Myotubularin related protein-2 and its phospholipid substrate PIP2 control Piezo2-mediated mechanotransduction in peripheral sensory neurons
- Max Planck Institute for Experimental Medicine, Germany
- University of Goettingen, Germany
- Institute of Pharmacology, Germany
Figures
Figure 1 with 2 supplements
Mtmr2 suppresses Piezo2-mediated RA-MA currents in HEK293 cells and DRG neurons.
(a–d) Representative images (a,c) and quantification (b,d) of a proximity ligation assay (PLA) in cultured DRG neurons (a,b) of Piezo2GFP mice (Woo et al., 2014) and HEK293 cells (c,d). As …
Figure 1—figure supplement 1
Mtmr2 is expressed in mouse DRG and also in close vicinity to Piezo2.
(a) Representative immunohistochemistry and (b) quantification of Mtmr2-positive neurons in cryosections of DRGs obtained from Piezo2GFP mice (Woo et al., 2014). 20.37 ± 2.01% of DRG neurons exhibit …
Figure 1—figure supplement 2
Mtmr2 overexpression does not influence Kv1.1- or Piezo1-mediated currents.
(a) Voltage-current curves upon overexpression of Kv1.1 with Mtmr2 in HEK293 cells showed no significant difference compared to overexpression with mock (Kv1.1 + mock: n = 24 cells; Kv1.1+ Mtmr2: n =…
Figure 2 with 1 supplement
Mtmr2 knockdown potentiates Piezo2 activity in peripheral sensory neurons.
(a) Representative traces of RA-MA currents in primary cultures of DRG neurons and (b) stimulus-current curves for RA-MA currents upon nucleofection of Mtmr2 siRNA showed a significant increase in …
Figure 2—figure supplement 1
Mtmr2 knockdown in cultured DRG neither affects Piezo2 mRNA nor Piezo2 membrane levels or overall expression.
(a) Quantification of Mtmr2 mRNA upon siRNA transfection in DRG neurons showed a significant decrease in Mtmr2 mRNA (Actin as reference: 0.42 ± 0.05; p<0.0001; one sample t-test; N = 8 independent …
Figure 3
Catalytic activity of Mtmr2 is necessary to suppress Piezo2-mediated RA-MA currents.
(a) Stimulus-current curves upon co-expression of Piezo2 with the catalytically inactive Mtmr2 C417S mutant in HEK293 cells compared to mock controls. Mtmr2 C417S overexpression slightly, but not …
Figure 4 with 2 supplements
Mtmr2 modulates Piezo2-mediated RA-MA currents mainly via PI(3,5)P2.
(a) Scheme illustrating the major steps of PI(3,5)P2 synthesis and turnover including commonly used inhibitors and their targets. Wortmannin is an inhibitor of the phosphatidylinositol 3-kinase …
Figure 4—figure supplement 1
Effect on Piezo2 RA-MA currents upon application of PIPs or Apilimod in cultured DRG.
(a) Stimulus-current curves of RA-MA currents are not altered upon addition of 1 µM PI(3)P or 1 µM PI(3,5)P2 (CTRL: n = 27 neurons; 1 µM PI(3)P: n = 17 neurons; 1 µM PI(3,5)P2: n = 21 neurons; ns; …
Figure 4—figure supplement 2
Mtmr2 knockdown does not obviously alter mechanical properties of cultured DRG neurons.
(a) Sketch of the AFM set-up used to measure the mechanical properties of cultured DRG neurons transfected with CTRL or Mtmr2 siRNA. (b) Representative force-indentation curves for CTRL and Mtmr2 …
Figure 5 with 1 supplement
Murine Piezo2, but not Piezo1, harbors a PIP2 binding motif.
(a) Schematic view of the PI(3,5)P2 binding region of TRPML1 identified elsewhere (Dong et al., 2010) and the region in murine Piezo2 that exhibits pronounced sequence similarity to the PI(3,5)P2 …
Figure 5—figure supplement 1
Quantification of peptide-lipid binding assays using the Piezo2 peptide.
Piezo2 peptide densitometry data were analyzed using one-way ANOVA followed by Dunnett’s multiple comparisons test to compare spot signal densities for different lipids to the blank, p-values are …
Figure 6
Working model: Local control of Piezo2 function by interdependent actions of Mtmr2 and PI(3,5)P2.
Mtmr2 controls the abundance of PI(3,5)P2 by dephosphorylation (please see Figure 4a). Mtmr2 and Piezo2 expression as well as PI(3,5)P2 might be compartmentalized in membrane microdomains. Piezo2 …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (mouse) | B6/J mice | RRID: IMSR_JAX:000664 | bred in the animal facility of the MPIem Goettingen | |
| Strain (mouse) | Piezo2GFP | kind gift of Ardem Patapoutian | bred in the animal facility of the MPIem Goettingen | |
| Cell line (human) | HEK293 | purchased from ATCC | RRID: CVCL_0045 | Cells were not tested for mycoplasma contamination; cells were authenticated by ATCC upon purchase |
| Antibody | Rabbit anti-Mtmr2 (1:100) | Biotechne, #NBP1-33724 | RRID: AB_2147841 | |
| Chicken anti-GFP (1:500) | Thermo Fisher Scientific, #A10262 | RRID: AB_2534023 | ||
| Rabbit anti-GST (1:500) | Santa Cruz, #sc-459 | |||
| Mouse anti-myc (1:750, 1:500) | Santa Cruz, #sc-47694 | RRID: AB_627266 | ||
| Mouse anti-FLAG (1:100) | Sigma Aldrich, #F1804 | RRID: AB_262044 | ||
| Rabbit anti-Piezo2 (1:200) | Novus Biologicals, #NBP1-78624 | RRID: AB_11005294 | ||
| Recombinant DNA reagent | pCMVSport6 Piezo2-GST IRES GFP | kind gift of Ardem Patapoutian | mouse Piezo2 | |
| pCMV6-Entry Mtmr2-myc-DDK | Origene, #MR215223 | mouse Mtmr2 | ||
| Mtmr2C417S-myc-DDK | mouse Mtmr2 C417S | Mutation generated using Q5 Site-Directed Mutagenesis kit (New England BioLabs) | ||
| pCMV Sport6 Piezo1-753-myc-IRES GFP | kind gift of Ardem Patapoutian | mouse Piezo1 | Myc tag was inserted at amino acid 753 as described inCoste et al., 2015. | |
| pGEM-Teasy Kv1.1-HA | mouse Kv1.1 | Custom-made and sequence-verified | ||
| pCMVSport6 | kind gift of ArdemPatapoutian | |||
| pCDNA3.1-myc-His | Invitrogen, #V80020 | |||
| pCNDA3-GST | kind gift of Ardem Patapoutian | |||
| pCMVSport6 Piezo2 P1 mutant-GST IRES GFP | mouse Piezo2 P1 mutant | Mutation generated using Q5 Site-Directed Mutagenesis kit (New England BioLabs) | ||
| pCDNA3.1-myc-His TRPA1 | kind gift of Ardem Patapoutian | mouse TRPA1 | ||
| pCMV6-Vti1b-myc-DDK | Origene | |||
| Sequence-based reagent | Mtmr2 forward primer for qPCR | MPIem DNA Core Facility | TGTACCCCACCATTGAAGAAA | |
| Mtmr2 reverse primer for qPCR | MPIem DNA Core Facility | TAAGAGCCCCTGCAAGAATG | ||
| Piezo2 forward primer for qPCR | MPIem DNA Core Facility | AGGCAGCACATAGGATGGAT | ||
| Piezo2 reverse primer for qPCR | MPIem DNA Core Facility | GCAGGGTCGCTTCAGTGTA | ||
| Actb forward primer for qPCR | MPIem DNA Core Facility | GATCAAGATCATTGCTCCTCCTG | ||
| Actb reverse primer for qPCR | MPIem DNA Core Facility | CAGCTCAGTAACAGTCCGCC | ||
| Gapdh forward primer for qPCR | MPIem DNA Core Facility | CAATGAATACGGCTACAGCAAC | ||
| Gapdh reverse primer for qPCR | MPIem DNA Core Facility | TTACTCCTTGGAGGCCATGT | ||
| Piezo2 mutagenesis forward primer | MPIem DNA Core Facility | GTCTTCTGGTGGCTCGTGGTCATTTATACCATGTTGG | ||
| Piezo2 mutagenesis reverse primer | MPIem DNA Core Facility | ACGCAGCAGCTTCCTCCACCACTCGTAGTGCAC | ||
| Mtmr2 mutagenesis forward primer | MPIem DNA Core Facility | GTGGTACACTCCAGTGATGGATG | ||
| Mtmr2mutagenesis reverse primer | MPIem DNA Core Facility | CACAGACGTCTTCCCAGA | ||
| Peptide, recombinant protein | Piezo2-FLAG tagged | Custom-made by GenScript | EWWRKILKYFWMSVVIDYKDDDDKQNN | |
| Piezo2 3Q-FLAG tagged | Custom-made by GenScript | EWWQQILQYFWMSVVIDYKDDDDKQNN | ||
| Piezo1-FLAG tagged | Custom-made by GenScript | TLWRKLLRVFWWLVDYKDDDDKQNN | ||
| Chemical compound, drug | Wortmannin | Sigma Aldrich | ||
| Apilimod | Bertin Pharma | |||
| PI(3,5)P2 | Echelon | |||
| PI(3)P | Echelon | |||
| Software, algorithm | Fitmaster | HEKA Electronik GmbH | ||
| Patchmaster | HEKA Electronik GmbH | |||
| ImageJ | NIH (Schindelin et al., 2015) | RRID: SCR_003070 | ||
| GraphPad Prism 6.01 | GraphPad Software | RRID: SCR_015807 |
Additional files
-
Supplementary file 1
Summary of properties of MA currents elicited under various conditions in HEK293 cells and DRG neurons
The table shows the displacement threshold and inactivation time constant (τ) values for all electrophysiological data presented in this study (please see Materials and methods for details on the calculation of each value). Values are represented as mean ± SEM and cell numbers are indicated by ‘n’. Data were not significant (ns) unless otherwise mentioned. Please note: for SA-MA currents, it was not possible to fit the current traces of all cells with a mono or bi-exponential fit (please see Materials and methods for details), hence the cell numbers measured for the inactivation time constant (τ) are lower than actual cell numbers measured and reported in Figure 2.
- https://doi.org/10.7554/eLife.32346.015
-
Transparent reporting form
- https://doi.org/10.7554/eLife.32346.016
