Cross-species functional diversity within the PIN auxin efflux protein family
- University of Cambridge, United Kingdom
- Western Regional Research Center, USDA-ARS, United States
- United States Department of Energy Joint Genome Institute, United States
- University of California, Berkeley, United States
Figures
Figure 1 with 2 supplements
Mutation of SoPIN1 but not PIN1a and PIN1b severely effects organ initiation in Brachypodium.
(A) SoPIN1, PIN1a, and PIN1b CRISPR-derived mutant alleles (see Materials and methods). Coding sequences are indicated by grey boxes. Arrowheads indicate CRISPR target sites and are labeled with the …
-
Figure 1—source data 1
Source data for spikelet and floret counts in Figure 1H–I.
- https://doi.org/10.7554/eLife.31804.005
-
Figure 1—source data 2
Source data for DII quantification in Figure 1—figure supplement 2 panel C.
- https://doi.org/10.7554/eLife.31804.006
Figure 1—figure supplement 1
sopin1-1 is complemented by the SoPIN1-CIT reporter.
(A) Wild-type inflorescence (Bd21-3 background) with wild-type mature spikelets (s). (B) sopin1-1 inflorescence with an aborted spikelet (asterisk) and several barren white spikelet nodes (n). Green …
Figure 1—figure supplement 2
DII-Venus is degraded in the presence of auxin in Brachypodium spikelet meristems.
(A) 1 µM NAA-treated, and (B) mock-treated spikelet meristems expressing pZmUbi::DII-Venus imaged every 30 min after treatment. Images from left to right, pre-treatment expression, 30 min, 60 min …
Figure 2 with 1 supplement
PIN1a and PIN1b redundantly control internode growth in Brachypodium.
(A–D) Whole-plant phenotypes for WT (Bd21-3), pin1a-1, pin1b-1, and double pin1a-1/pin1b-1 mutants. (E) Stacked bar graph of the length of the first 5 internodes below the inflorescence of the main …
-
Figure 2—source data 1
Source data for internode length measurements in Figure 2E.
- https://doi.org/10.7554/eLife.31804.009
-
Figure 2—source data 2
Source data for PIN1b-CIT-mediated complementation of pin1b-1 internode lengths in Figure 2—figure supplement 1.
- https://doi.org/10.7554/eLife.31804.010
Figure 2—figure supplement 1
PIN1b-CIT-mediated complementation of pin1b-1 internode length defects.
Stacked bar graph of the length of the first 5 internodes below the inflorescence of the main branch, labeled I1-I5 from top to bottom, for pin1b-1 and pin1b-1 containing the previously published …
Figure 3 with 1 supplement
AtPIN1, SoPIN1, and PIN1b show different behaviors when expressed in wild-type Arabidopsis.
Arabidopsis AtPIN1 promoter (proAtPIN1) driven expression of GFP-tagged AtPIN1 and Citrine-tagged (a YFP derivative) SoPIN1 and PIN1b in wild-type Columbia (Col-0) Arabidopsis. (A,D,G,J) AtPIN1, (B,E…
Figure 3—figure supplement 1
proAtPIN1 AtPIN1, SoPIN1, and PIN1b expression details.
(A) Confocal z-section of AtPIN1 accumulation in vascular-associated domains just below the apex of the meristem shown in Figure 3A. (B) Confocal z-section of SoPIN1 accumulation in a ring-shaped …
Figure 4 with 2 supplements
SoPIN1 but not PIN1b can partially complement the Arabidopsis pin1-613 mutant organ initiation and bulk transport defects.
(A) From left to right, inflorescence phenotypes of WT (Col-0), proAtPIN1::SoPIN1 in pin1-613, proAtPIN1::PIN1b in pin1-613, and pin1-613 alone. Note that PIN1b-expressing pin1-613 plants are …
-
Figure 4—source data 1
Source data for Figure 4D auxin transport assays.
- https://doi.org/10.7554/eLife.31804.016
-
Figure 4—source data 2
Source data for Figure 4—figure supplement 2 floral organ numbers.
- https://doi.org/10.7554/eLife.31804.017
Figure 4—figure supplement 1
Whole-plant phenotypes of proAtPIN1-driven complementation of pin1-613.
From left to right, Col-0 (WT), proAtPIN1::SoPIN1 complemented pin1-613, proAtPIN1::PIN1b expressing pin1-613, and pin1-613 alone. Scale bar: 1 cm.
Figure 4—figure supplement 2
Floral organ number in proAtPIN1::SoPIN1 complemented flowers.
Mean and standard-error of sepal, petal, stamen and carpel organ numbers in heterozygous pin1-613 or wild-type (white bars) and proAtPIN1::SoPIN1-complemented pin1-613 flowers (grey bars) (n = 30). …
Figure 5 with 2 supplements
SoPIN1 and PIN1b localization in null pin1-613 mutants.
Arabidopsis PIN1 promoter (proAtPIN1) driven expression of Citrine-tagged (YFP derivative) SoPIN1 and PIN1b in null pin1-613 mutant tissue. (A,C,E,G,I) SoPIN1, (B,D,F,H,J,K,L,M) PIN1b. (A–B) Maximum …
Figure 5—figure supplement 1
proAtPIN1::SoPIN1 expression in pin1-613 segregating family.
(A) proAtPIN1::SoPIN1 expression in 6 different WT or heterozygous pin1-613 meristem samples. (B) proAtPIN1::SoPIN1 expression in 6 different complemented pin1-613 meristems. All samples were imaged …
Figure 5—figure supplement 2
proAtPIN1::PIN1b expression in pin1-613 apexes.
Two representative meristems each from four different transgenic events. All samples were imaged with identical settings. Scale bars: 25 µm.
Figure 6 with 3 supplements
SoPIN1 and PIN1b show different behaviors under proAtML1-driven expression.
Maximum projections of proAtML1::LhG4 driving pOP::SoPIN1 or pOP::PIN1b (proAtML1 >>SoPIN1 and proAtML1 >>PIN1b) in wild-type Landsberg erecta (Ler) (A–D), and pin1-4 (E–L) inflorescence meristems …
Figure 6—figure supplement 1
proAtML1 >>SoPIN1 representative meristem maximum projections.
(A) proAtML1 >>SoPIN1 expression in three different wild-type Ler meristems. (B) proAtML1 >>SoPIN1 expression in three different complemented pin1-4 meristems. Capture settings are identical in all …
Figure 6—figure supplement 2
proAtML1 >>PIN1b representative meristem maximum projections.
(A) proAtML1 >>PIN1b expression in three different wild-type Ler meristems. (B) proAtML1 >>PIN1b expression in three different complemented pin1-4 meristems. Capture settings are identical in all …
Figure 6—figure supplement 3
Subcellular localization of PIN1b in wild-type (Ler) and pin1-4 meristems.
(A) Wild-type (Ler) meristem expressing proAtML1 >>PIN1b. Boxes numbered 1–3 indicate the positions of detail images in (B–D). (B) Organ boundary. (C) Incipient organ. (D) Meristem apex. (E) pin1-4 …
Figure 7
AtPIN1 protein immuno-localization in wild-type, pin1-613, and pin1-4 meristems.
(A) AtPIN1 protein accumulation in wild-type Ler inflorescence apex shows polar PIN protein at the sites of initiating organs (asterisk), and during vein patterning below the apex (arrow). (B) No …
Figure 8 with 1 supplement
Both SoPIN1 and PIN1b can complement Arabidopsis pin1-4 under proAtML1-driven expression.
(A) From left to right, wild-type Ler, proAtML1 >>PIN1b complemented pin1-4, proAtML1 >>SoPIN1 complemented pin1-4, and pin1-4 alone. Arrow indicates barren pin inflorescence in pin1-4. See Figure …
-
Figure 8—source data 1
Source data for Figure 8B auxin transport assays.
- https://doi.org/10.7554/eLife.31804.028
-
Figure 8—source data 2
Source data for Figure 8C stem cross-sectional area measurements.
- https://doi.org/10.7554/eLife.31804.029
Figure 8—figure supplement 1
proAtML1 >>SoPIN1 and proAtML1 >>PIN1b complemented pin1-4 inflorescence phenotypes.
(A) Wild-type Ler, (B) proAtML1 >>SoPIN1 complemented pin1-4, and (C) proAtML1 >>PIN1b complemented pin1-4 inflorescence apexes. Scale bars: 1 mm.
Figure 9 with 1 supplement
Heterologous expression visual summary: Functional distinction between PIN auxin efflux proteins during development.
Polarized SoPIN1 is represented by green lines, polarized PIN1b by blue lines, un-polarized PIN1b by blue ovals, and the putative partially functional pin1-4 protein is indicated by magenta circles. …
-
Figure 9—source data 1
FASTA alignment source data for Figure 9—figure supplement 1.
- https://doi.org/10.7554/eLife.31804.032
Figure 9—figure supplement 1
Brassicaceae-specific PIN1 domains.
(A) Wrapped protein alignment showing PIN1 clade members from across the angiosperms. Grass PIN1a proteins are indicated with grey rectangle, grass PIN1b proteins are indicated with black rectangle, …
Tables
Table 1
Primers
See methods for usage.
| ID# | Name | Sequence | Purpose |
|---|---|---|---|
| 1 | 524_Bradi4g26300_4230_F | CGTTCCGTGTTGATTCCGATG | sopin1-1 genotyping with HgaI digestion |
| 2 | 525_Bradi4g26300_4923_R | CTGGAGTAGGTGTTGGGGTTC | sopin1-1 genotyping with HgaI digestion |
| 3 | 526_Cas9_8622_F | TCCCAGAGAAGTACAAGGAGATCT | Cas9 Genotyping |
| 4 | 527_Cas9_9159_R | TTGTACACGGTGAAGTACTCGTAG | Cas9 Genotyping |
| 5 | 104_BdPIN_11_QPCR_F | ACAACCCTTACGCCATGAAC | pin1a-1 genotyping with NcoI digestion |
| 6 | 473_PIN1a_dom1_shortR | CACACGAACATGTGCAGGTC | pin1a-1 genotyping with NcoI digestion |
| 7 | 541_Bradi3g59520_PIN1b_5084_F | TGATGCTCTTCATGTTCGAGTACC | pin1b-1 genotyping with mboI digestion |
| 8 | 542_Bradi3g59520_PIN1b_5838_R | GGAGTAAACTACGTTGTGACAAGG | pin1b-1 genotyping with mboI digestion |
| 9 | 019 - Ubi-1 Prom attB4 F | GGGGACAACTTTGTATAGAAAAGTTGCTGCAGTGCAGCGTGACCCGG | pZmUbi amplification for cloning |
| 10 | 020 - Ubi-1 Prom attB1 R | GGGGACTGCTTTTTTGTACAAACTTGCTGCAGAAGTAACACCAAACA | pZmUbi amplification for cloning |
| 11 | PIN1pro-GW-F | GGGGACAACTTTGTATAGAAAAGTTGTTACCCTCATCCATCATTAACTT | proAtPIN1 amplification |
| 12 | PIN1pro-GW-R | GGGGACTGCTTTTTTGTACAAACTTGTCTTTTGTTCGCCGGAGAAGAGA | proAtPIN1 amplification |
| 13 | 455 BdSoPIN1 cacc mRNA | TCACATCTGCTGCCGCTGCC | SoPIN1-Citrine coding region amplification |
| 14 | 302 - PIN_7 qPCR UTR R2 | AATCCCAAAAGCCGACATTG | SoPIN1-Citrine coding region amplification |
| 15 | 466 BdPIN1b cacc mRNA-2 | CACCTGTACACACTGCGGCGCT | PIN1b-Citrine coding region amplification |
| 16 | 308 - PIN_5 qPCR UTR R1 | ACTCGCTAACCAACCCCTTAATT | PIN1b-Citrine coding region amplification |
| 17 | MVR087 - pin1-613 RP (SALK_047613) | AATCATCACAGCCACTGATCC | pin1-613 genotyping |
| 18 | MVR086 - pin1-613 LP (SALK_047613) | CAAAAACACCCCCAAAATTTC | pin1-613 genotyping |
| 19 | MVR036 - LBb1.3 | ATTTTGCCGATTTCGGAAC | pin1-613 genotyping |
| 20 | 344 - Citrine Seq R | GAAGCACATCAGGCCGTAG | PIN1b-Citrine and SoPIN1-Citrine genotyping |
| 21 | 524_Bradi4g26300_4230_F | CGTTCCGTGTTGATTCCGATG | SoPIN1-Citrine genotyping |
| 22 | 541_Bradi3g59520_PIN1b_5084_F | TGATGCTCTTCATGTTCGAGTACC | PIN1b-Citrine genotyping |
| 23 | 543_pin1-4_Aci_F | GCTTTTGCGGCGGCTATGAGATTTGT | pin1-4 genotyping with AciI digestion |
| 24 | 544_pin1-4_Aci_R | GCTTCTGATTTAATTTGTGGGTTTTCA | pin1-4 genotyping with AciI digestion |
| 25 | 076 - BASTA_F2 | CTTCAGCAGGTGGGTGTAGAG | ML1::LhG4 genotyping |
| 26 | 077 - BASTA_R2 | GAGACAAGCACGGTCAACTTC | ML1::LhG4 genotyping |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.31804.034
