1. Cell Biology
  2. Developmental Biology

Nanos promotes epigenetic reprograming of the germline by down-regulation of the THAP transcription factor LIN-15B

  1. Chih-Yung Sean Lee
  2. Tu Lu
  3. Geraldine Seydoux  Is a corresponding author
  1. Howard Hughes Medical Institute, Johns Hopkins University School of Medicine, United States
https://doi.org/10.7554/eLife.30201
Share this article
Cite this article
  1. Chih-Yung Sean Lee
  2. Tu Lu
  3. Geraldine Seydoux
(2017)
Nanos promotes epigenetic reprograming of the germline by down-regulation of the THAP transcription factor LIN-15B
eLife 6:e30201.
https://doi.org/10.7554/eLife.30201
  2. Download BibTeX
  3. Download .RIS
7 figures, 1 table and 11 additional files

Figures

Figure 1 with 1 supplement
Download asset Open asset
nos-1nos-2 PGCs upregulate transcripts expressed in oocytes.

(A) Mutual antagonism between DRM/LIN-15B transcription factor and PRC2/MES-4 chromatin modifiers balances activities that promote somatic (red) and germline (green) gene expression. In somatic …

https://doi.org/10.7554/eLife.30201.003
Figure 1—figure supplement 1
Download asset Open asset
nos-1nos-2 PGCs upregulate transcripts expressed in oocytes.

(A) Bar graph showing results of quantitative RT-PCR of 11 genes significantly misexpressed in nos-1(gv5)nos-2(RNAi) PGCs. (*p<0.05 using Student’s t-test). (B–C) Transcriptome comparison between …

https://doi.org/10.7554/eLife.30201.004
Figure 2 with 3 supplements
Download asset Open asset
nos-1nos-2 PGCs are defective in maternal mRNA turnover during embryogenesis.

(A–B) Transcriptome comparison between PGCs isolated from wild-type embryos and wild-type L1 larvae. (A) Volcano plot showing log2 fold-change in transcript abundance for each gene. The numbers of …

https://doi.org/10.7554/eLife.30201.005
Figure 2—figure supplement 1
Download asset Open asset
Maternal RNAs are maintained in early embryonic PGCs.

(A) XY scatter plots showing correlation of gene expression between wild-type embryonic PGCs (X axis) and oocyte transcriptome (Y axis) (Left panel) and correlation of gene expression between …

https://doi.org/10.7554/eLife.30201.006
Figure 2—figure supplement 2
Download asset Open asset
Perdurance of maternal RNAs is not suppressed by loss of lin-15B in nos-1(gv5)nos-2(ax3103) PGCs.

Photomicrograph of embryos hybridized with single molecule fluorescence probes (red) against mex-5 and C01G8.1. Wild-type, nos-1(gv5)nos-2(ax3103) and nos-1(gv5)nos-2(ax3103);lin-15B(n744) embryos …

https://doi.org/10.7554/eLife.30201.007
Figure 2—figure supplement 2—source data 1

R code for comparing transcriptome between oocyte and embryonic blastomeres.

https://doi.org/10.7554/eLife.30201.008
Figure 2—figure supplement 3
Download asset Open asset
Principal component analysis (PCA) of transcriptomes from isolated PGCs.

PCA of biological replicates from different development stages and library preparation methods across two principal components (PC1 and PC2). (A) PCA of embryonic samples [embryonic PGCs and somatic …

https://doi.org/10.7554/eLife.30201.009
Figure 3 with 2 supplements
Download asset Open asset
nos-1nos-2 L1 PGCs activate the transcription of oocyte and X-linked genes.

(A) Histogram showing the distribution of log2 fold change in gene expression between nos-1(gv5)nos-2(RNAi) (designated as nos-1/2) and wild-type L1 PGCs for 221 genes that acquired new ATAC-seq …

https://doi.org/10.7554/eLife.30201.010
Figure 3—figure supplement 1
Download asset Open asset
ATAC-seq reveals abnormal chromatin profile of nos-1(gv5)nos-2(RNAi) PGCs.

(A) Heat map showing accumulated ATAC-seq reads of 1430 genes (Y axis) that are upregulated genes in nos-1(gv5)nos-2(RNAi) L1 PGCs compared to wild-type (as determined by Truseq, see Figure 1—figure …

https://doi.org/10.7554/eLife.30201.011
Figure 3—figure supplement 2
Download asset Open asset
Analysis of reproducibility between ATAC-seq samples.

(A) PCA of ATAC-seq peaks between replicates. (B) Scatter plots comparing the ATAC-Seq peak scores (RPKM) between replicates. RPKM values for each replicate were obtained from DiffBind analysis. The …

https://doi.org/10.7554/eLife.30201.012
Figure 4 with 2 supplements
Download asset Open asset
mes-4 and nos-1nos-2 PGCs exhibit a similar defect in X-chromosome silencing.

(A–B) Transcriptome comparison between PGCs isolated from wild-type and mes-4(RNAi) L1 larvae. See Figure 4—figure supplement 2 for comparison between wild-type and mes-2(RNAi). (A) Volcano plot …

https://doi.org/10.7554/eLife.30201.013
Figure 4—figure supplement 1
Download asset Open asset
nos-1nos-2 PGCs share a defect in X chromosome silencing with mes-4 PGCs.

(A) Bar graph showing chromosomal distribution of nos-1(gv5)nos-2(RNAi) upregulated genes (fed L1, Truseq libraries). Asterisks indicate significantly more genes than expected (hypergeometric test, …

https://doi.org/10.7554/eLife.30201.014
Figure 4—figure supplement 2
Download asset Open asset
MES proteins are expressed in nos-1nos-2 embryonic PGCs.

Transcriptome comparison between PGCs isolated from wild-type and mes-2(RNAi) L1 larvae. (A) Volcano plot showing log2 fold change of gene expression between mes-2(RNAi) and wild-type L1 PGCs. The …

https://doi.org/10.7554/eLife.30201.015
Figure 5 with 3 supplements
Download asset Open asset
Suppression of nos-1nos-2 sterility by lin-15b and synMuvB mutants.

(A) Bar graph showing the % sterility at 20°C among progenies of hermaphrodites with the listed genotypes. lin-15B(n744) and lin-35(n745) are null alleles(Ferguson and Horvitz, 1989; Lu and Horvitz, …

https://doi.org/10.7554/eLife.30201.016
Figure 5—figure supplement 1
Download asset Open asset
Suppression of nos-1nos-2 sterility by synMuvB mutants.

(A) Bar graphs showing percent sterility among worms of the indicated genotypes. Black bars: nos-1(gv5)nos-2(ax3103) mutant were fed with bacteria expressing dsRNA to genes indicated and the …

https://doi.org/10.7554/eLife.30201.017
Figure 5—figure supplement 2
Download asset Open asset
Loss of lin-15B does not rescue mes maternal effect sterility.

(A,B) Schemes for testing maternal effect sterility of mes-2(ok2480);lin-15B(n744) and mes-4(ok2326);lin-15B(n744) animals. (A) First generation (F1) mes-2(ok2480);lin-15B(n744) animals were derived …

https://doi.org/10.7554/eLife.30201.018
Figure 5—figure supplement 3
Download asset Open asset
Suppression of nos-1nos-2 sterility by loss of lin-15B depends on mes activity.

Bar graphs showing percent sterility among animals with indicated genotypes and RNAi treatments. N2, lin-15B(n744) and nos-1(gv5)nos-2(ax3103);lin-15B(n744) were fed with bacteria expressing dsRNA …

https://doi.org/10.7554/eLife.30201.019
Figure 6 with 3 supplements
Download asset Open asset
LIN-15B is inherited maternally and is downregulated in PGCs in a nos-1nos-2 dependent manner.

(A) Photomicrograph of a dissected wild-type gonad stained with anti-LIN-15B antibody and DAPI for DNA. LIN-15B protein is detected at the end of the pachytene region and in all oocyte nuclei. (B) …

https://doi.org/10.7554/eLife.30201.020
Figure 6—figure supplement 1
Download asset Open asset
Expression oflin-15Bbegins in late pachytene germ cells.

(A) Photomicrograph of 2 cells wild-type and lin-15B(n744) embryos stained with α-LIN-15B antibody. α-LIN-15B is specific as no nuclear signal was detected in lin-15B(n744) embryos. (B) Cartoon …

https://doi.org/10.7554/eLife.30201.021
Figure 6—figure supplement 2
Download asset Open asset
Assay for maternal and zygotic contribution of lin-15B in nos-1nos-2 sterility.

(A–B) Mating schemes to characterize the maternal and zygotic contribution of lin-15B in nos-1(gv5)nos-2(ax3103). lin-15B genotypes were determined by Sanger sequencing (See key resources table for …

https://doi.org/10.7554/eLife.30201.022
Figure 6—figure supplement 3
Download asset Open asset
Loss of lin-15B activity mitigates gene expression changes in nos-1nos-2 PGCs.

Box and Whisker plot showing log2 fold change compared to wild-type of different gene sets as depicted under each plot. Each box extends from the 25th to the 75th percentile, with the median …

https://doi.org/10.7554/eLife.30201.023
Scheme 1
Download asset Open asset
Experimental procedure for ATAC-seq analysis.
https://doi.org/10.7554/eLife.30201.024

Tables

Key resources table
Reagent type (species)
or resource		DesignationSource or referenceIdentifiersAdditional information
strain, strain
background (C. elegans)		JH1270Subramaniam and Seydoux (1999)RRID:WB-STRAIN:JH1270nos-1(gv5)
strain, strain
background (C. elegans)		JH3103This studynos-1(gv5);
lin-15A(n767)
strain, strain
background (C. elegans)		TH206(http://www.modencode.org).RRID:WB-STRAIN:TH206unc-119(ed3) III;
ddEx16
strain, strain
background (C. elegans)		JH3099This studyunc-119(ed3) III;
ddEx16 out cross x2
strain, strain
background (C. elegans)		MT1806CGCRRID:WB-STRAIN:MT1806lin-15A(n767)
strain, strain
background (C. elegans)		PFR40CGCRRID:WB-STRAIN:PFR40hpl-2(tm1489)
strain, strain
background (C. elegans)		MT2495CGCRRID:WB-STRAIN:MT2495lin-15B(n744)
strain, strain
background (C. elegans)		MT10430CGCRRID:WB-STRAIN:MT10430lin-35(n745)
strain, strain
background (C. elegans)		MT11147CGCRRID:WB-STRAIN:MT10430dpl-1(n3643)
strain, strain
background (C. elegans)		JH3109This studynos-1(gv5);
hpl-2(tm1489)
strain, strain
background (C. elegans)		JH3119This studynos-1(gv5);
lin-35(n745)
strain, strain
background (C. elegans)		JH3121This studynos-1(gv5);
lin-15B(n744)
strain, strain
background (C. elegans)		JH3141This studynos-1(gv5)
dpl-1(n3643)
strain, strain
background (C. elegans)		JH3357This studynos-2(ax3103)
strain, strain
background (C. elegans)		JH3367This studynos-1(gv5)
nos-2(ax3103)/MnC1
strain, strain
background (C. elegans)		JH3401This studynos-1(gv5);
nos-2(ax3103);
lin-15B(n744)
strain, strain
background (C. elegans)		JH3428This studymes-2(ax2509
[mes-2::GFP]);
tagRFP::glh-1
strain, strain
background (C. elegans)		JH3436This studytagRFP::glh-1;
nos-1(gv5);
lin-15B(ax3104)
strain, strain
background (C. elegans)		JH3484This studymes-3(ax3105
[mes-3::OLLAS])
strain, strain
background (C. elegans)		JH3486This studymes-3(ax3105
[mes-3::OLLAS]);
nos-1(gv5) nos-2
(ax3103)/MnC1
strain, strain
background (C. elegans)		JH3203CGCRRID:WB-STRAIN:JH3203mes-2(ax2059
[mes-2::GFP])
strain, strain
background (C. elegans)		JH3510This studymes-2(ax2509[mes-2::GFP]);
tagRFP::glh-1;
nos-1(gv5)
nos-2(ax3103)/MnC1
strain, strain
background (C. elegans)		JH3513This studygtbp-1(axls3105[gtbp-1
prom::GFP-H2B::lin-15B 3'utr]);
tagRFP::glh-1;
nos-1(gv5) nos-2(ax3103)/MnC1
strain, strain
background (C. elegans)		JH3531This studydpl-1(n3643)
nos-1(gv5)nos-2(ax3103)
strain, strain
background (C. elegans)		JH3538This studylin-35(n745);
nos-1(gv5) nos-2(ax3103)
strain, strain
background (C. elegans)		VC2409CGCRRID:WB-STRAIN:VC2409mes-2(ok2480)/mT1 II;
+/mT1 [dpy-10(e128)] III
strain, strain
background (C. elegans)		VC1874CGCRRID:WB-STRAIN:VC1874mes-4(ok2326)
V/nT1[qls51] (IV;V)
strain, strain
background (C. elegans)		JH3357This studynos-2(ax3103).
Deletion of nos-2 ORF.
See Supplementary file 6 for description.
strain, strain
background (C. elegans)		JH3436This studylin-15B(ax3104).
lin-15B
prom::GFP-H2B::tbb-2 3'UTR.
See Supplementary file 6 for description.
strain, strain
background (C. elegans)		JH3484This studymes-3(ax3105).
mes-3::OLLAS.
See Supplementary file 6 for description.
antibodyK76DSHB,PMID:28787592RRID:AB_531836(1:15)
antibodyAnti-FLAG M2Sigma-Aldrich
Cat# F3165		RRID:AB_259529(1:200)
antibodyDonkey-anti-mouse IgM 647Jackson Immuno
Research Labs		RRID:AB_2340861(1:400)
antibodyGoat anti-Rabit IgG (H + L) 568Molecular probes
cat# A-11011		RRID:AB_143157(1:400)
antibodyAnti-OLLAS-L2Novus cat# NBP1-06713RRID:AB_1625979(1:200)
antibodyanti-LIN-15Bothergift from Dr. Susan
Strome, SDQ3183 1:40,000
antibodyanti-MES-4othergift from Dr. Susan
Strome. (1:400)
antibodyanti-OLLASothergift from Dr.
Jeremy Nathans (1:80)
sequence-based
reagent		oCYL584This studyGAUCUUCUAGAAAGAAUCUU; crRNA cut at 3' end of nos-2
sequence-based
reagent		oCYL669This studyAGAGUCGAAGUCGGUUCACU; crRNA cut at 5' end of nos-2
sequence-based
reagent		oCYL823This studyGCACUGCUACUGCUGGAAGU; crRNA cut at 5' end of lin-15B
sequence-based
reagent		oCYL957This studyGGGAUAAUCTAAUUAGAAGA; crRNA cut at 3' end of mes-3
sequence-based
reagent		AP691Paix et al. (2015)GGCCTTAACCCAGAATAAGA; crRNA cut at 5' end of gtbp-1
sequence-based
reagent		AP728Paix et al. (2015)CACGAGGTGGTATGCGCAG; crRNA cut at 3' end of gtbp-1
sequence-based
reagent		oCYL251This studyTGGAAAGTTGAGTGTGAGCA; Forward K08A8.1 RT-PCR primer
sequence-based
reagent		oCYL252This studyGGAGAATGTTTGATGGCTTCAC; Reverse K08A8.1 RT-PCR primer
sequence-based
reagent		oCYL259This studyCCTGAGAAGAAGCTGCAAATG; Forward W02A11.8 RT-PCR primer
sequence-based
reagent		oCYL260This studyTTTATGTCCTTTGGCAAAACGG; Reverse W02A11.8 RT-PCR primer
sequence-based
reagent		oCYL304This studyCTGCTATTGTGAAGTCTCCTG; Forward B0416.5 RT-PCR primer
sequence-based
reagent		oCYL305This studyCCATTTGTGGCTTACTAGCG; Reverse B0416.5 RT-PCR primer
sequence-based
reagent		oCYL308This studyTGTCAGTTTGTGATGTGCTG; Forward C35C5.3 RT-PCR primer
sequence-based
reagent		oCYL309This studyGCTTCAAAATCGTCCTTTTCATG; Reverse C35C5.3 RT-PCR primer
sequence-based
reagent		oCYL738This studyACTGGACGATTTCAACGGAG; Forward lin-15B RT-PCR primer
sequence-based
reagent		CYL739This studyACATACTGCACAGCGACG; Reverse lin-15B RT-PCR primer
sequence-based
reagent		oCYL994This studyAGTCGGTATTTTGAATGCGG; Forward lsd-1 RT-PCR primer
sequence-based
reagent		oCYL995This studyCGTTTCCGAGTGATCTGATTG; Reverse lsd-1 RT-PCR primer
sequence-based
reagent		oCYL998This studyAATCCGTTTGACTATGAGTGG; Forward W05H9.2 RT-PCR primer
sequence-based
reagent		oCYL999This studyTCGTTTAGAAGCTACAATGACAG; Reverse W05H9.2 RT-PCR primer
sequence-based
reagent		oCYL1006This studyGAAGTTACCCGTCGCAAG; Forward F28H6.4 RT-PCR primer
sequence-based
reagent		oCYL1007This studyGCCACTGTTTTGTAATCCCG; Reverse F28H6.4 RT-PCR primer
sequence-based
reagent		oCYL1010This studyACTTTGCGATAAACTCCCTTC; Forward tag-299 RT-PCR primer
sequence-based
reagent		oCYL1011This studyGCTTGCAGACACGAAGATAAG; Reverse tag-299 RT-PCR primer
sequence-based
reagent		oCYL1020This studyCGAATGCGGACATCTTAATCC; Forward lnp-1 RT-PCR primer
sequence-based
reagent		oCYL1021This studyGTTGACGGCTTCTGATTCTC; Reverse lnp-1 RT-PCR primer
sequence-based
reagent		oCYL1044This studyTGGTTATGTGCAACACTTGG; Forward sygl-1 RT-PCR primer
sequence-based
reagent		oCYL1045 primerThis studyTCTCGCTACGATCCTTCTTC; Reverse sygl-1 RT-PCR
sequence-based
reagent		oCYL438This studyCAGCTCGAAACCTGAAAATTGT;Forward PCR primer for nos-2 locus. 179 bp upstream of nos-2 ATG.
sequence-based
reagent		oCYL734This studyGCCATCACCTATGCGATTTG; Reverse PCR primer for nos-2 locus. 468 bp after nos-2 STOP.
sequence-based
reagent		oCYL735This studyGTTGTGGCGGAAAGGAATAC; Reverse PCR primer for nos-2 locus, 154 bp after nos-2 ATG.
sequence-based
reagent		oCYL43This studyATGTTGATTTTCAGGACTTCTC; Forward PCR primer for nos-1 locus. seq from + 1- + 22
sequence-based
reagent		oCYL45This studyACGAAGCATCACCTGGAG; Forward PCR primer for nos-1 locus. seq from + 901–918 (ORF seq).
sequence-based
reagent		oCYL407This studyCGTTGAAACTTTGAAGAAAGACATC; Forward PCR primer for nos-1 locus. seq from + 901–918 (ORF seq).
sequence-based
reagent		oCYL361This studyGATGATTGTTGGAGAGGACG; Reverse PCR primer for lin-15B locus. Pair with oCYL363 to generated a PCR fragment contains n744 mutation.
sequence-based
reagent		oCYL363This studyGCACAAACCTGGAGATCG; Forward PCR primer for lin-15B locus. 200 bp upstream of n744 mutation.
sequence-based
reagent		oCYL374This studyAGAAGATGATGATTATGAGGAGG; Forward PCR primer for lin-35(n745) locus. 395 bp up stream of n745 mutation.
sequence-based
reagent		oCYL375This studyGAAGAAGCAGCAGAGTAAATTC; Reverse PCR primer for lin-35(n745) locus. 276 bp down stream n745 mutation.
sequence-based
reagent		oCYL402This studyTGGAGACTACAAATCCCACAG; Forward PCR primer for dpl-1 (n3643) locus, 270 bp up stream of n3643 site.
sequence-based
reagent		oCYL405This studyGTACGTAATATCGTTTGGTAACGG; Reverse PCR primer for dpl-1(n3643) locus,270 bp down stream of n3643 site.
sequence-based
reagent		oCYL668This studyRepair ssODN for nos-2 deletion. See Supplementary file S10 for sequence information.
sequence-based
reagent		oCYL977This studyRepair ssODN for mes-3 C'ter OLLAS tag. See Supplementary file S10 for sequence information.
sequence-based
reagent		gBLOCK4This studyFirst 138nt is gpd-2/3 outron followed by the sequence of recoded first 20 amino acid of LIN-15B. See Supplementary file S10 for sequence information.
recombinant DNA
reagent		pSL270This studycontains GFP-H2B::tbb2 3'UTR from pCFJ420 and gpd-2/3 outron plus 60 nt lin-15B 5' sequence from gBLOCK4
software, algorithmDiffbindDOI: 10.18129/B9.bioc.DiffBindRRID:SCR_012918
software, algorithmhisat2DOI:10.1038/nprot.2016.095RRID:SCR_015530
software, algorithmhtseq-countDOI:10.1093/bioinformatics/btu638RRID:SCR_011867
software, algorithmcuffdiffhttp://cole-trapnell-lab.github.io/cufflinks/RRID:SCR_001647
software, algorithmSlidebook 6https://www.intelligent-imaging.com/slidebookRRID:SCR_014300

Additional files

Supplementary file 1

Gene categories.

These categories were based on previously published data sets as described in methods section.

https://doi.org/10.7554/eLife.30201.025
Supplementary file 2

Genes with nos-1nos-2-dependent chromatin features.

Excel sheet 1. List of 221 genes that acquired open chromatin in nos-1(gv5)nos-2(RNAi) L1 PGCs. Excel sheet 2. List of 29 genes that acquired close chromatin in nos-1(gv5)nos-2(RNAi) L1 PGCs.

https://doi.org/10.7554/eLife.30201.026
Supplementary file 3

Average gene expression level between x-linked and autosomal genes.

https://doi.org/10.7554/eLife.30201.027
Supplementary file 4

Expression level of selected genes.

https://doi.org/10.7554/eLife.30201.028
Supplementary file 5

Lists of differential expression analyses.

Data sheets contain significantly up- and downregulated genes from pairwise comparisons using ciffdiff as described in the methods section. FPKM values were extracted from differential expression analysis between wild-type and nos-1(gv5)nos-2(RNAi) PGCs using SMART-seq libraries.

https://doi.org/10.7554/eLife.30201.029
Supplementary file 6

Information for strains generated by CRISPR/cas9.

https://doi.org/10.7554/eLife.30201.030
Supplementary file 7

Information for sequencing libraries.

https://doi.org/10.7554/eLife.30201.031
Supplementary file 8

List of embryonic Z2/Z3 enriched genes.

From purified embryonic cells, we identified 1347 PGC enriched genes (enrichment over somatic blastomeres). In this table, we cross-referenced our embryonic PGC enriched gene set with other published PGC or germline enriched gene sets. 392/1347 embryonic PGC enriched genes were identified as PGC enriched genes in Spencer et al., 2011- Supplementary file 2 (in which 979 genes with enriched expression in Z2/Z3); 700/1347 were characterized as either germline specific or germline enriched genes in Gaydos et al., 2012.

https://doi.org/10.7554/eLife.30201.032
Supplementary file 9

Gene count tables for PCA plots.

Sheet 1. A table contains HTseq-count output using all Truseq libraries. Sheet 2. A table contains HTseq-count output using SMART-seq libraries.

https://doi.org/10.7554/eLife.30201.033
Supplementary file 10

Additional sequence information for oligos.

https://doi.org/10.7554/eLife.30201.034
Transparent reporting form
https://doi.org/10.7554/eLife.30201.035

Download links