(A) Mutual antagonism between DRM/LIN-15B transcription factor and PRC2/MES-4 chromatin modifiers balances activities that promote somatic (red) and germline (green) gene expression. In somatic …
(A) Bar graph showing results of quantitative RT-PCR of 11 genes significantly misexpressed in nos-1(gv5)nos-2(RNAi) PGCs. (*p<0.05 using Student’s t-test). (B–C) Transcriptome comparison between …
(A–B) Transcriptome comparison between PGCs isolated from wild-type embryos and wild-type L1 larvae. (A) Volcano plot showing log2 fold-change in transcript abundance for each gene. The numbers of …
(A) XY scatter plots showing correlation of gene expression between wild-type embryonic PGCs (X axis) and oocyte transcriptome (Y axis) (Left panel) and correlation of gene expression between …
Photomicrograph of embryos hybridized with single molecule fluorescence probes (red) against mex-5 and C01G8.1. Wild-type, nos-1(gv5)nos-2(ax3103) and nos-1(gv5)nos-2(ax3103);lin-15B(n744) embryos …
R code for comparing transcriptome between oocyte and embryonic blastomeres.
PCA of biological replicates from different development stages and library preparation methods across two principal components (PC1 and PC2). (A) PCA of embryonic samples [embryonic PGCs and somatic …
(A) Histogram showing the distribution of log2 fold change in gene expression between nos-1(gv5)nos-2(RNAi) (designated as nos-1/2) and wild-type L1 PGCs for 221 genes that acquired new ATAC-seq …
(A) Heat map showing accumulated ATAC-seq reads of 1430 genes (Y axis) that are upregulated genes in nos-1(gv5)nos-2(RNAi) L1 PGCs compared to wild-type (as determined by Truseq, see Figure 1—figure …
(A) PCA of ATAC-seq peaks between replicates. (B) Scatter plots comparing the ATAC-Seq peak scores (RPKM) between replicates. RPKM values for each replicate were obtained from DiffBind analysis. The …
(A–B) Transcriptome comparison between PGCs isolated from wild-type and mes-4(RNAi) L1 larvae. See Figure 4—figure supplement 2 for comparison between wild-type and mes-2(RNAi). (A) Volcano plot …
(A) Bar graph showing chromosomal distribution of nos-1(gv5)nos-2(RNAi) upregulated genes (fed L1, Truseq libraries). Asterisks indicate significantly more genes than expected (hypergeometric test, …
Transcriptome comparison between PGCs isolated from wild-type and mes-2(RNAi) L1 larvae. (A) Volcano plot showing log2 fold change of gene expression between mes-2(RNAi) and wild-type L1 PGCs. The …
(A) Bar graph showing the % sterility at 20°C among progenies of hermaphrodites with the listed genotypes. lin-15B(n744) and lin-35(n745) are null alleles(Ferguson and Horvitz, 1989; Lu and Horvitz, …
(A) Bar graphs showing percent sterility among worms of the indicated genotypes. Black bars: nos-1(gv5)nos-2(ax3103) mutant were fed with bacteria expressing dsRNA to genes indicated and the …
(A,B) Schemes for testing maternal effect sterility of mes-2(ok2480);lin-15B(n744) and mes-4(ok2326);lin-15B(n744) animals. (A) First generation (F1) mes-2(ok2480);lin-15B(n744) animals were derived …
Bar graphs showing percent sterility among animals with indicated genotypes and RNAi treatments. N2, lin-15B(n744) and nos-1(gv5)nos-2(ax3103);lin-15B(n744) were fed with bacteria expressing dsRNA …
(A) Photomicrograph of a dissected wild-type gonad stained with anti-LIN-15B antibody and DAPI for DNA. LIN-15B protein is detected at the end of the pachytene region and in all oocyte nuclei. (B) …
(A) Photomicrograph of 2 cells wild-type and lin-15B(n744) embryos stained with α-LIN-15B antibody. α-LIN-15B is specific as no nuclear signal was detected in lin-15B(n744) embryos. (B) Cartoon …
(A–B) Mating schemes to characterize the maternal and zygotic contribution of lin-15B in nos-1(gv5)nos-2(ax3103). lin-15B genotypes were determined by Sanger sequencing (See key resources table for …
Box and Whisker plot showing log2 fold change compared to wild-type of different gene sets as depicted under each plot. Each box extends from the 25th to the 75th percentile, with the median …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
strain, strain background (C. elegans) | JH1270 | Subramaniam and Seydoux (1999) | RRID:WB-STRAIN:JH1270 | nos-1(gv5) |
strain, strain background (C. elegans) | JH3103 | This study | nos-1(gv5); lin-15A(n767) | |
strain, strain background (C. elegans) | TH206 | (http://www.modencode.org). | RRID:WB-STRAIN:TH206 | unc-119(ed3) III; ddEx16 |
strain, strain background (C. elegans) | JH3099 | This study | unc-119(ed3) III; ddEx16 out cross x2 | |
strain, strain background (C. elegans) | MT1806 | CGC | RRID:WB-STRAIN:MT1806 | lin-15A(n767) |
strain, strain background (C. elegans) | PFR40 | CGC | RRID:WB-STRAIN:PFR40 | hpl-2(tm1489) |
strain, strain background (C. elegans) | MT2495 | CGC | RRID:WB-STRAIN:MT2495 | lin-15B(n744) |
strain, strain background (C. elegans) | MT10430 | CGC | RRID:WB-STRAIN:MT10430 | lin-35(n745) |
strain, strain background (C. elegans) | MT11147 | CGC | RRID:WB-STRAIN:MT10430 | dpl-1(n3643) |
strain, strain background (C. elegans) | JH3109 | This study | nos-1(gv5); hpl-2(tm1489) | |
strain, strain background (C. elegans) | JH3119 | This study | nos-1(gv5); lin-35(n745) | |
strain, strain background (C. elegans) | JH3121 | This study | nos-1(gv5); lin-15B(n744) | |
strain, strain background (C. elegans) | JH3141 | This study | nos-1(gv5) dpl-1(n3643) | |
strain, strain background (C. elegans) | JH3357 | This study | nos-2(ax3103) | |
strain, strain background (C. elegans) | JH3367 | This study | nos-1(gv5) nos-2(ax3103)/MnC1 | |
strain, strain background (C. elegans) | JH3401 | This study | nos-1(gv5); nos-2(ax3103); lin-15B(n744) | |
strain, strain background (C. elegans) | JH3428 | This study | mes-2(ax2509 [mes-2::GFP]); tagRFP::glh-1 | |
strain, strain background (C. elegans) | JH3436 | This study | tagRFP::glh-1; nos-1(gv5); lin-15B(ax3104) | |
strain, strain background (C. elegans) | JH3484 | This study | mes-3(ax3105 [mes-3::OLLAS]) | |
strain, strain background (C. elegans) | JH3486 | This study | mes-3(ax3105 [mes-3::OLLAS]); nos-1(gv5) nos-2 (ax3103)/MnC1 | |
strain, strain background (C. elegans) | JH3203 | CGC | RRID:WB-STRAIN:JH3203 | mes-2(ax2059 [mes-2::GFP]) |
strain, strain background (C. elegans) | JH3510 | This study | mes-2(ax2509[mes-2::GFP]); tagRFP::glh-1; nos-1(gv5) nos-2(ax3103)/MnC1 | |
strain, strain background (C. elegans) | JH3513 | This study | gtbp-1(axls3105[gtbp-1 prom::GFP-H2B::lin-15B 3'utr]); tagRFP::glh-1; nos-1(gv5) nos-2(ax3103)/MnC1 | |
strain, strain background (C. elegans) | JH3531 | This study | dpl-1(n3643) nos-1(gv5)nos-2(ax3103) | |
strain, strain background (C. elegans) | JH3538 | This study | lin-35(n745); nos-1(gv5) nos-2(ax3103) | |
strain, strain background (C. elegans) | VC2409 | CGC | RRID:WB-STRAIN:VC2409 | mes-2(ok2480)/mT1 II; +/mT1 [dpy-10(e128)] III |
strain, strain background (C. elegans) | VC1874 | CGC | RRID:WB-STRAIN:VC1874 | mes-4(ok2326) V/nT1[qls51] (IV;V) |
strain, strain background (C. elegans) | JH3357 | This study | nos-2(ax3103). Deletion of nos-2 ORF. See Supplementary file 6 for description. | |
strain, strain background (C. elegans) | JH3436 | This study | lin-15B(ax3104). lin-15B prom::GFP-H2B::tbb-2 3'UTR. See Supplementary file 6 for description. | |
strain, strain background (C. elegans) | JH3484 | This study | mes-3(ax3105). mes-3::OLLAS. See Supplementary file 6 for description. | |
antibody | K76 | DSHB,PMID:28787592 | RRID:AB_531836 | (1:15) |
antibody | Anti-FLAG M2 | Sigma-Aldrich Cat# F3165 | RRID:AB_259529 | (1:200) |
antibody | Donkey-anti-mouse IgM 647 | Jackson Immuno Research Labs | RRID:AB_2340861 | (1:400) |
antibody | Goat anti-Rabit IgG (H + L) 568 | Molecular probes cat# A-11011 | RRID:AB_143157 | (1:400) |
antibody | Anti-OLLAS-L2 | Novus cat# NBP1-06713 | RRID:AB_1625979 | (1:200) |
antibody | anti-LIN-15B | other | gift from Dr. Susan Strome, SDQ3183 1:40,000 | |
antibody | anti-MES-4 | other | gift from Dr. Susan Strome. (1:400) | |
antibody | anti-OLLAS | other | gift from Dr. Jeremy Nathans (1:80) | |
sequence-based reagent | oCYL584 | This study | GAUCUUCUAGAAAGAAUCUU; crRNA cut at 3' end of nos-2 | |
sequence-based reagent | oCYL669 | This study | AGAGUCGAAGUCGGUUCACU; crRNA cut at 5' end of nos-2 | |
sequence-based reagent | oCYL823 | This study | GCACUGCUACUGCUGGAAGU; crRNA cut at 5' end of lin-15B | |
sequence-based reagent | oCYL957 | This study | GGGAUAAUCTAAUUAGAAGA; crRNA cut at 3' end of mes-3 | |
sequence-based reagent | AP691 | Paix et al. (2015) | GGCCTTAACCCAGAATAAGA; crRNA cut at 5' end of gtbp-1 | |
sequence-based reagent | AP728 | Paix et al. (2015) | CACGAGGTGGTATGCGCAG; crRNA cut at 3' end of gtbp-1 | |
sequence-based reagent | oCYL251 | This study | TGGAAAGTTGAGTGTGAGCA; Forward K08A8.1 RT-PCR primer | |
sequence-based reagent | oCYL252 | This study | GGAGAATGTTTGATGGCTTCAC; Reverse K08A8.1 RT-PCR primer | |
sequence-based reagent | oCYL259 | This study | CCTGAGAAGAAGCTGCAAATG; Forward W02A11.8 RT-PCR primer | |
sequence-based reagent | oCYL260 | This study | TTTATGTCCTTTGGCAAAACGG; Reverse W02A11.8 RT-PCR primer | |
sequence-based reagent | oCYL304 | This study | CTGCTATTGTGAAGTCTCCTG; Forward B0416.5 RT-PCR primer | |
sequence-based reagent | oCYL305 | This study | CCATTTGTGGCTTACTAGCG; Reverse B0416.5 RT-PCR primer | |
sequence-based reagent | oCYL308 | This study | TGTCAGTTTGTGATGTGCTG; Forward C35C5.3 RT-PCR primer | |
sequence-based reagent | oCYL309 | This study | GCTTCAAAATCGTCCTTTTCATG; Reverse C35C5.3 RT-PCR primer | |
sequence-based reagent | oCYL738 | This study | ACTGGACGATTTCAACGGAG; Forward lin-15B RT-PCR primer | |
sequence-based reagent | CYL739 | This study | ACATACTGCACAGCGACG; Reverse lin-15B RT-PCR primer | |
sequence-based reagent | oCYL994 | This study | AGTCGGTATTTTGAATGCGG; Forward lsd-1 RT-PCR primer | |
sequence-based reagent | oCYL995 | This study | CGTTTCCGAGTGATCTGATTG; Reverse lsd-1 RT-PCR primer | |
sequence-based reagent | oCYL998 | This study | AATCCGTTTGACTATGAGTGG; Forward W05H9.2 RT-PCR primer | |
sequence-based reagent | oCYL999 | This study | TCGTTTAGAAGCTACAATGACAG; Reverse W05H9.2 RT-PCR primer | |
sequence-based reagent | oCYL1006 | This study | GAAGTTACCCGTCGCAAG; Forward F28H6.4 RT-PCR primer | |
sequence-based reagent | oCYL1007 | This study | GCCACTGTTTTGTAATCCCG; Reverse F28H6.4 RT-PCR primer | |
sequence-based reagent | oCYL1010 | This study | ACTTTGCGATAAACTCCCTTC; Forward tag-299 RT-PCR primer | |
sequence-based reagent | oCYL1011 | This study | GCTTGCAGACACGAAGATAAG; Reverse tag-299 RT-PCR primer | |
sequence-based reagent | oCYL1020 | This study | CGAATGCGGACATCTTAATCC; Forward lnp-1 RT-PCR primer | |
sequence-based reagent | oCYL1021 | This study | GTTGACGGCTTCTGATTCTC; Reverse lnp-1 RT-PCR primer | |
sequence-based reagent | oCYL1044 | This study | TGGTTATGTGCAACACTTGG; Forward sygl-1 RT-PCR primer | |
sequence-based reagent | oCYL1045 primer | This study | TCTCGCTACGATCCTTCTTC; Reverse sygl-1 RT-PCR | |
sequence-based reagent | oCYL438 | This study | CAGCTCGAAACCTGAAAATTGT;Forward PCR primer for nos-2 locus. 179 bp upstream of nos-2 ATG. | |
sequence-based reagent | oCYL734 | This study | GCCATCACCTATGCGATTTG; Reverse PCR primer for nos-2 locus. 468 bp after nos-2 STOP. | |
sequence-based reagent | oCYL735 | This study | GTTGTGGCGGAAAGGAATAC; Reverse PCR primer for nos-2 locus, 154 bp after nos-2 ATG. | |
sequence-based reagent | oCYL43 | This study | ATGTTGATTTTCAGGACTTCTC; Forward PCR primer for nos-1 locus. seq from + 1- + 22 | |
sequence-based reagent | oCYL45 | This study | ACGAAGCATCACCTGGAG; Forward PCR primer for nos-1 locus. seq from + 901–918 (ORF seq). | |
sequence-based reagent | oCYL407 | This study | CGTTGAAACTTTGAAGAAAGACATC; Forward PCR primer for nos-1 locus. seq from + 901–918 (ORF seq). | |
sequence-based reagent | oCYL361 | This study | GATGATTGTTGGAGAGGACG; Reverse PCR primer for lin-15B locus. Pair with oCYL363 to generated a PCR fragment contains n744 mutation. | |
sequence-based reagent | oCYL363 | This study | GCACAAACCTGGAGATCG; Forward PCR primer for lin-15B locus. 200 bp upstream of n744 mutation. | |
sequence-based reagent | oCYL374 | This study | AGAAGATGATGATTATGAGGAGG; Forward PCR primer for lin-35(n745) locus. 395 bp up stream of n745 mutation. | |
sequence-based reagent | oCYL375 | This study | GAAGAAGCAGCAGAGTAAATTC; Reverse PCR primer for lin-35(n745) locus. 276 bp down stream n745 mutation. | |
sequence-based reagent | oCYL402 | This study | TGGAGACTACAAATCCCACAG; Forward PCR primer for dpl-1 (n3643) locus, 270 bp up stream of n3643 site. | |
sequence-based reagent | oCYL405 | This study | GTACGTAATATCGTTTGGTAACGG; Reverse PCR primer for dpl-1(n3643) locus,270 bp down stream of n3643 site. | |
sequence-based reagent | oCYL668 | This study | Repair ssODN for nos-2 deletion. See Supplementary file S10 for sequence information. | |
sequence-based reagent | oCYL977 | This study | Repair ssODN for mes-3 C'ter OLLAS tag. See Supplementary file S10 for sequence information. | |
sequence-based reagent | gBLOCK4 | This study | First 138nt is gpd-2/3 outron followed by the sequence of recoded first 20 amino acid of LIN-15B. See Supplementary file S10 for sequence information. | |
recombinant DNA reagent | pSL270 | This study | contains GFP-H2B::tbb2 3'UTR from pCFJ420 and gpd-2/3 outron plus 60 nt lin-15B 5' sequence from gBLOCK4 | |
software, algorithm | Diffbind | DOI: 10.18129/B9.bioc.DiffBind | RRID:SCR_012918 | |
software, algorithm | hisat2 | DOI:10.1038/nprot.2016.095 | RRID:SCR_015530 | |
software, algorithm | htseq-count | DOI:10.1093/bioinformatics/btu638 | RRID:SCR_011867 | |
software, algorithm | cuffdiff | http://cole-trapnell-lab.github.io/cufflinks/ | RRID:SCR_001647 | |
software, algorithm | Slidebook 6 | https://www.intelligent-imaging.com/slidebook | RRID:SCR_014300 |
Gene categories.
These categories were based on previously published data sets as described in methods section.
Genes with nos-1nos-2-dependent chromatin features.
Excel sheet 1. List of 221 genes that acquired open chromatin in nos-1(gv5)nos-2(RNAi) L1 PGCs. Excel sheet 2. List of 29 genes that acquired close chromatin in nos-1(gv5)nos-2(RNAi) L1 PGCs.
Average gene expression level between x-linked and autosomal genes.
Expression level of selected genes.
Lists of differential expression analyses.
Data sheets contain significantly up- and downregulated genes from pairwise comparisons using ciffdiff as described in the methods section. FPKM values were extracted from differential expression analysis between wild-type and nos-1(gv5)nos-2(RNAi) PGCs using SMART-seq libraries.
Information for strains generated by CRISPR/cas9.
Information for sequencing libraries.
List of embryonic Z2/Z3 enriched genes.
From purified embryonic cells, we identified 1347 PGC enriched genes (enrichment over somatic blastomeres). In this table, we cross-referenced our embryonic PGC enriched gene set with other published PGC or germline enriched gene sets. 392/1347 embryonic PGC enriched genes were identified as PGC enriched genes in Spencer et al., 2011- Supplementary file 2 (in which 979 genes with enriched expression in Z2/Z3); 700/1347 were characterized as either germline specific or germline enriched genes in Gaydos et al., 2012.
Gene count tables for PCA plots.
Sheet 1. A table contains HTseq-count output using all Truseq libraries. Sheet 2. A table contains HTseq-count output using SMART-seq libraries.
Additional sequence information for oligos.