentation: All animal procedures were performed in strict compliance with the EU directives 86/609/EWG and 2007/526/EG guidelines for animal experiments and were approved by the local government (permission numbers: 02-011/10 for generation and establishment of syndapin III KO mice; 02-057/14 (18.09.2014)/Änderungsbescheid I (19.02.2015) for motor training; Thüringer Landesamt, Bad Langensalza; Germany).
Reviewing Editor
- Suzanne R Pfeffer, Stanford University School of Medicine, United States
Publication history
- Received: June 22, 2017
- Accepted: November 14, 2017
- Version of Record published: December 5, 2017 (version 1)
Copyright
© 2017, Seemann et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 1,060
- Page views
-
- 187
- Downloads
-
- 22
- Citations
Article citation count generated by polling the highest count across the following sources: Crossref, Scopus, PubMed Central.