1. Developmental Biology
Download icon

Diversification of heart progenitor cells by EGF signaling and differential modulation of ETS protein activity

  1. Benjamin Schwarz
  2. Dominik Hollfelder
  3. Katharina Scharf
  4. Leonie Hartmann
  5. Ingolf Reim  Is a corresponding author
  1. Friedrich-Alexander University of Erlangen-Nürnberg, Germany
Research Article
  • Cited 5
  • Views 1,069
  • Annotations
Cite this article as: eLife 2018;7:e32847 doi: 10.7554/eLife.32847


For coordinated circulation, vertebrate and invertebrate hearts require stereotyped arrangements of diverse cell populations. This study explores the process of cardiac cell diversification in the Drosophila heart, focusing on the two major cardioblast subpopulations: generic working myocardial cells and inflow valve-forming ostial cardioblasts. By screening a large collection of randomly induced mutants, we identified several genes involved in cardiac patterning. Further analysis revealed an unexpected, specific requirement of EGF signaling for the specification of generic cardioblasts and a subset of pericardial cells. We demonstrate that the Tbx20 ortholog Midline acts as a direct target of the EGFR effector Pointed to repress ostial fates. Furthermore, we identified Edl/Mae, an antagonist of the ETS factor Pointed, as a novel cardiac regulator crucial for ostial cardioblast specification. Combining these findings, we propose a regulatory model in which the balance between activation of Pointed and its inhibition by Edl controls cardioblast subtype-specific gene expression.


eLife digest

Organs contain many different kinds of cells, each specialised to perform a particular role. The fruit fly heart, for example, has two types of muscle cells: generic heart muscle cells and ostial heart muscle cells. The generic cells contract to force blood around the body, whilst the ostial cells form openings that allow blood to enter the heart. Though both types of cells carry the same genetic information, each uses a different combination of active genes to perform their role.

During development, the cells must decide whether to become generic or ostial. They obtain signals from other cells in and near the developing heart, and respond by turning genes on or off. The response uses proteins called transcription factors, which bind to regulatory portions of specific genes.

The sequence of signals and transcription factors that control the fate of developing heart muscle cells was not known. So Schwarz et al. examined the process using a technique called a mutagenesis screen. This involved triggering random genetic mutations and looking for flies with defects in their heart muscle cells. Matching the defects to the mutations revealed genes responsible for heart development.

Schwarz et al. found that for cells to develop into generic heart muscle cells, a signal called epidermal growth factor (EGF) switches on a transcription factor called Pointed in the cells. Pointed then turns on another transcription factor that switches off the genes for ostial cells. Conversely, ostial heart muscle cells develop when a protein called ‘ETS-domain lacking’ (Edl) interferes with Pointed, allowing the ostial genes to remain on. The balance between Pointed and Edl controls which type of heart cell each cell will become.

Many cells in other tissues in fruit flies also produce the Pointed and Edl proteins and respond to EGF signals. This means that this system may help to decide the fate of cells in other organs. The EGF signaling system is also present in other animals, including humans. Future work could reveal whether the same molecular decision making happens in our own hearts.



The heart consists of a variety of cells with distinct molecular and physiological properties in both vertebrates and invertebrates. A complex regulatory network of transcription factors and signaling pathways orchestrates the specification of these different cell populations and their proper arrangement within a regionalized working myocardium or other functional structures such as valves, inflow and outflow tracts (reviewed in Greulich et al., 2011; Miquerol and Kelly, 2013; Rana et al., 2013; for the invertebrate Drosophila heart see for example Bodmer and Frasch, 2010; Lehmacher et al., 2012; Lovato and Cripps, 2016; Reim and Frasch, 2010). For example, the vertebrate T-box gene Tbx20 promotes working myocardial fate by restricting Tbx2 expression and enabling the expression of chamber myocardium-specific genes (Cai et al., 2005; Singh et al., 2005; Stennard et al., 2005). By contrast, Tbx2 and Tbx3 repress working myocardium-specific gene expression and chamber differentiation in the non-chamber myocardium and thus contribute to the formation of endocardial cushions and structures of the conduction system (Christoffels et al., 2004; Hoogaars et al., 2007; Singh et al., 2012). Normal endocardial cushion formation also requires COUP-TFII, an orphan nuclear receptor transcription factor that regulates cell fate decisions in several tissues (Lin et al., 2012; Wu et al., 2016). In the embryonic mouse myocardium, COUP-TFII is restricted to atrial cardiomyocytes, a pattern consistent with a fate determination function that confers atrial over ventricular fate (Lin et al., 2012; Wu et al., 2013). This function appears to involve the up-regulation of Tbx5 (Wu et al., 2013), another T-box gene with non-uniform cardiac expression and a fundamental role in heart development and human cardiac disease (Basson et al., 1997; Bruneau et al., 1999; Bruneau et al., 2001; Ghosh et al., 2017; Steimle and Moskowitz, 2017). Furthermore, FGF-mediated receptor tyrosine kinase (RTK) signaling upstream of the cardiogenic transcription factor Nkx2-5 was recently shown to be required for the maintenance of ventricular chamber identity of cardiomyocytes in zebrafish (Pradhan et al., 2017). As emphasized below, spatial restriction of cardiac transcription factors as well as precisely controlled RTK signaling activities are not only important in vertebrate but also invertebrate hearts (Gajewski et al., 2000; Lo and Frasch, 2001; Zaffran et al., 2006; this work).

The Drosophila heart (dorsal vessel) comprises several types of cardiomyocytes (in the embryo called cardioblasts, CBs) and non-contractile pericardial cells (PCs) (Bodmer and Frasch, 2010; Lovato and Cripps, 2016). The progenitors of these cells are specified in segmentally repeated heart fields located at the intersection of BMP/Dpp and Wg/Wnt signaling activities (Frasch, 1995; Reim and Frasch, 2005; Wu et al., 1995). Subsequent specification of the definitive cardiogenic mesoderm depends on a conserved group of transcription factors, most importantly those encoded by the Nkx2-5 ortholog tinman (tin), the Gata4 ortholog pannier (pnr) and the Dorsocross1-3 T-box genes (three Tbx6-related paralogs that also share features with Tbx2/3/5; in the following collectively called Doc) (Alvarez et al., 2003; Azpiazu and Frasch, 1993; Bodmer, 1993; Gajewski et al., 1999; Junion et al., 2012; Reim and Frasch, 2005; Reim et al., 2003; reviewed in Reim and Frasch, 2010; Reim et al., 2017).

While the identification of cardiogenic factors has greatly improved our understanding of early specification events, much less is known about the mechanisms that lead to the diversification of cardiac cell subpopulations. In this study, we mainly focus on the development of the two major cardioblast subpopulations: generic cardioblasts (gCBs), which build the main portion of the contractile tube (‘working myocardium’), and ostial cardioblasts (oCBs), which form bi-cellular valves (ostia) for hemolymph inflow. Due to Hox gene inputs, ostial progenitor specification is limited to the abdominal region (Lo et al., 2002; Lovato et al., 2002; Ponzielli et al., 2002; Ryan et al., 2005; reviewed in Monier et al., 2007). Current research suggests that each abdominal hemisegment generates at least seven distinct progenitors that give rise to six CBs (4 gCBs + 2 oCBs) and several types of PCs (Tin+/Even-skipped[Eve]+ EPCs, Tin+ TPCs, and Odd-skipped[Odd]+ OPCs; Bodmer and Frasch, 2010 and references therein). Whereas gCBs (a.k.a. Tin-CBs) maintain expression of tin, oCBs (a.k.a. Svp-CBs) specifically express the COUP-TFII ortholog seven-up (svp) and Doc (Gajewski et al., 2000; Lo and Frasch, 2001; Ward and Skeath, 2000; Zaffran et al., 2006). Previous work has shown that Doc is repressed in gCBs in a tin-dependent manner (Zaffran et al., 2006). Robust tin expression in turn depends on the Tbx20 ortholog midline (mid/nmr2). The mid gene is first activated in gCB progenitors, but later, like its paralog H15/nmr1, becomes expressed in all cardioblasts (Miskolczi-McCallum et al., 2005; Qian et al., 2005; Reim et al., 2005). In oCBs, svp represses tin expression thereby permitting continued Doc expression in these cells (Gajewski et al., 2000; Lo and Frasch, 2001; Zaffran et al., 2006). In the abdomen, gCBs and most PCs are preceded by a precursor that undergoes symmetric division, whereas oCBs and half of the OPCs are derived from common, asymmetrically dividing CB/PC progenitors (Alvarez et al., 2003; Han and Bodmer, 2003; Ward and Skeath, 2000).

The process of progenitor specification in the somatic and cardiogenic mesoderm involves the antagonistic actions of RTK/Ras/MAPK and Delta/Notch signaling (Carmena et al., 2002; Grigorian et al., 2011; Hartenstein et al., 1992). Two types of RTKs, the fibroblast growth factor (FGF) receptor Heartless (Htl) and the epidermal growth factor (EGF) receptor EGFR, act positively on progenitor selection via MAPK signaling, although they are used by different progenitors to different extents (Buff et al., 1998; Carmena et al., 2002; Michelson et al., 1998). Htl and its FGF8-like ligands Pyramus (Pyr) and Thisbe (Ths) have a dual function as regulators of mesodermal cell migration and cell specification, with progenitors of the Eve+ lineage as the most prominent example for the latter (reviewed in Bae et al., 2012; Muha and Müller, 2013). EGFR signaling appears to be dispensable for early mesoderm migration events (Wilson et al., 2005) but has been reported to contribute to the specification of particular cell types within the mesoderm, including subsets of adult muscle precursors (AMPs; Figeac et al., 2010) and the Eve+ DA1 muscles (derived from the so-called P15 progenitors in the dorsal mesoderm; Buff et al., 1998; Carmena et al., 1998). By contrast, Eve+pericardial cells derived from the P2 progenitor were shown to form independent of EGFR activity. The exact contribution of EGFR signaling to Drosophila heart development has been less clear until now, but it was shown that EGFR loss-of-function results in a severe reduction of the numbers of cardioblasts, pericardial nephrocytes, and blood progenitors (Grigorian et al., 2011).

Molecularly, the predominant EGFR ligand in the embryo, Spitz (Spi), relies on the protease Rhomboid (encoded by rho) and the chaperon Star (S) for its conversion from a membrane-bound into its active form (reviewed in Shilo, 2014). In contrast to spi, rho expression is restricted to a limited number of cells in a complex and dynamic pattern, including cells of the cardiogenic area (Bidet et al., 2003; Liu et al., 2006), which points to rho expression being the most decisive factor for Spi-mediated EGFR activation. Among the most important downstream effectors of RTK/Ras/MAPK pathways are the ETS transcription factors PntP2 (encoded by pointed/pnt) and Yan/Aop (encoded by anterior open/aop). While PntP2 becomes an active transcriptional activator upon phosphorylation by MAPK, the transcriptional repressor Yan is negatively regulated by MAPK (Gabay et al., 1996; O'Neill et al., 1994). Unlike PntP2, a shorter isoform encoded by pnt, PntP1, is constitutively active but was shown to require activated MAPK for its transcriptional activation at least in some cell types (Brunner et al., 1994; Gabay et al., 1996; Klämbt, 1993; O'Neill et al., 1994). Notably, chordate Pnt orthologs (ETS1/2) were shown to contribute to cardiac progenitor formation in the tunicate Ciona and during transdifferentiation of human dermal fibroblasts into cardiac progenitors (Davidson et al., 2006; Islas et al., 2012). During early Drosophila cardiogenesis, Pnt favors expression of eve over that of another homeobox gene, ladybird (lbe, expressed in mesodermal cells immediately anterior of the Eve+ cluster and later in TPCs and two of the four gCBs per hemisegment; Jagla et al., 1997) (Liu et al., 2006). In addition, Pnt promotes pericardial cell development and antagonizes CB fate, especially that of oCBs (Alvarez et al., 2003).

Despite the progress in the understanding of cardiac progenitor specification, the mechanisms that diversify progenitors of the oCB and gCB lineages have remained elusive. We have performed an unbiased large-scale mutagenesis screen to identify genes that regulate cardiac development in Drosophila embryos and found several mutants that show CB subtype-specific defects. On this basis, we discovered a novel and rather unexpected function of the EGF pathway in specifying the gCBs of the working myocardium, thus revealing an intimate link between cardioblast specification and diversification. Furthermore, we identified ETS domain lacking (Edl a.k.a. Modulator of the activity of ETS, Mae) as a crucial regulator of the specification of inflow valve-forming oCBs. Edl possesses a SAM domain, which mediates binding to the SAM domain-containing ETS factors PntP2 and Yan, thereby inhibiting their activity as a transcriptional activator or repressor, respectively (Baker et al., 2001; Qiao et al., 2006; Qiao et al., 2004; Tootle et al., 2003; Vivekanand et al., 2004; Yamada et al., 2003). Our data imply that Edl enables svp expression and thus oCB fate by limiting the activity of PntP2, thereby blocking subsequent activation of important downstream targets such as pntP1 and mid. Collectively, our data provide the basis for an elaborated model of cardiac cell fate diversification that links MAPK signaling, Pnt activity and the cell-type-specific expression patterns of key cardiac transcription factors.


Novel EMS-induced mutants reveal a specific requirement of EGF signaling for the specification of generic cardioblasts

In order to identify genes involved in heart and muscle development in an unbiased manner, we have performed an EMS mutagenesis screen for chromosome two in Drosophila melanogaster embryos (Hollfelder et al., 2014). Several of the isolated mutants display a partial loss or irregular alignment of cardioblasts (CBs). Such defects may potentially result from mutations in genes that regulate the specification or differentiation of all CBs or only a particular CB subtype. In the latter case, disturbances in the characteristic ‘2 + 4’ CB pattern of two ostial cardioblast (oCBs; Doc+/Tin-) and four generic CBs (gCBs; Doc-/Tin+) per hemisegment are to be expected. To analyze the cardiac pattern of mutants in more detail, we performed immunofluorescent double stainings for Doc and H15 (or alternatively Mef2) to label oCBs and all CBs, respectively. We then genetically and in part also molecularly mapped the mutations responsible for CB pattern anomalies (for details see the Materials and methods section and Supplementary file 1-Table S1). The class of mutants characterized by a loss of CBs contained several novel alleles of genes involved in RTK/Ras/MAPK signaling, which is consistent with the assumed role of this pathway in cardiac progenitor selection or maintenance (Carmena et al., 2002; Grigorian et al., 2011). However, no specific role for the specification of a particular cardioblast subtype or diversification of gCB versus oCB progenitors had been previously attributed to RTK/Ras/MAPK signaling. Our phenotypic analysis now shows that diminished EGF/EGFR but not FGF/Htl signaling leads to a preferential reduction of gCB numbers. Embryos with partially reduced FGF/Htl signaling, that is mutants lacking both copies of the FGF-encoding gene pyr and one copy of its paralog ths, as well as hypomorphic htl mutants, show an about equal reduction of gCB and oCB numbers (Figure 1B, for quantification see Figure 1M; additional examples in Figure 1—figure supplement 1B,C). This CB reduction can be explained by uneven spreading of the early mesoderm to Dpp-receiving areas. By contrast, several mutations mapped to EGF signaling components feature a preferential loss of gCBs. In strong Egfr mutants very few CBs can be found (Figure 1C, Figure 1—figure supplement 1E). Remarkably, the overwhelming majority of the residual CBs express Doc. The few remaining Doc-negative CBs are usually located toward the anterior and thus are possibly remnants of the oCB-free anterior aorta. In spitz, rhomboid and Star loss-of-function mutants, the number of Doc-/Tin+ CBs is strongly reduced while that of ostial Doc+/Tin- CBs is nearly normal or in some cases even increased by a few cells (Figure 1D–G,M, Figure 1—figure supplement 1F, Figure 1—figure supplement 2A–C). In the wild type, the two pairs of sibling gCBs within each hemisegment can be further categorized as Lbe+ (anterior pair) or Lbe- (posterior pair) subtypes. Since the above-mentioned spitz group mutants often feature a single pair of gCBs in each abdominal hemisegment, we tested whether these cells are preferentially Lbe+ or Lbe-, which would indicate that one of the two gCB progenitor types may be more sensitive to impaired EGF signaling. However, our finding that both types are about equally represented in rho mutants (Figure 1—figure supplement 3) argues against this assumption. Moreover, segment-by-segment analysis in homozygous rhoL68 mutants reveals that residual gCBs most frequently occur either as Lbe+ or Lbe- pairs, whereas none of the analyzed residual gCB duplets consisted of a combination of both gCB types. This suggests that EGF function is required for the formation of gCB progenitors prior to their final division. Notably, progenitors of the oCB lineage apparently do not require activity of the ostial marker gene svp to develop and survive independently of EGF, since total CB numbers are similar in Star single and Star svp double mutants (compare Figure 1H–1G; quantification in Figure 1M).

Figure 1 with 4 supplements see all
Genetic manipulation of EGF but not FGF signaling leads to cardioblast subtype-specific heart defects.

Immunostaining for the cardioblast marker H15 (red) and the ostial cardioblast marker Dorsocross (anti-Doc2+3, green). (HG: hindgut with artificial staining in the lumen). All figures depict dorsal views of stage 16 embryos with anterior to the left unless noted otherwise. (A) Wild type (WT) CB pattern with regular alternation of gCBs (red) and oCBs (yellow) in the posterior aorta and the heart proper. The anterior aorta consists entirely of Doc- CBs. (B) Mutant with reduced FGF activity (pyrS3547 over a deficiency, Df(2R)BSC25, that removes pyr and ths) showing a reduction of both CB types. (C) Homozygous EgfrS2561 mutant with a severe loss of CBs. Almost all remaining CBs are Doc+. Predominant reduction of gCBs is also observed in the EGF pathway-impairing spitz group mutants spiS3384 (D), rho7M43/rhoL68 (E), SS4550 (F) and SB0453 (G, showing an extreme case in which all retained CBs except for those of the anterior aorta are Doc+). (H) In S B0453 svpAE127 double mutants, total CB numbers are similar to that of S single mutants, even though all CBs are Doc-negative. (I) If the apoptosis inhibitor p35 is artificially expressed in the mesoderm of S mutants a mild increase in the number of CBs can be observed. Compared to the wild type, more Doc+ CBs are present. (J) Pan-mesodermal overexpression of dominant-negative Egfr results in a phenotype similar to spitz group mutants. Expression of rho in the entire mesoderm via how24B-GAL4 (K) or at later time in dorsal mesoderm cells via tinD +tinCΔ4-GAL4 (L) generates supernumerary gCBs. By contrast, oCB specification is either reduced (K) or unaffected (L) in these backgrounds. (M) Quantification of Doc+ oCBs (green), Doc- gCBs (red) and total cardioblasts (grey). The column bar chart depicts average numbers with standard deviation error bars. Asterisks indicate significant differences compared to the y w control (WT) assessed by Student's t-test (two-tailed, type 3; *=p < 0.05, **=p < 0.001; n.s. = not significant). Brackets indicate comparisons between other genotypes. Pie charts display the corresponding average fraction of oCBs and gCBs.

Figure 1—source data 1

Quantification of Doc+oCBs, Doc- gCBs and total cardioblasts.


Previous studies in EGF pathway mutants suggested that incorrectly specified mesodermal progenitors undergo apoptosis (Buff et al., 1998; Grigorian et al., 2011). Using TUNEL and anti-activated caspase stainings, we could not reliably detect signs of apoptosis in the Tin- or Doc-labeled cardiogenic mesoderm of Star mutants, while numerous signals were observed in other tissues (Figure 1—figure supplement 4 and data not shown). Nevertheless, we obtained indirect evidence for the occurrence of at least some apoptosis by using the baculoviral apoptosis inhibitor p35 (Zhou et al., 1997). If p35 is artificially expressed in the mesoderm of S mutants the number of CBs slightly increases in comparison to S mutants without p35 (Figure 1I,M). Although this is consistent with a pro-survival function of EGF signaling, it does not fully account for the gCBs missing in S mutants. Of note, we detect a small, but statistically significant increase in the average number of Doc+ CBs in comparison to the wild type in spi mutants, in p35-expressing S mutants as well as in embryos overexpressing dominant-negative EGFR (Figure 1M), which suggests that at least some presumptive gCB progenitors adopt oCB-like fates at reduced EGFR activity. However, the observed effects are small and additional explanations such as persistence in an uncommitted dorsal mesoderm cell pool must be considered to fully explain the fate of all lost gCB progenitors (see discussion). Collectively, the cardiac patterning phenotypes imply that EGF signaling plays a major role in the correct specification of gCB progenitors, although we cannot exclude an additional function in cardiac cell survival that might be difficult to detect by the applied methods.

Generic CBs and a subset of Odd+pericardial cells require spatially and temporally coordinated EGF signals

Because EGF signaling is involved in multiple processes during embryogenesis we next asked whether its impact on gCB specification is directly linked to signaling activity within mesoderm cells. Indeed, mesoderm-specific attenuation of the pathway by expression of a dominant-negative EGFR variant resulted in essentially the same phenotype as with the spitz group mutants (Figure 1J,M). Activation of the EGF pathway in mesoderm cells appears to be largely controlled by the spatially restricted expression of rho (Bidet et al., 2003; Grigorian et al., 2011; Halfon et al., 2000). Overexpression of rho with the pan-mesodermal how24B-GAL4 driver has been previously reported to affect the number of tin-expressing pericardial cells (Bidet et al., 2003), but CBs and their subtypes were not unambiguously labeled in these experiments. We extended these experiments using also other drivers. Consistent with a mesoderm-autonomous function, overexpression of rho in the dorsal ectoderm (via pnrMD237-GAL4) has no significant effect on CB number or pattern (Figure 1M and data not shown). By contrast, all mesodermal rho overexpression setups increase the gCBs:oCBs ratio in comparison to the wild type (Figure 1K–M and data not shown). The impact on the absolute CB numbers depends on the timing and strength of transgene expression. The later rho is activated in mesodermal cells (with following drivers according to their temporal order and progressive spatial restriction: twist-GAL4, how24B-GAL4 and tinD +tinCΔ4-GAL4) the larger the total number of CBs (Figure 1K–M and data not shown). This implies that rho activity needs to be tightly regulated, spatially as well as temporally. In the wild-type mesoderm, rho expression is first seen in the Eve+ progenitor P2 (Buff et al., 1998; Carmena et al., 1995; Halfon et al., 2000) followed by expression in the adjacent CB progenitor-containing clusters C14 and C16 (Bidet et al., 2003; Grigorian et al., 2011; see also Figure 2A–D). Of note, stage 11 rho expression is still robustly observed in all C14/C16 clusters in S mutants (Figure 2E cf. 2A), showing that earlier patterning events are not disrupted in this situation. Later during stage 12, when rho RNA is normally found in developing CBs along the dorsal mesoderm margin, a reduction of rho expressing cells is apparent in S mutants (Figure 2F cf. 2C), which is consistent with defects in CB progenitor formation. Importantly, detection of active diphospho-MAPK is severely reduced in cardiac cells of S mutants already in the cardiogenic clusters at stage 11 as well as during 12 in which dpMAPK is normally detected in both ostial and generic CB progenitors (Figure 2H,J cf. 2G,I; later activity in cardiac cells appears to be less affected; Figure 2L cf. 2K). Similar observations were made for embryos with pan-mesodermal overexpression of the dominant-negative EGFR (data not shown). Altogether, this demonstrates that EGF signaling serves as the major positive input for MAPK activation during early gCB progenitor formation, whereas input from FGFs may gain importance in developing CBs at later stages for CB fate maintenance as was proposed previously (Grigorian et al., 2011).

Expression of rho and MAPK activity in cardiac cells.

(A–F) Detection of rho mRNA (green), Mef2 (blue) and Doc (red). (A) At stage 11, rho is detectable in clusters C14/C16 of the cardiac mesoderm (arrowheads) and is fading from the central Doc-negative region containing EPC and somatic muscle progenitors (empty arrowhead). Dashes separate units derived from adjacent mesoderm segments. (B) At late stage 11, rho is expressed at high levels in at least one cardiac progenitor per cluster close to the dorsal mesoderm segment borders. (C, D) As cardioblasts align near the dorsal mesoderm margin during stage 12, rho continues to be expressed in most CBs. (E,F) Detection of rho RNA in SB0453 mutants showing normal rho expression in cardiogenic clusters at stage 11 (E, compare to A) and reduced cardiac expression at stage 12 (F, compare to C). (G–L) Detection of activated MAPK in the cardiogenic region of wild type (G,I,K) and SB0453 mutant (H,J,L) embryos in immunostainings against diphospho-MAPK (dpMAPK, green), Doc (red) and either Mef2 or Mid (blue) as indicated in each panel. (G) dpMAPK is detectable in the Doc+ cardiogenic clusters (arrowheads) of a stage 11 wild-type embryo. (H) This dpMAPK activity is severely reduced in Star mutants. (I) At stage 12, dpMAPK activity is observed in the Mid-expressing gCB progenitors (arrows) and in the Mid-negative oCBs and their sibling PCs (asterisks). (J) By contrast, both Mid and dpMAPK are severely reduced in stage 12 Star mutants. (K) Early stage 13 embryo after germ band retraction but prior to completion of the final mitotic division of the Mid+ gCB progenitors. dpMAPK is still active in all cardiac cells (oCBs and gCBs labeled as in I). (L) In contrast to earlier stages, dpMAPK staining is prominently observed in both oCBs (asterisks) and the few formed Mid+Doc- gCB progenitors (arrow) of Star mutants at the onset of stage 13.


Since half of the odd-expressing pericardial cells (OPCs) are siblings of oCBs, we also analyzed PCs in EGF-related mutants by Odd/Eve as well as Odd/Zfh1 double-stainings (Figure 3A–C,E; Figure 3—figure supplement 1A–D and data not shown). Consistent with the results of previous studies on Eve+ progenitor derivatives (Buff et al., 1998; Carmena et al., 2002; Su et al., 1999), we detected EPCs in almost normal numbers in spi group mutants and in embryos with pan-mesodermal dominant-negative EGFR, whereas spi-dependent Eve+ DA1 muscles were largely absent (Figure 3B,C,E). OPCs are strongly reduced in these loss-of-function backgrounds. Our quantification revealed that about half of the OPCs were lost in rho7M43/L68 and other EGF pathway mutants (Figure 3B,C,E). A converse phenotype with many extra OPCs as well as Tin+ PCs (TPCs, excluding the unaffected EPCs) is generated by rho overexpression with tinD +tinCΔ4-GAL4 (Figure 3D,E; Figure 3—figure supplement 1F). Notably, the number of oCB-sibling OPCs (as identified by svp-lacZ reporter analysis) is not significantly reduced in Star mutants if compared to the wild type (Figure 3F,G), thus implying that the EGF signaling-dependent OPCs are those derived from symmetrically dividing OPC progenitors.

Figure 3 with 1 supplement see all
EGF signaling promotes the formation of Odd+PCs.

(A–D) Odd/Eve staining to analyze pericardial cells (PCs). (A) In the wild type, each hemisegment contains four OPCs, two EPCs and one Eve+ somatic muscle DA1 (*). (B) Amorphic rho7M43/L68 mutant with a loss of about half of all OPCs and all DA1 muscles. (C) Pan-mesodermal overexpression of the dominant-negative Egfr results in a phenotype similar to rho mutants. (D) Overexpression of rho in the dorsal mesoderm generates supernumerary OPCs. The number of EPCs is not affected by altered levels of EGF signaling. (E) Quantification of OPCs (green) and EPCs (red). Only abdominal PCs (located posterior to the lymph gland, LG) were included into the analysis. Significant differences compared to the y w control (WT) are designated as in Figure 1. Colored dashed lines mark the average numbers of OPCs and EPCs counted in the wild type. (F,G) Doc2+3/β-galactosidase (LacZ) staining in wild type (F) and Star mutant embryos (G) carrying a heterozygous copy of svpAE127-lacZ and showing presence of normal numbers of oCBs (Doc+/LacZ+) and their OPC siblings (Doc-/LacZ+). Bottom panels show a higher magnification and β-galactosidase single channel view of the upper panel. RG: ring gland, FB: fat body.

Figure 3—source data 1

Quantification of OPCs and EPCs.


In sum, these data demonstrate that EGF pathway activity is required in the mesoderm specifically for the specification of the symmetrically dividing gCB and OPCs progenitors (and probably also for those of the TPCs, which we did not quantify in detail) but is largely dispensable or even detrimental for the specification of the svp-expressing oCB/OPC progenitors.

The SAM domain protein Edl promotes specification of ostial cardioblasts by blocking Pointed activity

Our EMS screen also yielded mutants in which the number of ostial cardioblasts was specifically reduced. One such complementation group consisting of three alleles was mapped to the numb gene (alleles listed in Supplementary file 1-Table S1), which is consistent with its well-known function as a Notch suppressor during asymmetric cell division in the oCB lineage (Gajewski et al., 2000; Ward and Skeath, 2000). Preferential reduction of oCBs was also observed in the mutant line S0520. We found that its cardiac phenotype was caused by loss of the gene ETS domain lacking (edl) as part of a multi-gene deletion and named this mutant Df(2R)edl-S0520 (Figure 4A, Supplementary file 2-Table S2). We identified edl as the gene responsible for the oCB losses by obtaining phenocopies with other edl mutants (Figure 4A–D and data not shown). The lacZ enhancer trap insertion allele edlk06602 was used in most edl loss-of-function experiments since its cardiac phenotype is indistinguishable from that of Df(2R)edl-S0520 and Df(2R)edl-L19 (Figure 4C,D and data not shown), and we detected in this strain a small deletion that specifically destroys the edl gene (Figure 4A, Supplementary file 2-Table S2). Furthermore, we were able to rescue the cardiac phenotype of edl by introducing a genomic edl transgene (Yamada et al., 2003; Figure 4E). Phenotypic rescue was also achieved, albeit with lesser efficiency, by artificially expressing edl in the dorsal mesoderm cells or in cardioblasts using the drivers tinD-GAL4 and tinCΔ4-GAL4, respectively (Figure 4F,G), demonstrating that Edl is required directly within these cell types. In accordance, edl mRNA is found within the cardiogenic region during stages 10 to 12 (Figure 4—figure supplement 1A–C; Figure 4—figure supplement 2A–D), including prominent expression in early svp-expressing oCB progenitors (Figure 4—figure supplement 2E). Thereafter edl expression shifts to the pericardial region, where it persists until stage 15 (Figure 4—figure supplement 1D and data not shown).

Figure 4 with 2 supplements see all
Edl is a decisive factor of ostial cardioblast specification.

(A) Map of the edl locus with the used alleles and deficiencies. (B–I) Doc2+3/H15 stainings as in Figure 1. (B) Embryo with transheterozygous combination of Df(2R)edl-S0520 (edl deleted) and Df(2R)ED3636 (edl present) showing a regular ‘2 + 4’ CB pattern of oCBs and gCBs. By contrast, amorphic edl mutants Df(2R)edl-S0520/Exel7157 (C) and edlk06602 (D) have only few oCBs. Note the occurrence of ‘1 + 5’ CB patterns (bracket). (E) The regular CB pattern is restored by a genomic edl+ transgene. A nearly normal CB pattern is observed in edl mutants upon expression of UAS-edl in the dorsal mesoderm via tinD-GAL4 (F) or only in CBs or their progenitors via tinCΔ4-GAL4 (G). In cardioblast-specific tin mutants (carrying a rescue construct for early tin function) all CBs present become Doc+, irrespective of whether edl is functional (H) or not (I). Observation of some H15- Doc+ CBs in (H) and (I) suggest that robust H15 expression requires normal tin function. (J) Mutually exclusive expression of Doc and Tin proteins in the wild type at late stage 15. (K) In edl mutants, Doc and Tin are co-expressed in some CBs (arrowheads). These oCBs display either low level expression of both Tin and Doc (as exemplified in the magnification) or low levels of Tin concurrent with close to normal levels of Doc. Asterisks denote positions of artificial signal overlap due to co-projection of oCBs and TPCs.


A distinctive feature of edl mutants is that the normal ‘2 + 4’ pattern of 2 Doc+ CBs + 4 Doc- CBs is often transformed into a ‘1 + 5’ pattern (e.g. bracket in Figure 4D), indicating a fate switch from ostial to generic CBs. However, Edl is not a direct activator of Doc expression because Doc is found in CBs of edl double mutants with CB-specific ablation of tin (Figure 4I), a phenotype reminiscent of that of CB-specific tin single mutants (Figure 4H; Zaffran et al., 2006). This suggests that edl normally contributes to the activation of Doc in oCBs via suppression of tin. This role of edl in CB patterning is further supported by the observation of some CBs with low levels of both Tin and Doc in edl mutants (Figure 4K; compare to the strictly complementary distribution of Doc and Tin in the wild type, Figure 4J).

Next, we analyzed Edl function by ectopic expression. Consistent with a mesoderm-autonomous function, overexpressing edl in the dorsal ectoderm via pnrMD237-GAL4 has no significant effect on cardiogenesis (data not shown). By contrast, overexpression of edl in the entire mesoderm via twist-GAL4 results in an increase of CB numbers (Figure 5A) and a decrease of OPCs (described in the next subsection). The increase in Doc+ CBs is disproportionately high. The extra Doc+ CBs in the heart proper also activate ostial cell differentiation markers such as wg (data not shown). In agreement with the proposed function of Edl as a negative regulator of PntP2 (Yamada et al., 2003), our overexpression phenotypes of edl are very reminiscent to that of pntP2-specific mutants (pntRR112 reported in Alvarez et al. (2003); and pntMI03880 shown in Figure 5B) and amorphic pnt mutants (pntΔ88, pnt2; see Figure 5E,I and Alvarez et al., 2003). Accordingly, overexpression of constitutively active PntP2VP16 (Figure 5C) or PntP1 (not shown) via tinD +tinCΔ4-GAL4 causes a phenotype similar to that of edl loss-of-function mutants (Figure 4C,D). By contrast, analogous overexpression of the potential Edl target Yan/Aop leads to a loss of heart cells irrespective of their subtype (Figure 5D). These losses may result from a more general block in cell specification and differentiation since Yan has been related to such functions in several other types of MAPK-dependent progenitors (Bidet et al., 2003; Caviglia and Luschnig, 2013; Halfon et al., 2000; Rebay and Rubin, 1995). If the predominant function of Edl during CB specification is the inhibition of Pnt, edl pnt double mutants should mimic pnt mutants. In principle, this is what we observed (Figure 5E,F; quantifications in Figure 5I). By contrast, edl aop double mutants show an additive combination of aop and edl single mutant phenotypes (compare Figure 5H with 5G and 4D; see also quantifications in Figure 5I). Amorphic aop mutants display a reduction in CB number irrespective of CB subtype, which we ascribe to a permissive function during CB development that is probably linked to its well-documented role in restricting eve expression in the early dorsal mesoderm (Bidet et al., 2003; Halfon et al., 2000; Liu et al., 2006; Webber et al., 2013). Importantly, and in contrast to edl and pnt activity changes, manipulating aop activities does not lead to significant shifts in the oCBs:gCBs ratio (Figure 5I). Thus, we suggest that Edl acts mainly via negative modulation of PntP2 activity during cardioblast diversification.

Figure 5 with 2 supplements see all
Edl promotes oCB fate via inhibition of PntP2.

(A–H) CB pattern in embryos with modified activity of edl and/or genes encoding the ETS proteins Pnt and Yan revealed by H15/Doc2+3 stainings. (A) Pan-mesodermal edl overexpression via twist-GAL4 leads to extra CBs with a disproportionately high increase in oCB numbers. This phenotype is reminiscent to that of the pnt mutants pntMI03880 (a PntP2-specific mutant; here in trans with a pnt-deleting deficiency, (B) and pntΔ88 (without any functional Pnt isoform, (E). (C,C') Conversely, an edl mutant-like phenotype (loss/conversion of oCBs, exemplified by arrowheads for one hemisegment, and CBs with low Doc levels marked by asterisks) is generated by overexpression of a constitutively active PntP2 variant in the dorsal/cardiogenic mesoderm. C and C' depict strong and weak phenotypes, respectively. (D) Overexpression of the constitutively active repressor Yan/Aop leads to a loss of both gCBs and oCBs. (E,F) The CB phenotypes of pnt and edl pnt double mutants are very similar suggesting that edl acts mainly by blocking Pnt activity during CB specification. (G) Hemizygous aop mutant showing a moderate reduction of both CB types. (H) edl aop double mutant combining aop-like and edl-like defects. (I) Quantification of cardioblasts in various genotypes affecting Edl, Pnt or Yan/Aop activities (annotated as in Figure 1M).

Figure 5—source data 1

Quantification of cardioblasts in various genotypes affecting Edl, Pnt or Yan/Aop activities.


An additional function of Pnt (and thereby Edl) regarding to the total number of CBs is also apparent in Figure 5. The increase in the total CB number detected in pnt mutants is reminiscent of Notch pathway mutants. Figure 5—figure supplement 1 shows examples of such mutants isolated from our EMS screen. There is an important difference between pnt and Notch pathway mutants regarding the oCBs:gCBs ratio. Whereas oCBs account for about 40–50% of the CBs in pnt mutants (as compared to 27% in the wild type), all Notch pathway mutants for which CB patterning data are available feature a significantly smaller fraction of oCBs than pnt mutants (Figure 5—figure supplement 1D). The maximum fraction of oCBs observed was 33% of the total CB number, found in mamS0669. In kuz mutants (data not shown; Albrecht et al., 2006), oCBs even increase by smaller factors than gCBs resulting in oCB fractions below 27%. (Some differences in the oCBs:gCBs ratio between various Notch pathway mutants are likely to arise from variable impact on lateral inhibition and specific functions of Notch in asymmetrically dividing lineages). On a side note, edl expression, which was found to be positively regulated by Notch signaling in a Drosophila cell culture system (Krejcí and Bray, 2007), is not negatively affected in the cardiogenic mesoderm of two mam alleles and in bibS1538 mutants (Figure 5—figure supplement 2 and data not shown).

Edl and Pnt regulate ostial fate by controlling seven-up expression

The population of oCBs is characterized by expression of svp. In svp mutants all oCBs are converted into Tin+/Doc- CBs due to de-repression of tin (Gajewski et al., 2000; Lo and Frasch, 2001; Zaffran et al., 2006; Figure 6—figure supplement 1A). Therefore, we tested the possibility that Edl promotes oCB fate by regulating svp. In the wild type, expression of svp is recapitulated by the enhancer trap svpAE127-lacZ (Figure 6A; Lo and Frasch, 2001). In edl mutants, svp-LacZ expression is strongly reduced in cardiac cells (Figure 6B,D). The reduction in numbers of both svp-LacZ+ oCBs and OPCs at late stages (Figure 6D cf. 6C) suggests that edl already affects the fates of their common progenitors. Consistent with a function in promoting svp expression and oCBs fates, mesodermal overexpression of edl leads to larger numbers of svp-LacZ+ cardiac cells, particularly of CBs, where svp expression correlates with expanded Doc expression (Figure 6E,F). As shown for Doc expression, svp expression can be suppressed by PntP2 hyperactivity (green asterisks in Figure 6H). These observations and further evaluation of the epistatic relations between svp and edl (Figure 6—figure supplement 1) demonstrate that edl affects CB patterning by blocking Pnt activity upstream of svp.

Figure 6 with 1 supplement see all
Edl is required for svp expression.

(A) In stage 12 control embryos (lateral view) carrying one copy of svpAE127-lacZ, β-galactosidase is detected in oCBs (arrows) and their sibling OPCs (arrowheads) within the Mef2-labeled mesoderm. (B) Cardiac svp-LacZ expression is strongly reduced in edl mutants (Df(2R)edl-S0520/Exel7157;svpAE127-lacZ/+). (C–E) Odd/svp-LacZ staining in stage 16 embryos. (C) In the control, each hemisegment contains two oCB-related svp-LacZOPCs and two svp-LacZ- OPCs. The total number of OPCs decreases if edl is absent (Df(2R)edl-S0520/edl-L19;svpAE127-lacZ/+) (D) or overexpressed (E), but different OPC subpopulations account for these losses: svp-LacZOPCs (arrowheads) are reduced in edl mutants, svp-LacZ- OPCs in edl overexpressing embryos. (E,F) Pan-mesodermal overexpression of edl leads to a drastic increase in the number of svp-LacZ+/Doc+ cardioblasts (Odd-). Compare F to the control in Figure 3F. (G,H) Mef2/Doc2+3/β-galactosidase staining in svp-lacZ/+ controls (G) and embryos overexpressing constitutively active pntP2VP16 in the dorsal mesoderm (H). Overexpression of pntP2VP16 via tinD-GAL4 leads to significantly reduced svp and Doc expression (examples labeled with green asterisks; average number of Svp+ CBs: 20.6 ± 3.0, p=0,00069**; accompanied by an increased number of Svp- CBs: 83.4 ± 2.6, p=0.00015**; n = 7) as compared to normal oCBs (red asterisks). LG: lymph gland, RG: ring gland, FB: fat body.


Cardioblast subtype-specific expression of the PntP1 isoform is regulated by PntP2 and Edl

Proposing a gCB-specific function of Pnt, we next analyzed its cardiac expression. Boisclair Lachance et al. previously reported that the expression of a fully functional genomic pnt-GFP transgene mirrors the combined expression of all Pnt isoforms (Boisclair Lachance et al., 2014). The authors detected Pnt-GFP fusion protein in nearly all cells of the cardiac region, but highest levels were observed in two Yan-negative clusters per hemisegment flanking Eve+ cells. We confirmed and refined these observations showing that high levels of Pnt-GFP are present in the nuclei of gCB progenitors as identified by their position, characteristically enlarged size, presence of only low levels of Doc, and absence of svp-LacZ expression (Figure 7A). We attribute these high total Pnt levels largely to a gCB-specific expression of the PntP1 isoform since PntP1-specific antibodies (Alvarez et al., 2003) specifically label gCB progenitors (Figure 7B), whereas pntP2 transcripts are present in a rather uniform pattern in the mesoderm including the cardiogenic area (Klämbt, 1993; and data not shown). We further speculated that PntP2 could activate pntP1 transcription in gCB progenitors for a sustained signaling response as found in other tissues (Shwartz et al., 2013). This assumption is indeed supported by our genetic data. First, we detect PntP1 in an expanded pattern in the cardiogenic mesoderm of edl mutants in which PntP2 activity is assumed to increase (Figure 7C). Second, overexpression of edl (i.e. repression of PntP2 function) as well as genetic disruption of pntP2 resulted in a near-complete loss of cardiac PntP1 (Figure 7D,E; note persistent expression of PntP1 in other cells located more laterally). We conclude that the combined activities of Edl and PntP2 lead to the confined pntP1 expression in gCBs. The EGF Spitz appears to be a major, although not necessarily the sole factor for the MAPK-mediated activation of PntP2 in this context, because PntP1 levels are reduced but not eradicated in cardiac cells of amorphic spi mutants (Figure 7F).

Figure 7 with 2 supplements see all
PntP1 and Mid are specifically expressed in early gCB progenitors to antagonize oCB fate.

(A) Detection of Doc3+2, β-galactosidase and GFP-tagged Pnt (all isoforms) in a pnt-GFP/+; svpAE127-lacZ/+ embryo at the beginning of stage 12 (lateral view). Highest levels are observed in gCB progenitors (large svp-LacZ-negative nuclei with low levels of Doc, arrowheads) and low levels in oCBs and their siblings (small svp-LacZ+ nuclei with higher Doc levels, arrows). (B) At the onset of germ band retraction, PntP1 becomes expressed in gCB progenitors (arrowheads) of wild type embryos. Cardiac cells are labeled via anti-Doc3+2 staining. PntP1 is not detected in oCBs and their siblings (arrows). (C) In edl- mutants cardiac PntP1 expression is generally increased and detected ectopically in some small nuclei that correspond to prospective oCBs and their siblings (arrows). (D) Pan-mesodermal overexpression of edl leads to a strong decrease of cardiac PntP1 expression while other mesodermal tissues are less affected. (E) The same effect is seen in pntP2 mutants. (F) In spi mutants PntP1 levels are reduced as well, although not as severely as upon loss of pntP2 function. (G) Like PntP1, Mid protein is found in gCB progenitors (arrowheads), but not in prospective oCBs (arrows) at the beginning of germ band retraction. (H,I) The cardiac phenotype of mid mutants is characterized by variable expansion of Doc, which largely correlates with ectopic svp expression in CBs (I, normal pattern shown in Figure 3F). (J) Overexpression of mid represses svp expression in H15-labeled cardioblasts (arrowheads indicate a hemisegment with five lacZ-negative nuclei). (K) Combining homozygous mid and edl mutations results in the restoration of oCBs in comparison to edl single mutants (Figure 4D), suggesting that edl normally antagonizes mid function. An additional edl function regarding the total CB number is not rescued by abrogation of mid. (L) Overexpression of mid in the dorsal mesoderm via tinD-GAL4 in a pnt null background converts many of the extra oCBs into gCBs (cf. Figure 5E).


The Tbx20 ortholog Midline contributes to Pnt-dependent repression of svp in the working myocardial lineage

According to the common view, we expect Pnt to act as a transcriptional activator also during CB diversification, particularly since overexpression of PntP2 fused to the VP16 activator domain has essentially the same effect on cardiac patterning as PntP1 overexpression (Figure 6H and data not shown). Therefore, its negative impact on svp expression is likely to involve Pnt-dependent activation of a transcriptional repressor. Interestingly, the T-box factor Midline (Mid), like PntP1, shows expression in early gCB progenitors (Figure 2I,K; Figure 7G). We previously reported that mid functions to maintain tin expression in gCBs, thereby restricting Doc expression to oCBs (Reim et al., 2005). Consistent with this function our EMS screen also generated novel mid alleles showing the same CB patterning defects as previously described alleles (Supplementary file 1-Table S1, Figure 7H and data not shown). While a direct regulation of tin by Mid was previously proposed to be responsible for these changes (supported by the gain- and loss-of-function phenotypes of mid; Qian et al., 2005; Reim et al., 2005), another non-exclusive scenario could involve repression of svp (encoding a repressor of tin) by Mid. Consistent with the latter, we observe a Doc-like expansion of svp expression in mid loss-of-function mutants (Figure 7I) and a reduction of svp expression upon ectopic overexpression of mid via tinD +tinCΔ4-GAL4 (Figure 7J). Moreover, persistent tin expression in all CBs of mid svp double mutants (Figure 7—figure supplement 1D, compare to control in A and single mutants in B and C) demonstrates that mid is not directly required for tin expression in CBs. Furthermore, the wild type-like expression of svp-lacZ (with nearly no LacZ in gCBs) observed in the same genetic background argues for the involvement of a Svp-dependent positive feedback loop in ectopic cardiac svp activation in gCBs, as has been predicted previously based on svp overexpression studies (Zaffran et al., 2006). The cardiac pattern phenotype of edl mid double mutants is a composite of the single mutant phenotypes. The number of oCBs (average oCBs: 24.4 ± 3.6; n = 6) is strongly increased as compared to edl mutants, but reduced in comparison with mid mutants, with total CB numbers being similar to those of edl mutants. In some cases, a near wild-type pattern is observed (Figure 7K), although many embryos display an asymmetric arrangement of CBs. While the prevalence of many Doc-negative CBs in this background implies that mid is not the only factor that limits oCB fate, it also indicates that edl is normally required in the oCB lineage to restrict mid activity, possibly by blocking a Pnt-dependent activation of mid transcription. This hypothesis is indeed supported by the reversion of ectopic Doc and svp expression in pnt mutants upon forced mid expression (Figure 7L, Figure 7—figure supplement 2C). By contrast, overexpression of the previously assumed Mid target tin in this background only represses Doc, but not svp (Figure 7—figure supplement 2D).

To further test the idea that Mid is a repressor of oCB fate downstream of pnt, we analyzed whether it is a direct target of Pnt. Notably, an enhancer identified as a Tin target and named midE19 (mid180 for a shorter minimal version) was recently shown to drive mid expression specifically in gCBs (Jin et al., 2013; Ryu et al., 2011; Figure 8A–C; Figure 9A,C). Since this enhancer does not drive reporter expression in oCBs after germ band retraction as detected for mid in the genomic context, additional cis-regulatory regions must be at work to reproduce all aspects of cardiac mid expression. The characteristic activity pattern of the enhancer suggests that this regulatory region may be specifically (or exclusively) devoted to the reception of early gCB-specific inputs. Consistent with our assumption that this enhancer is also a target of Pnt, very little midE19-GFP activity is detectable in pnt mutants (Figure 8D), reduced activity is observed in embryos with mesodermal edl overexpression (Figure 8E), and expanded activity is seen upon overexpression of PntP1 (Figure 8F; note occasional expansion into CBs with no detectable Tin) or PntP2VP16 (not shown). An observed reduction of midE19-driven GFP levels in many of the retained Tin+ gCBs of rho mutants (Figure 8G) corroborates that EGF signaling feeds into mid activation. The idea that mid is a target of Pnt is further supported by the almost complete elimination of reporter activity upon mutating a single ETS binding motif within the mid180 minimal cardiac enhancer (Figure 9A–D) as well as the strong reduction of endogenous mid transcription in emerging CBs during germ band retraction stages in pnt mutants (Figure 9E–H). After germ band retraction, endogenous mid is activated independently of pnt in all CBs (Figure 9J) as observed in the wild type (Figure 9I) indicating that distinct mechanisms regulate mid transcription in early gCB progenitors and maturing CBs.

Characterization of a Pnt-responsive mid enhancer.

(A–C) Expression analysis of the midE19-GFP reporter in the wild type background showing segmental expression in gCB progenitors at stage 12 (A: co-expression of GFP RNA, Mef2 and low levels of Doc) and later in the Tin+/H15+ gCBs (bracket; B: stage 14 stained for GFP protein and Tin; C: stage 16 stained for GFP, Tin and H15 proteins). No or very little reporter expression is detectable in oCBs and their presumed precursors (arrows). (D) Despite an overall increase in CB number, midE19-GFP expression is severely reduced in amorphic pnt mutants. Most of the Tin+/H15+ gCBs (purple nuclei, arrowheads) lack GFP expression. (E) Mesodermal overexpression of edl via how24B-GAL4 also leads to a loss of midE19-GFP in many gCBs. (F) Overexpression of pntP1 via how24B-GAL4 leads to nearly continuous midE19-GFP expression in CBs. In some instances, the reporter is activated even in Tin- CBs (arrows). (G) Loss of rho function, which is expected to cause reduced PntP2 activity, leads to a complete loss of GFP in some of the retained gCBs (arrowheads) and a level reduction in others (arrows). In comparison to pnt mutants (D), a higher fraction of gCBs retains substantial GFP expression indicating additional, rho-independent inputs upstream of Pnt.

Additional experimental support for the regulation of mid by the ETS factor Pnt.

Expression of GFP RNA (A, stage 13) and protein (C, stage 16) driven by the minimal cardiac mid enhancer, mid180, is less robust than midE19-GFP but shows essentially the same expression pattern. The minimal enhancer contains a single ETS binding motif flanked by two Tin-binding sites (indicated in the scheme below). (B,D) Mutating the ETS-binding site leads to near-complete abolishment of mid180-GFP expression. (E–J) Analysis of mid mRNA expression in cardiac cells doubly stained with anti-Doc3+2 antibody. In the wild type, mid mRNA is first detected in gCB progenitors at early stage 12 (E); its expression begins to expand during germ band retraction (G) until it reaches continuous expression in all CBs at stage 13 (I). By contrast, amorphic pnt mutants show reduced cardiac mid expression during germ band retraction (F,H). Regular uniform mid expression is observed only after germ band retraction (J).


In sum, our data lead to the conclusion that EGF signaling contributes to gCB specification by at least two distinct mechanisms, Pnt-independent specification of a subset of cardiac progenitors as well as Pnt-dependent inhibition of ostial cardioblast fate. Modulation by Edl is needed to inhibit Pnt-dependent gene activation and thus enable formation of ostial cardioblasts.


The specification and diversification of particular cell types are linked to the establishment of lineage-specific transcriptional programs. The differences in these programs are often prompted by distinct local signaling activities. The cells in the early heart fields of Drosophila acquire their cardiogenic potential by intersecting BMP and Wnt signal activities (Frasch, 1995; Reim and Frasch, 2005; Wu et al., 1995), but cell diversification within this area requires additional regulatory inputs. Previous studies established that progenitors of cardioblasts, pericardial cells and dorsal somatic muscles are selected by RTK/Ras/MAPK signaling, whereas lateral inhibition by Delta/Notch signaling activity counteracts this selection in neighboring non-progenitor cells (Carmena et al., 2002; Grigorian et al., 2011; Hartenstein et al., 1992). The progenitors of the definitive cardiogenic mesoderm, which give rise to all cardiac cells except for the somatic muscle lineage-related EPCs, co-express the cardiogenic factors Tin, Doc and Pnr, a unique feature that separates them from other cells (Reim and Frasch, 2005). In addition to limiting the number of progenitors, Notch signaling has a second function during Drosophila cardiogenesis that promotes pericardial (or in thoracic segments, hematopoietic) over myocardial fate (Albrecht et al., 2006; Grigorian et al., 2011; Hartenstein et al., 1992; Mandal et al., 2004). Other factors previously reported to impose heterogeneity in the heart field include the cross-repressive activities of the homeodomain factors Eve and Lbe (Jagla et al., 2002) as well as ectoderm-derived Hedgehog (Hh) signals (Liu et al., 2006; Ponzielli et al., 2002). In segmental subsets of cardioblasts, Hh signaling was proposed to act as a potential activator of svp in prospective oCBs (Ponzielli et al., 2002) but whether these are direct or indirect effects of Hh on these cells has not been ascertained.

Based on the findings of our study, we present a novel model of cardioblast diversification that introduces EGF signaling activities and lineage-specific modulation of the MAPK effector Pointed by Edl as crucial factors for the specification of generic working myocardial and ostial cell fates (Figure 10). We propose that EGF/MAPK signaling promotes the development of generic working myocardial progenitors (red cell in Figure 10) by two mechanisms that differ in their requirement for the ETS protein Pnt:

  1. EGF promotes the correct selection and specification of gCB progenitors. This is evident from our loss- and gain-of-function analysis of EGF signaling components. This EGF function is obviously independent of pnt, since pnt null mutants display excessive numbers of CBs (with gCB numbers comparable to the wild type or even increased), a phenotype different from that of mutants defective in EGF pathway components upstream of Pnt (Alvarez et al., 2003); this study).

  2. EGF signals affect the diversification of CB progenitors by impinging on a PntP2-dependent transcriptional cascade that eventually leads to suppression of Tin- oCB and the adoption of Tin+ gCB fates. This function is mediated by stimulating the gCB progenitor-specific expression of regulatory genes such as mid (depicted in red in Figure 10), which in turn will promote transcription of gCB-specific differentiation genes and/or repression of oCB-specific factors (depicted in green in Figure 10).

Figure 10 with 1 supplement see all
Model of regulatory interactions in generic and ostial CB progenitors.

Genes activated in a subtype-specific manner in gCB or oCB progenitors are colored in red and green, respectively. Larger font sizes and thicker lines indicate higher levels. Dashed lines indicate presumed regulations. In principle, MAPK can be activated in cardiac progenitors by EGF/EGFR and FGF/Htl signals. Generic cardioblast development depends on EGF-activated MAPK signaling which provides pnt-independent and pnt-dependent functions. The suppression of svp and subsequent regulation of tin and Doc is a pnt-dependent function that is in part mediated by activation of mid in presumptive gCBs. This step is likely to be supported by the gCB-specific expression of constitutive active PntP1. The gCB-specific cascade may require a higher level of MAPK activity to overcome the blockage of PntP2 by Edl. Alternatively or in addition, Edl levels might be differentially regulated in gCBs and oCBs by yet unknown mechanisms. In oCB progenitors, Edl keeps activated PntP2 below a critical threshold leading to absence or delayed onset of expression of oCB fate antagonists such as mid. This in turn permits svp activation by Hox genes and Tin derived from early stages. Presumed transcriptional activators of svp acting downstream of segmental Hh signals in oCB progenitors are not mandatory in this model, although it does not categorically exclude such contributions. Some details and additional interactions have been omitted for clarity. For a more complex version of the model see the corresponding figure supplement.


Since this study focuses mainly on the second, Pnt-dependent cardioblast diversification function, we elucidate the regulatory circuitry within each cardioblast lineage more extensively in the paragraphs further below. Prior to that, we briefly discuss our findings regarding the EGF signaling function during CB progenitor formation.

EGF signaling and cardiac progenitor selection

According to our data, EGF signals are the major source for MAPK activation and progenitor specification in the symmetrically dividing progenitors of gCBs and OPCs (and likely also TCPs). By contrast, EGF signals are dispensable (in high doses even unfavorable) for the development of progenitors of oCBs and their sibling OPCs. Thus, EGF signaling clearly has a lineage-specific function, which is most easily explained by a requirement for progenitor selection and cell fate specification. This interpretation does not preclude contributions to cell survival (which might depend on differentiation) or lineage-specific divisions (i.e. correct progenitor specification is a prerequisite of the subsequent final division). Notably, in most hemisegments of the analyzed EGF pathway mutants, the number of gCBs is reduced by even numbers and remaining gCB pairs are usually of the same subtype regarding Lbe expression, arguing for a requirement prior to completion of the final mitotic division at the progenitor stage. Since we have only minor evidence for apoptosis and fate conversions into other cell types in EGF-related mutants (minor increase in oCBs, overall reduction of PCs) we propose that many of the missing gCBs are not selected as highly Delta-expressing CB progenitors upon reduced MAPK signaling activity (Carmena et al., 2002; Grigorian et al., 2011; Hartenstein et al., 1992). Instead, they are likely retained by default within a pool of undifferentiated dorsal mesoderm cells.

Our overexpression studies demonstrate that the timing of EGF signals is crucial for their function in differential progenitor specification. In previous studies, earlier functions of MAPK signaling might have obscured its specific impact on gCBs and OPC subtypes. While early pan-mesodermal activation of MAPK signaling or expression of constitutive active Pnt forms via the twi-GAL4 driver reduces the numbers of all cardiac cells except the Eve+ progenitors (Alvarez et al., 2003; Bidet et al., 2003; Liu et al., 2006; and our own data), later MAPK activation favors formation of the symmetrically dividing OPC, TPC and gCB progenitor subpopulations (e.g. as seen in our experiments with tinD-GAL4-driven rho). We propose that the specification of these progenitors requires the context of the definitive cardiogenic mesoderm, whereas premature MAPK activation in all mesoderm cells negates any pro-cardiogenic effects due to the massive expansion of Eve+ clusters (which are normally the first cells in the heart field to display MAPK and rho activity) at the expense of the cardiac progenitors in the neighboring C14/C16 clusters (Buff et al., 1998; Jagla et al., 2002; Liu et al., 2006; Qian et al., 2005; and our own data not shown).

As discussed above, cardioblast formation as such is independent of pnt. How could this be achieved? Growth factor-activated MAPK can also phosphorylate the repressor Yan thereby diminishing its activity as an antagonist of progenitor selection (Halfon et al., 2000; O'Neill et al., 1994; Rebay and Rubin, 1995). Therefore, it is conceivable that MAPK activity in the context of CB progenitor selection might be primarily required to eliminate the repressive activity of Yan. This would be consistent with the observed reduction of cardiac cells upon aop/yan hyperactivation (Halfon et al., 2000; this study). In this context, a minor function of Edl could contribute to the robustness of cardiac progenitor selection and thus total cardioblast and pericardial cell numbers by reducing the repressive Yan activity.

A novel model for cardioblast diversification connecting EGF signaling, ETS protein activity and lineage-specific transcription factor patterns

Combining previous findings with our new data we have conceived the regulatory model of cardioblast diversification illustrated in Figure 10. The central element of this model is the differential modulation of Pnt activity in the gCB and oCB progenitors leading to lineage-specific outcomes.

Basic features of gene regulation in the gCB lineage

We identified mid as a key target gene of Pnt in gCB progenitors based on its early gCB-specific expression, Pnt-dependent transcriptional regulation and its ability to repress the oCB-specific regulator gene svp. Since Svp represses tin expression (Gajewski et al., 2000; Lo and Frasch, 2001), svp suppression provides an important part of the explanation for the previously reported positive role of Mid in maintaining tin expression in gCBs (Qian et al., 2005; Reim et al., 2005). Furthermore, expanded expression of tin in mid svp double mutants argues against the possibility that Mid stimulates tin expression directly. While Tin acts as a repressor of Doc via unknown mechanisms in gCBs, it does not repress svp (Zaffran et al., 2006; Figure 7—figure supplement 2D). On the contrary, at least in the early cardiogenic mesoderm, it acts as an activator of svp in oCB progenitors (Ryan et al., 2007). Thus, in the absence of appropriate repressors such as Mid, svp expression can expand into gCBs.

Basic features of gene regulation in the oCB lineage

In prospective oCB progenitors, Pnt activity must be kept in check to permit svp expression and thereby tin repression and Doc activity. Fittingly, we identified edl, a gene linked to negative regulation of MAPK signaling and cell identity determination in several tissues - including the eye (Yamada et al., 2003) and recently in certain somatic muscle progenitors (Dubois et al., 2016) - as a novel regulator in the context of cardiac cell specification, particularly that of oCB progenitor fate (green cell in Figure 10). This function is reflected by the over-proportional increase of svp-expressing oCBs in pnt mutants first reported by (Alvarez et al., 2003). Our phenotypic analysis demonstrates that Edl is required for svp and Doc gene activity (the latter being due to restriction of tin expression) as well as the restriction of PntP2-dependent PntP1 expression in cardiac progenitors. Molecularly, Edl can modulate the activities of PntP2 as well as Yan (Baker et al., 2001; Qiao et al., 2006; Qiao et al., 2004; Tootle et al., 2003; Vivekanand et al., 2004; Yamada et al., 2003). The comparison of single and double mutant phenotypes, combined with the reproducibility of nearly all aspects of the cardiac pnt phenotype by Edl overexpression, implies that Edl acts primarily by inhibiting Pnt during cardiac cell diversification, although we cannot fully exclude additional interactions with Yan. Our observations further support the function of Edl as an antagonist of Pnt (first demonstrated in the context of eye and chordotonal organ development; Yamada et al., 2003) and rule out an initially proposed Pnt-stimulating function (Baker et al., 2001).

Linkage of MAPK and Pnt activities

The involvement of Edl also leads to important conclusions regarding the placement of Pnt function within the cardiac gene regulatory network. Based on the phenotypic discrepancies between pnt and other EGF pathway components (gain and loss of CBs, respectively), Alvarez et al. proposed that PntP2 acts independent of MAPK signaling to limit the number of CBs (Alvarez et al., 2003). Since we found that Edl blocks Pnt activity in oCB progenitors, and Edl is thought to antagonize PntP2 mainly by blocking MAPK-dependent phosphorylation (Qiao et al., 2006), we propose that PntP2 acts downstream of MAPK also during cardiogenesis (see Figure 10). This is further supported by our data demonstrating spi-sensitive cardiac expression of PntP1 and the observation that, if timed properly, both EGF and Pnt activities can lead to expanded gCB and reduced oCB populations. However, not all MAPK activities require pnt, which is the case for the pro-cardiogenic activities of EGF. Notably, parallel pnt-dependent and pnt-independent MAPK signaling functions take place also during other processes such as epithelial branching morphogenesis (Cabernard and Affolter, 2005).

Special features of Pnt-dependent regulation in working myocardial cells

Our model of CB diversification incorporates the observation that the PntP1 isoform is activated specifically in gCB progenitors in a PntP2-dependent and EGF-sensitive fashion. This is reminiscent of the situation in other tissues such as the developing eye where the PntP1 isoform is also activated in a MAPK/PntP2-dependent manner (Gabay et al., 1996; O'Neill et al., 1994; Shwartz et al., 2013). We propose that PntP1 becomes activated at a particular threshold of MAPK/PntP2 activity. This activation marks a point of no return for CB diversification, because PntP1 cannot be inhibited via Edl. The activation of PntP1 also explains why edl overexpression with relatively late acting drivers such as tinD-GAL4 (as used in the edl mutant rescue experiment) does not cause the cardiac phenotypes observed with early pan-mesodermal drivers. Furthermore, depending on enhancer structure, target genes may be either quickly activated by PntP2 alone or require higher levels only achieved upon additional PntP1 buildup (particularly for sustained expression). In case of the mid gene, our model includes both possibilities (Figure 10 and Figure 10—figure supplement 1). Although the exact details of this activation as well as the direct binding of Pnt to particular sites in vivo remain to be investigated, the sum of our genetic and enhancer data provide strong indications for mid being a direct and functionally critical target of Pnt during cardiac cell diversification. Thus, by regulating Pnt activity, the timing of Mid protein appearance can be controlled. We predict that this timing is linked to its capability to interfere with svp expression, since later presence of Mid in all CB subtypes including oCBs (mediated by other, Pnt-independent mechanisms; see Figure 9F,H,J) does not lead to svp repression. One possible explanation for the co-occurrence of Svp and Mid in oCBs at later stages is that the chromatin structure determining svp gene activity becomes fixed prior to the delayed appearance of Mid protein in these cells.

Besides pntP1 and mid, there are very likely additional target genes activated by PntP2 and/or PntP1 to execute the differentiation program in generic working myocardial cells. Incomplete conversion of gCBs in mid mutants also calls for the existence of additional repressors that contribute to oCB fate suppression. Interestingly, a study investigating Tin target genes found that cardiac target enhancers of Tin are not only enriched for Tin-binding sites but also for a motif highly reminiscent of ETS binding sites, termed ‘cardiac enhancer enriched (CEE) motif’ (with the consensus ATT[TG]CC or GG[CA]AAT in antisense orientation) (Jin et al., 2013). Mutation of four CEE sites (one of which overlapping our predicted ETS binding site) in a ca. 600 bp version of the midE19 enhancer nearly abolished reporter activity in that study. Thus, many of the CEE-containing Tin target enhancers might in fact also be targets of Pnt (potentially mediating ETS-dependent activation) or Yan (potentially mediating ETS-dependent repression in the absence of MAPK signals). Therefore, a combination of closely spaced Tin and ETS binding sites might be a key signature in enhancers of working myocardial genes, although additional features must be present in their architecture to distinguish them from Tin+ETS binding site-containing enhancers active in pericardial cells or their progenitors (Halfon et al., 2000). The differences might include elements directly or indirectly regulated by Delta-Notch signaling. Notably, the juxtacrine Notch ligand Delta is upregulated in the CB lineage in an MAPK-activity-dependent manner (Grigorian et al., 2011). Hence, it is conceivable that Pnt proteins might stimulate Delta transcription in gCBs to control OPC development in a non-autonomous manner. This would explain both, simultaneous mis-specification of gCB progenitors and non-ostial-related OPCs in EGF mutants as well as phenotypic similarities between pnt mutants and mutants for components of the Delta-Notch signaling pathway. However, because of the herein described function of Pnt in suppressing svp transcription and oCB fate, pnt mutants feature an extreme bias in the increase of oCBs that has not been observed in Notch pathway mutants (Albrecht et al., 2006; this work).

What is the original signal that discriminates generic and ostial progenitors?

Our work clearly identifies Pnt and Edl as crucial transducers of spatio-temporal inputs during cardiac cell diversification, but open questions remain regarding the initial source for the differential activities. Our model proposes that factors which tilt the balance between PntP2 activity and Edl will have a major impact on CB subtype choice (see Figure 10). Thus, any input that modestly increases MAPK/PntP2 activity within the appropriate window of time would favor gCB fate, whereas factors that have the opposite effect should promote oCB specification. This points to activities that impinge on the highly complex and dynamic expression of rho and/or edl. The Rhomboid protease is a key determinant in the decision of which cells will activate the more broadly expressed EGF Spitz and thus emanate signaling activity. A prime candidate for an instructive cue to anterior-posterior positioning within each segment could be Hh (indicated in the extended model in Figure 10—figure supplement 1), because it was proposed to be an oCB-promoting and rho/MAPK pathway-modulating signal towards the cardiogenic mesoderm in previous studies (Liu et al., 2006; Ponzielli et al., 2002). In these studies, decreased svp expression and reduced numbers of Tin-negative CBs observed in hh mutants and upon overexpression of constitutive repressor forms of the Hh effector Ci were interpreted as signs of Hh-dependent oCB specification, although no converse effects have been reported using constitutive active Ci forms. However, the role of the Hh pathway in CB diversification is not fully understood, mainly due to complications arising from ectodermal Hh functions, primarily in maintaining pro-cardiogenic wg expression (Bejsovec and Martinez Arias, 1991; Park et al., 1996). Furthermore, the effect of Hh on MAPK and rho activities in the dorsal mesoderm was suggested to be positive rather than negative based on an expansion of stage 12 mesodermal rho expression and expanded numbers of cells with activated MAPK upon pan-mesodermal overexpression of hh (Liu et al., 2006). This would refute a function favoring oCB fate, but it is an interesting finding in light of our work, which couples rho activity with gCB specification. A modulation of rho expression via Hh signaling, whether direct or indirect, would also be consistent with the phenotype of mutants lacking the function of patched (encoding a negative regulator of Hh signaling activity), in which we observe a strong increase in the gCBs:oCBs ratio (although absolute CB numbers are highly variable between embryos and alleles; E. Heyland, F. Karama, B. Schwarz and I. Reim, unpublished observations). On the other hand, mutants with diminished Hh pathway activity, including some that were recovered by our EMS screen because of their partial CB losses (i.e. smoothened mutants), do not display a biased reduction of either oCBs or gCBs (E. Heyland, F. Karama, B. Schwarz and I. Reim; unpublished observations). Hence, the regulation of rho and the role of hh during CB diversification await more detailed analysis.

Factors that regulate edl expression levels might also determine the outcome of the competition between Edl and Pnt. The edl gene was found to be positively regulated by EGF signaling, and to be a target of Pnt and Yan, and thus was proposed to provide a negative feedback system for EGF inputs (Baker et al., 2001; Leatherbarrow and Halfon, 2009; Vivekanand et al., 2004; Yamada et al., 2003). Our extended model therefore includes regulation by Pnt as a possibility (dashed arrows in Figure 10—figure supplement 1). Nevertheless, additional or alternative inputs need to be considered to explain the strong edl expression in presumptive oCB progenitors with low Pnt activity. Notably, ChIP-on-chip experiments suggest that edl is also targeted by cardiogenic factors (Junion et al., 2012). Furthermore, edl was identified as a positively regulated target of Notch signaling in a Drosophila cell culture system (Krejcí et al., 2009). However, observed persistent edl expression in Notch pathway mutants argues against positive inputs from Notch during edl regulation in oCB progenitors.

The spatio-temporal dynamics and detailed mechanisms that regulate MAPK and edl activities within the cardiogenic mesoderm remain to be investigated in future studies. Such studies may also help to understand lineage decisions in other tissues and species. Edl/Mae-relatives are also present in non-Dipteran insects (e.g. Tribolium; Bucher and Klingler, 2005), echinoderms, and the chordate Ciona. Although no clear ortholog of Edl appears to be present in vertebrates, a SAM domain-only isoform of the human Yan-relative TEL2 as well as Drosophila Edl were shown to inhibit transcriptional stimulation by the mammalian Pnt orthologs ETS1/ETS2 in cell culture (Gu et al., 2001; Vivekanand and Rebay, 2012). Hence, the restriction of ETS protein activities by protein-protein interactions offers an intriguing mechanism to fine-tune MAPK signaling output in developing tissues of both invertebrates and vertebrates.

Materials and methods

Key resources table
Reagent type
(species) or
DesignationSource or referenceIdentifiersAdditional information
Genetic reagent (Drosophila
S-18a-13b-16b.1PMID: 24935095starter stock used for EMS
mutagenesis; genotype: y[*] w[*];
w[+mC]}18a, P{pGD130.tinC*-GFP,
y[+]}13b, P{RedH-Pelican.HLH54Fb-
dsRed, w[+mC]}16b
Genetic reagent (D. melanogaster)S-18a-13b-16c.1PMID: 24935095starter stock used for EMS
mutagenesis; genotype: y[*] w[*];
w[+mC]}18a, P{pGD130.tinC*-GFP,
y[+]}13b, P{RedH-Pelican.HLH54Fb-
dsRed, w[+mC]}16 c
Genetic reagent (D. melanogaster)aop[1]Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)bib[S1538]this papermutation in S-18a-13b-16c.1
Genetic reagent (D. melanogaster)Df(2R)edl-S0520this papermutation in S-18a-13b-16b.1
Genetic reagent (D. melanogaster)edl[k06602]Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)Df(2R)edl-L19Y. Hiromi, PMID: 12874129FBab0037748
Genetic reagent (D. melanogaster)P{edl.AF1}BS12; P{edl[+]}this paperderived from injection with
pCaSpeR4-X18C12-edl_rescue; line #
BS12 carries P{edl.AF1} on
chromosome 3
Genetic reagent (D. melanogaster)Egfr[f2]Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)Egfr[S0167]this papermutation in S-18a-13b-16b.1
Genetic reagent (D. melanogaster)Egfr[S2145]this papermutation in S-18a-13b-16c.1
Genetic reagent (D. melanogaster)Egfr[S2307]this papermutation in S-18a-13b-16c.1
Genetic reagent (D. melanogaster)Egfr[S2561]this papermutation in S-18a-13b-16c.1
Genetic reagent (D. melanogaster)htl[YY262]PMID: 8957001
Genetic reagent (D. melanogaster)mam[S0669]this papermutation in S-18a-13b-16b.1
Genetic reagent (D. melanogaster)mam[S4648]this papermutation in S-18a-13b-16c.1
Genetic reagent (D. melanogaster)mid[1]Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)mid[S0021]this papermutation in S-18a-13b-16b.1
Genetic reagent (D. melanogaster)midE19-GFPM. Frasch; PMID: 23326246
Genetic reagent (D. melanogaster)mid180-GFPthis paperinsertion in attP2
Genetic reagent (D. melanogaster)mid180-mETS-GFPthis paperinsertion in attP2
Genetic reagent (D. melanogaster)pnt[MI03880]Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)pnt[Δ88]Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)pyr[18]PMID: 19515694
Genetic reagent (D. melanogaster)pyr[S3547]PMID: 22609944
Genetic reagent (D. melanogaster)rho[7M43]Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)rho[L68]Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)S[S4550]this papermutation in S-18a-13b-16c.1
Genetic reagent (D. melanogaster)S[B0453]F. Schnorrer;
PMID: 18327265
Genetic reagent (D. melanogaster)spi[S3384]this papermutation in S-18a-13b-16c.1
Genetic reagent (D. melanogaster)spi[1]Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)svp[AE127]-lacZY. Hiromi, PMID: 11404079
Genetic reagent (D. melanogaster)ths[759]PMID: 19515694
Genetic reagent (D. melanogaster)‘tin-ABD;tin[EC40]’PMID: 16987868
Genetic reagent (D. melanogaster)UAS-aop.ACT-IIaBloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)UAS-edl-XY. Hiromi, PMID: 12874129
Genetic reagent (D. melanogaster)‘UAS-Egfr[DN].B-29-77-1;
Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)UAS-mid-B2PMID: 15922573
Genetic reagent (D. melanogaster)UAS-pntP1-3Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)UAS-pntP2[VP16]−2C. Klämbt;
PMID: 11051548
Genetic reagent (D. melanogaster)UAS-p35Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)UAS-rho[EP3704]Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)UAS-rho(ve.dC)Bloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)UAS-svpM. Hoch
Genetic reagent (D. melanogaster)how[24B]-GAL4; 24BBloomington Drosophila
Stock Center
Genetic reagent (D. melanogaster)tinCΔ4-GAL4M. Frasch;
PMID: 11404079
Genetic reagent
(D. melanogaster)
tinD-GAL4J. Weiss;
PMID: 16221729
Genetic reagent
(D. melanogaster)
2xPE-twi-GAL4Bloomington Drosophila
Stock Center
Genetic reagent
(D. melanogaster)
Df(2L)Exel6006Bloomington Drosophila
Stock Center
Genetic reagent
(D. melanogaster)
Df(2R)BSC25Bloomington Drosophila
Stock Center
Genetic reagent
(D. melanogaster)
Df(2R)Exel7157Bloomington Drosophila
Stock Center
Genetic reagent
(D. melanogaster)
Df(3R)Exel9012Bloomington Drosophila
Stock Center
Genetic reagent
(D. melanogaster)
lbe-GFPBloomington Drosophila
Stock Center
Genetic reagent
(D. melanogaster)
pnt-GFPBloomington Drosophila
Stock Center
DNA reagent
edl_rescue (plasmid)
Y. Hiromi, P
MID: 12874129
P transformation plasmid
for generation of P{edl.AF1}
(guinea pig polyclonal)
PMID: 12783790(1:2000, TSA)
(guinea pig polyclonal)
PMID: 12783790(1:1000)
(rabbit polyclonal)
J. Skeath;
PMID: 19013145
(guinea pig polyclonal)
J. Skeath;
PMID: 19013145
(rabbit polyclonal)
J. Skeath;
PMID: 19013145
(1:250, TSA or 1:1000)
(rabbit polyclonal)
J. Skeath;
PMID: 12756183
(rabbit polyclonal)
H.T. Nguyen(1:1500)
(rat polyclonal)
PMID: 9683745(1:600, TSA)
(rabbit polyclonal)
PMID: 2884106(1:3000)
(rabbit polyclonal)
PMID: 9362473(1:750)
(rabbit polyclonal)
R. Lehmann;
PMID: 9435286
(mouse monoclonal)
Sigma(1:500, TSA)
Antibodyanti-Seven-up 5B11
(mouse monoclonal)
Developmental Studies
Hybridoma Bank
(1:20, TSA)
Antibodyanti-Wg 4D4
(mouse monoclonal)
Developmental Studies
Hybridoma Bank
(1:30, TSA)
Antibodyanti-β-galactosidase 40-
1a (mouse monoclonal)
Developmental Studies
Hybridoma Bank
(1:50, TSA or 1:20)
(rabbit polyclonal)
(rabbit polyclonal)
Molecular ProbesMolecular
(rabbit polyclonal)
Antibodyanti-GFP 3E6
(mouse monoclonal)
Life TechnologiesLife Technologies:A11120(1:100, TSA)
Asp175 (rabbit polyclonal)
Cell Signaling TechnologyCell Signaling
(1:100, TSA)
Antibodysheep anti-Digoxigenin
(sheep polyclonal)
RocheRoche:11333089001(1:1000, TSA)
assay or kit
VectaStain Elite
Vector LaboratoriesLinaris:PK-6100
assay or kit
tyramide signal
amplification (TSA)
reagent Cy3
assay or kit
tyramide signal
amplification (TSA)
reagent Fluorescein
assay or kit
TUNEL apoptosis
detection kit (Apoptag)

Drosophila melanogaster stocks

Request a detailed protocol

The mutants bibS1538, Df(2R)edl-S0520, EgfrS0167, EgfrS2145, EgfrS2307, EgfrS2561, kuzS3330, kuzS3832, mamS0669, mamS4648, midS0021, midS2961, numbS1342, numbS3992, numbS4439, pyrS3547 (Reim et al., 2012), spiS3384, StarS4550 were recovered from our EMS screen. The lines mid1, UAS-mid-B2, how24B-GAL4, pnrMD237-GAL4, svpAE127-lacZ (a svp mutant in homozygous condition), UAS-svp.I, 2xPE-twi-GAL4, twi-SG24-GAL4, tinD-GAL4, UAS-tin#2, {tin-ABD}T003-1B1; tinEC40, UAS-p35 were as described previously (Reim et al., 2012; Reim et al., 2005; Zaffran et al., 2006). In addition, the following strains were used: aop1 = aopIP (Nüsslein-Volhard et al., 1984; Rogge et al., 1995), UAS-aop.ACT-IIa (Rebay and Rubin, 1995), bib1 (Lehmann et al., 1983), edlL19 = Df(2R)edl-L19 (edl and some neighboring genes deleted) and UAS-edl-X (both from Y. Hiromi; Yamada et al., 2003), P{lacW}edlk06602 (Baker et al., 2001; Török et al., 1993), Egfrf2 (Clifford and Schüpbach, 1994), UAS-EgfrDN.B-29-77-1;UAS-EgfrDN.B-29-8-1 (Buff et al., 1998), htlYY262 (Gisselbrecht et al., 1996), kuze29-4 (Rooke et al., 1996), PBac{lbe-GFP.FPTB}VK00037 (A. Victorsen and K. White), mam8 (Lehmann et al., 1983), mid1 (Buescher et al., 2004), midE19-GFP (Jin et al., 2013; from M. Frasch), pntΔ88 (Scholz et al., 1993), pntMI03880 (PntP2-specific; harbors a gene-trap cassette with an artificial splice acceptor followed by stop codons upstream of the pntP1 transcription start site; Venken et al., 2011), UAS-pntP2VP16-2 (Halfon et al., 2000; originally from C. Klämbt), UAS-pntP1-3 and UAS-pntP2-2 (Klaes et al., 1994), PBac{pnt-GFP.FPTB}VK00037 (R. Spokony and K. White; Boisclair Lachance et al., 2014), pyr18 and ths759 (Klingseisen et al., 2009), rho7M43 (Jürgens et al., 1984), rhoL68 (Salzberg et al., 1994), rhoEP3704 (Bidet et al., 2003), UAS-rho(ve.dC) (de Celis et al., 1997), spi1 = spiIIAIIA14 (Nüsslein-Volhard et al., 1984), StarB0453 (Chen et al., 2008; from F. Schnorrer), tinCΔ4-GAL4 (Lo and Frasch, 2001; from M. Frasch), Df(2R)Exel7157, and about 180 additional deficiencies spanning chromosome 2 (except where noted, all stocks available from the Bloomington Stock Center).

Flies expressing edl+ from a transgene were generated anew by standard P-element transgenesis using the previously described edl[+t18] rescue construct (named AF1 in Yamada et al., 2003; provided by Y. Hiromi). Line P{edl.AF1}BS12 carrying an insertion on chromosome three was used in this study.

Unless noted otherwise, y w or S-18a-13b-16c.1 control (Hollfelder et al., 2014) flies were used as wild type controls. Mutant lines were maintained over GFP- or lacZ-containing balancer chromosomes to allow recognition of homozygous embryos. Flies were raised at 25°C, except for UAS/GAL4-driven overexpression at 29°C.

Isolation and mapping of novel EMS mutants

Request a detailed protocol

Novel EMS-induced mutants were obtained from our screen for embryonic heart and muscle defects and mapped to a particular gene through extensive complementation testing analogous to the previously described procedure (Hollfelder et al., 2014). Many alleles were mapped by unbiased complementation tests with a set of chromosome 2 deficiencies and subsequent non-complementation of lethality and embryonic phenotype by previously described alleles. Df(2R)edl-S0520 was mapped by non-complementation of lethality with Df(2R)Exel7157, Df(2R)edl-L19 and Df(2R)ED3636, but the cardiac phenotype was only reproduced in trans with Df(2R)Exel7157, Df(2R)edl-L19 and edlk06602. Novel alleles of Egfr and Star were mapped using a candidate gene approach.

Molecular analysis of mutations and deletions

Request a detailed protocol

Several EMS alleles and the unmutagenized S-18a-13b-16c.1 control were analyzed by sequencing of overlapping PCR products covering the coding sequence and splicing sites of the candidate gene as described (Hollfelder et al., 2014). Details about the mutations are provided in Supplementary file 1-Table S1. The area deleted by Df(2R)edl-S0520 and its approximate break points were determined by iterative PCR amplification tests. The insertion of P{lacW}edlk06602 near the edl transcription start site was confirmed by PCR using primers binding to the 5' P end and adjacent genomic DNA. Although the integrity of the both P element ends could be confirmed by PCR, no genomic edl sequences expected next to the 3' P end could be amplified using several primer pairs shown to amplify control DNA. This indicates that P{lacW}edlk06602 is associated with a deletion in edl. Details of the deletion mapping are listed in Supplementary file 2-Table S2.

Generation of reporter constructs for enhancer analysis

Request a detailed protocol

The mid180-GFP reporter constructs were generated according to a similar lacZ construct published by Ryu et al. (2011). The forward primer 5'-EcoRI-CGTGCCTCCCACTTCAGGGCGG-3' and the backward primer 5'-BamHI-TTAATTTCATTTTTCACTCTGCTCACTTGAGATTCCCCTGCTTTGTCTGCGGCATTTCCGCTTCT-3' were used to amply DNA from y w flies. The predicted ETS binding site matching the antisense sequence of published ETS binding motifs (Halfon et al., 2000; Hollenhorst et al., 2011; underlined) was mutated in mid180-mETS-GFP by replacing the invariable TCC core (bold) with AAA in the backward primer. Amplicons were cloned into EcoRI/BamHI of pH-Stinger-attB (Jin et al., 2013), sequenced and inserted into the attP2 landing site via nos-driven ΦC31 integrase.

Staining procedures

Request a detailed protocol

Embryo fixations, immunostainings for proteins and RNA in situ hybridizations were carried out essentially as described (Knirr et al., 1999; Reim and Frasch, 2005), except for stainings with anti-dpMAPK, for which the formaldehyde concentration was doubled and embryos were rehydrated from methanol and stained immediately after fixation. VectaStain Elite ABC-HRP kit (Vector Laboratories) and tyramide signal amplification (TSA, PerkinElmer Inc.) were used for detection of RNA and certain antigens (as indicated). The following antibodies were used: guinea pig anti-Doc2+3 (1:2000, TSA) and anti-Doc3+2 (1:1000) (Reim et al., 2003), rabbit anti-H15/Nmr1 (1:2000), guinea pig anti-H15/Nmr1 (1:2000), rabbit anti-Mid/Nmr2 (early stages: 1:250, TSA; late stages: 1:1000 direct) and rabbit anti-PntP1 (1:250, TSA) (all from J. Skeath; Alvarez et al., 2003; Leal et al., 2009), rabbit anti-Mef2 (1:1500) (from H.T. Nguyen), rat anti-Odd (1:600, TSA) (Kosman et al., 1998), rabbit anti-Eve (1:3000) (Frasch et al., 1987), rabbit anti-Tin (1:750) (Yin et al., 1997) (all from M. Frasch), rabbit anti-Zfh1 (1:2000) (from R. Lehmann; Broihier et al., 1998), mouse anti-dpMAPK (Sigma, 1:500, TSA), rabbit anti-β-galactosidase (Cappel, 1:1500), rabbit anti-GFP (Molecular Probes, 1:2000 and Rockland, 1:1000), mouse anti-GFP 3E6 (Life Technologies, 1:100, TSA), anti-cleaved-Caspase-3 (Asp175, Cell Signaling Technology, 1:100, TSA), sheep anti-Digoxigenin (Roche, 1:1000, TSA), monoclonal mouse antibodies anti-β-galactosidase 40-1a (1:20 direct or 1:50 with TSA), anti-Seven-up 5B11 (1:20, TSA) and anti-Wg 4D4 (1:30, TSA) (all from Developmental Studies Hybridoma Bank, University of Iowa), fluorescent secondary antibodies (1:200) (Jackson ImmunoResearch Laboratories and Abcam), biotinylated secondary antibodies (1:500) and HRP-conjugated anti-rabbit and anti-mouse IgG (1:1000) (Vector Laboratories). TUNEL staining was performed as described (Reim et al., 2003) using the Millipore ApopTag S7100 kit in combination with TSA.

Digoxigenin-labeled antisense riboprobes against mid, edl, rho and pntP2 were used for whole mount in situ hybridizations. The mid probe was generated as described previously (Reim et al., 2005). T7 promoter-tagged edl, rho and pntP2 (isoform-specific exons) templates for in vitro transcription were generated by PCR (primers edl: CAATCGTGAAAGAGCGAGGGTC, T7-TGACGAGCAGAACTAAGGACTAGGC, edlintron: GCACCGACGACTCAACTTCCTG, T7-GCTGCGATTGCGATTACAAACAAG, pnt: CCAGCAGCCACCTCAATTCGGTC, T7-GCGTGCGTCTCGTTGGGGTAATTG, rho: ATGGAGAACTTAACGCAGAATGTAAACG, T7-TTAGGACACTCCCAGGTCG) from DNA of wild-type flies or flies carrying UAS-rho(ve.dC) or UAS-pntP2, respectively.

Embryos were mounted in Vectashield (Vector Laboratories). Images were acquired on a Leica SP5 II confocal laser scanning microscope and projected using Leica LAS-AF and ImageJ.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided for Figures 1, 3, 5 and 5-S1.


    1. Bejsovec A
    2. Martinez Arias A
    Roles of wingless in patterning the larval epidermis of Drosophila
    Development 113:471–485.
    1. Bodmer R
    The gene tinman is required for specification of the heart and visceral muscles in Drosophila
    Development 118:719–729.
  1. Book
    1. Bodmer R
    2. Frasch M
    (2010) Development and Aging of the Drosophila Heart
    In: Rosenthal N, Harvey R. P, editors. Heart Development and Regeneration, 1. Elsevier. pp. 47–86.
    1. Broihier HT
    2. Moore LA
    3. Van Doren M
    4. Newman S
    5. Lehmann R
    zfh-1 is required for germ cell migration and gonadal mesoderm development in Drosophila
    Development 125:655–666.
    1. Buff E
    2. Carmena A
    3. Gisselbrecht S
    4. Jiménez F
    5. Michelson AM
    Signalling by the Drosophila epidermal growth factor receptor is required for the specification and diversification of embryonic muscle progenitors
    Development 125:2075–2086.
    1. Clifford R
    2. Schüpbach T
    Molecular analysis of the Drosophila EGF receptor homolog reveals that several genetically defined classes of alleles cluster in subdomains of the receptor protein
    Genetics 137:531–550.
    1. de Celis JF
    2. Bray S
    3. Garcia-Bellido A
    Notch signalling regulates veinlet expression and establishes boundaries between veins and interveins in the Drosophila wing
    Development 124:1919–1928.
    1. Frasch M
    2. Hoey T
    3. Rushlow C
    4. Doyle H
    5. Levine M
    Characterization and localization of the even-skipped protein of Drosophila
    The EMBO Journal 6:749–759.
    1. Gabay L
    2. Scholz H
    3. Golembo M
    4. Klaes A
    5. Shilo BZ
    6. Klämbt C
    EGF receptor signaling induces pointed P1 transcription and inactivates Yan protein in the Drosophila embryonic ventral ectoderm
    Development 122:3355–3362.
    1. Gajewski K
    2. Fossett N
    3. Molkentin JD
    4. Schulz RA
    The zinc finger proteins Pannier and GATA4 function as cardiogenic factors in Drosophila
    Development 126:5679–5688.
    1. Hartenstein AY
    2. Rugendorff A
    3. Tepass U
    4. Hartenstein V
    The function of the neurogenic genes during epithelial development in the Drosophila embryo
    Development 116:1203–1220.
    1. Jagla K
    2. Frasch M
    3. Jagla T
    4. Dretzen G
    5. Bellard F
    6. Bellard M
    ladybird, a new component of the cardiogenic pathway in Drosophila required for diversification of heart precursors
    Development 124:3471–3479.
    1. Jagla T
    2. Bidet Y
    3. Da Ponte JP
    4. Dastugue B
    5. Jagla K
    Cross-repressive interactions of identity genes are essential for proper specification of cardiac and muscular fates in Drosophila
    Development 129:1037–1047.
    1. Klämbt C
    The Drosophila gene pointed encodes two ETS-like proteins which are involved in the development of the midline glial cells
    Development 117:163–176.
    1. Knirr S
    2. Azpiazu N
    3. Frasch M
    The role of the NK-homeobox gene slouch (S59) in somatic muscle patterning
    Development 126:4525–4535.
    1. Lovato TL
    2. Nguyen TP
    3. Molina MR
    4. Cripps RM
    The Hox gene abdominal-A specifies heart cell fate in the Drosophila dorsal vessel
    Development 129:5019–5027.
    1. Miquerol L
    2. Kelly RG
    (2013) Organogenesis of the vertebrate heart
    Wiley Interdisciplinary Reviews: Developmental Biology 2:17–29.
    1. Ponzielli R
    2. Astier M
    3. Chartier A
    4. Gallet A
    5. Thérond P
    6. Sémériva M
    Heart tube patterning in Drosophila requires integration of axial and segmental information provided by the Bithorax Complex genes and hedgehog signaling
    Development 129:4509–4521.
    1. Rogge R
    2. Green PJ
    3. Urano J
    4. Horn-Saban S
    5. Mlodzik M
    6. Shilo BZ
    7. Hartenstein V
    8. Banerjee U
    The role of yan in mediating the choice between cell division and differentiation
    Development 121:3947–3958.
    1. Scholz H
    2. Deatrick J
    3. Klaes A
    4. Klämbt C
    Genetic dissection of pointed, a Drosophila gene encoding two ETS-related proteins
    Genetics 135:455–468.
    1. Su MT
    2. Fujioka M
    3. Goto T
    4. Bodmer R
    The Drosophila homeobox genes zfh-1 and even-skipped are required for cardiac-specific differentiation of a numb-dependent lineage decision
    Development 126:3241–3251.
    1. Török T
    2. Tick G
    3. Alvarado M
    4. Kiss I
    P-lacW insertional mutagenesis on the second chromosome of Drosophila melanogaster: isolation of lethals with different overgrowth phenotypes
    Genetics 135:71–80.
    1. Ward EJ
    2. Skeath JB
    Characterization of a novel subset of cardiac cells and their progenitors in the Drosophila embryo
    Development 127:4959–4969.
    1. Yin Z
    2. Xu XL
    3. Frasch M
    Regulation of the twist target gene tinman by modular cis-regulatory elements during early mesoderm development
    Development 124:4971–4982.

Decision letter

  1. Utpal Banerjee
    Reviewing Editor; University of California, Los Angeles, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for sending your article entitled "Diversification of heart progenitor cells by EGF signaling and differential modulation of ETS protein activity" for peer review at eLife. Your article has been favorably evaluated by K VijayRaghavan (Senior Editor) and three reviewers, one of whom, Utpal Banerjee, is a member of our Board of Reviewing Editors. The following individual involved in review of your submission has agreed to reveal his identity: Rolf Bodmer (Reviewer #3).

The revisions asked for by the reviewers are rather extensive and in the post-review discussion, the concern was raised that they are not achievable in a two-month period, and even that some of the concerns may be difficult to meet to the satisfaction of an eLife publication. Nevertheless, the reviewing editor finds considerable merit and novelty in the manuscript given that this is an area of Drosophila developmental biology that needs attention provided by the manuscript.


In this paper, the authors show that EGFR signaling has a specific and defined role in the specification of cardioblast cell fates. Their work shows that active EGFR signaling through the Spitz signaling involving Rhomboid and Star activate the EGFR signaling in the gCB cells and is required for the activation and maintenance of Tinman expression. This process requires the participation of both isoforms of Pointed and also requires the function of Tbx20 ortholog, Midline. In contrast, the specification of the oCB requires an active attenuation of EGFR signaling and this is mediated by the expression of the gene ETS domain lacking (Edl) which has been shown to bind to ETS domain protein and block their function.

Using loss of function and gain of function studies the authors convincingly support their model for the role of EGFR signaling in the specification of cardioblast fate during heart development in Drosophila.

Essential revisions:

1) In the paper the authors refer to the fact that EGFR signaling functions at multiple stages, one being its role in the specification of cardioblast fate. They use loss of function mutants and overexpression and dominant negative version driven by broadly expressed GAL4 lines to come of the conclusion. The results will be strengthened if EGFR signaling is blocked at specific time points to rule out the possibility that a prior EGFR step might contribute to the phenotype.

2) The authors should show the activity status of EGFR during these fate specification events by using the activated MAPK antibody to define how this correlates with the phenotype.

3) Even though this paper is directed towards defining the role of EGFR in cardioblast fate, the role of Notch signaling during these events have been totally ignored. Is it possible that Notch signaling is required for the activation of Edl, which then blocks the activation of Pnt mediated transcription to promote oCB fate?

4) Although the authors suggest that the decrease in gCBs is due to the adoption of other cell fates, they do not identify which fates these cells take on. A better understanding of this through staining with markers for other cell types, clonal analysis or lineage tracing would be helpful, especially to distinguish this model from one in which mutant cells undergo apoptosis or fail to divide.

5) While the final figure shows a brief enhancer analysis, this aspect of the paper is under-developed. This point is specifically germane to Figure 7, for which there are a number of concerns:

A) There is no indication that pointed can bind specifically to the ETS sites in the enhancer, and that its binding is abrogated by the mutations.

B) Since the role for midline in cardiac diversification is expected to occur during stage 12, it is unclear why the enhancer analyses (panels D and E) are presented at stage 16.

C) Related to this, the midE19 enhancer is clearly not reporting the entire midline expression pattern, so how generally applicable are the findings from the analysis of just this single enhancer?

D) Since midline is expressed at later stages throughout the cardiac tube, how does it fail to suppress seven-up at later stages (the authors discuss this later in the paper, but a mechanistic understanding is not apparent)?

6) How does hedgehog impact EGF expression and receptor activity? This is a concern because, as the work stands, we are not left with a comprehensive understanding of how cardioblast diversification is triggered that incorporates existing published data.

7) The question of spatial integration (in addition to temporal integration that is addressed in this paper), attributing the spatial cues to wg and in particular hh signaling, upstream of rho needs better elaboration. Also, the Discussion should be more explicit on the fact that the current studies mainly address a permissive/transducing role for pnt/edl rather than a spatially instructive role, and/or discuss what the scenarios could be that relate to spatially instructive signals.

8) Also, the gCBs come in two flavors Tin+/Lbe+ and Tin+ only; their distinction should be included in the Discussion.


Author response

Essential revisions:

1) In the paper the authors refer to the fact that EGFR signaling functions at multiple stages, one being its role in the specification of cardioblast fate. They use loss of function mutants and overexpression and dominant negative version driven by broadly expressed GAL4 lines to come of the conclusion. The results will be strengthened if EGFR signaling is blocked at specific time points to rule out the possibility that a prior EGFR step might contribute to the phenotype.

First, we want to clarify that the manuscript proposes multiple functions of EGF signaling in the cardiogenic mesoderm only for gCB progenitor selection as such (Pnt-independent function) as well as for a potential boost in MAPK activity that feeds into CB subtype diversification (Pnt-dependent function). Our experiment that uses dominant negative EGFRDN driven by 2xPE-twi+how24B-GAL4 (Figure 1J and the corresponding quantification in Figure 1M) was merely intended to demonstrate that EGFR signaling activity is required in the mesoderm and exclude indirect influences from potential disruptions in the ectoderm in mutants. The discussed mesodermal EGF signaling activities might not be fully separable by blocking EGFR at specific time points with conventional methods due to potential temporal overlap as well as technical reasons discussed below.

Secondly, we would like to point out that there are no indications for an early pan-mesodermal function of EGF signaling. In the early mesoderm, MAPK activity is strictly dependent on FGF signaling (Michelson, Gisselbrecht, Buff, and Skeath, 1998; Wilson, Vogelsang and Leptin, 2005; Klingseisen, Clark, Gryzik, and Müller, 2009), and in the fully migrated mesoderm, earliest MAPK activity is observed in the FGF-dependent Eve+ C2 cluster, slightly before MAPK activity in the DA1-generating C15 cluster and the nearly simultaneously appearing cardiogenic clusters C14/C16 (Carmena, Gisselbrecht, Harrison, Jiménez, and Michelson, 1998; Grigorian, Mandal, Hakimi, Ortiz, and Hartenstein, 2011). While gCBs and subsets of PCs are strongly affected in amorphic Star and rhomboid mutants as well as in 2xPE-twi+how24B-GAL4>>EGFRDN embryos, oCBs, oCB-related OPCs and Eve-positive pericardial cells are not (Figure 1, Figure 3), demonstrating that mesodermal EGFR activities are clearly specific to particular cardiac lineages. This and the normal early patterning of the rho expression clusters in the cardiogenic mesoderm themselves (newly added results in Figure 2) also argue against an earlier broad function. The specificity is analogous to published data in certain lineages in the somatic mesoderm, where EGF signaling, via loss-of-function approaches similar to ours, was shown to affect only certain types of muscles (e.g. muscle DA1; Buff, Carmena, Gisselbrecht, Jiménez, and Michelson, 1998; Carmena, Gisselbrecht, Harrison, Jiménez, and Michelson, 1998) and adult muscle precursors (AMPs; Figeac, Jagla, Aradhya, Da Ponte, and Jagla, 2010). These functional aspects of EGF signaling in the mesoderm are now mentioned more specifically in the Introduction.

Furthermore, we think that the experiment shown in Figure 1J actually represents a partial and rather late attenuation of EGF signaling due to delays in the GAL4 system in combination with the need to accumulate EGFRDN at levels capable of out-competing endogenous EGFR. We have tried to block EGF signaling using EGFRDN driven by the later active tinD+tinCΔ4-GAL4 driver, but this did not result in any abnormalities in CB formation. Since formation of the EGF-dependent DA1 muscle was also entirely normal in this background, we conclude that this driver does not produce sufficient amounts of dominant-negative EGFRDN for EGF signaling attenuation at the time of cardioblast specification. However, a mild but significant reduction in gCBs was observed using 24B-GAL4 without 2xPE-twi-GAL4 (data not shown; average number of gCBs=72.2, p=0.0049*; oCBs: 27.7, p=0.85; n=15), even though this driver was still too weak to generate any DA1 defects (n=3). Aiming at a more efficient, controllable knock-down of EGFR activity we have tried to knock-down Rhomboid, the most restricted factor of EGFR signaling, via inducible RNAi. Unfortunately, this turned out to be unsuccessful, presumably because tissue-specific RNAi is generally very inefficient during embryonic development of Drosophila (even the use of 2xPE-twi+how24B-GAL4 in combination with three different UAS-RNAi lines did not influence heart or DA1 muscle formation; data not shown). Note that effective expression of positively acting factors in the pathway (overexpression of Rhomboid, PntP1) is inherently easier to achieve, since there is no competition with the endogenous counterpart. This (together with artificial activation of normally FGF-regulated MAPK upon early rho expression) explains the differences in the efficiency of the different drivers in loss- and gain-of-function experiments.

2) The authors should show the activity status of EGFR during these fate specification events by using the activated MAPK antibody to define how this correlates with the phenotype.

To clarify the EGFR status in the cardiogenic mesoderm, we have performed stainings with anti-diphospho-MAPK antibodies in combination with cardiogenic mesoderm markers in wild-type embryos and compared them to stainings of various EGF-related genotypes. The most important results of this analysis are shown in Figure 2. The data are consistent with the assertion that EGF signaling is the major source of MAPK activity in CB progenitors. (FGF signaling is assumed to contribute to the residual dpMAPK activity observed in EGF pathway mutants, particularly after CB specification (late stage 12/stage 13). This is in agreement with a CB fate maintaining function of FGF signaling proposed by Grigorian et al. (Grigorian, Mandal, Hakimi, Ortiz, and Hartenstein, 2011.)

Concerning activated MAPK level differences between CB subtypes: These are technically difficult to prove by standard dpMAPK antibody stainings. Furthermore, differential input to the different progenitor subtypes may not solely rely on level differences, but could also be achieved via the timing/duration of activity. Thus to get a full understanding, activity would have to be monitored for each cell type over the entire time course of early cardiac development. However, since MAPK activation is expected to be upstream of cardioblast diversification events, there is no marker available that will unambiguously identify oCB vs. gCB progenitors in the early cardiogenic mesoderm, making it impossible to assign dpMAPK antibody signals with 100% certainty to particular CB progenitor subtypes at critical stages.

3) Even though this paper is directed towards defining the role of EGFR in cardioblast fate, the role of Notch signaling during these events have been totally ignored. Is it possible that Notch signaling is required for the activation of Edl, which then blocks the activation of Pnt mediated transcription to promote oCB fate?

The revised manuscript now more extensively deals with Notch-related aspects (see added text in the Results section related to Figure 5, corresponding supplemental figures and discussion in distinction to pnt phenotypes). Several observations argue against a positive oCB-subtype determining function of Notch signaling.

1) Genetic data show that Notch signaling activity generally antagonizes CB fate.

From our mutagenesis screen, we also obtained several mutants for genes required for Notch signaling, i.e. mastermind (mam), big brain (bib) and kuzbanian (kuz). We did not include these mutants in the first version of the manuscript, because Notch signaling components, particularly mam and kuz, have been previously reported to cause supernumerary CBs irrespective of their CB subtype (Hartenstein, Rugendorff, Tepass and Hartenstein, 1992; Tao, Christiansen and Schulz, 2007, and in particular the CB subtype analysis in Albrecht, Wang, Holz, Bergter, and Paululat, 2006). In response to your request, we added a new figure supplement showing cardioblast patterning data for various Notch signaling-impaired genotypes including a novel molecularly characterized bib allele (Figure 5—figure supplement 1). Consistent with the previous reports, our data show that Notch signaling mutants feature a strong increase in both oCB and gCB numbers. Some variations in the oCB:gCB ratio are expected to occur between different Notch-related gene mutations or alleles due to variable impact (e.g. due to different maternal contributions or allele strength) on the multiple functions of Notch, which involve lateral inhibition and fate decisions linked to asymmetric division, the latter being relevant specifically for the oCB lineage. In case of the novel mam allele, mamS0669, the oCB:gCB ratio was elevated relative to the wild type, but not as much as in pnt mutants. By contrast, in mutants with a strong maternal component such as kuz, the increase in oCBs lags a bit behind that of gCBs presumably due to partially functional lateral inhibition during selection of the oCB progenitors (Albrecht, Wang, Holz, Bergter, and Paululat, 2006; and our own observations). Many Notch-related mutations may cause oCB:gCB ratios that lie somewhere in between (mamS0669, bibS1538

; a normal oCB:gCB ratio was also observed upon mesoderm-specific overexpression of dominant-negative MamN driven by how24B-GAL4, which featured a milder increase in total cardioblast numbers; Jan Wittstatt and Ingolf Reim, unpublished data). Of note, hyperactivation of the Notch pathway via constitutive active Notch driven by tinCΔ4-GAL4 or how24B-GAL4 causes a complete or near complete loss of cardioblasts. In those cases where some cardioblasts are formed, the fraction of oCBs was not increased compared to the wild type (Jan Wittstatt and Ingolf Reim, unpublished data).

2) Cardiac edl expression is not abolished in Notch pathway mutants.

Nevertheless, because a previous report identified edl as a Notch target in a Drosophila cell culture system (Krejčí, Bernard, Housden, Collins, and Bray, 2009), it made sense to test whether this is the case in our system as well. Thus, we analyzed edl expression (using an intronic probe to get a higher spatio-temporal resolution) in wild type embryos (new Figure 4—figure supplement 2) and compared it to embryos with impaired Notch activity (mam mutant analysis shown in the new Figure 5—figure supplement 2 and similar data for bib not shown). These mutants do not display any obvious reductions of edl expression in the cardiogenic mesoderm, further arguing against a substantial role of Notch in determining CB subtypes.

4) Although the authors suggest that the decrease in gCBs is due to the adoption of other cell fates, they do not identify which fates these cells take on. A better understanding of this through staining with markers for other cell types, clonal analysis or lineage tracing would be helpful, especially to distinguish this model from one in which mutant cells undergo apoptosis or fail to divide.

The sum of our data suggests that missing gCBs do not simply differentiate into one particular alternate cell type in mutants with diminished EGF signaling. At the end of embryogenesis, Tin+ and Tin-(Odd+) PCs are not expanded in compensation for gCBs, but are rather reduced (Figure 1—figure supplement 2, Figure 3, Figure 3—figure supplement 1) as are many somatic muscles (Buff, Carmena, Gisselbrecht, Jiménez, and Michelson, 1998, and our own data not shown). We discuss that a minor fraction of cells may undergo apoptosis or adopt oCB fates. But these effects are small and they do not fully explain the fate of all lost progenitors.

To follow up on the fate of the unaccounted cells, we analyzed Star mutants carrying a pnr-lacZ reporter that marks the definitive cardiogenic mesoderm (excluding EPC progenitors) and early CBs and OPCs (as well as dorsal ectoderm and amnioserosa). Although these experiments tended to favor the idea that the presumptive gCBs cells become part of the pool of uncommitted Mef2+/Lmd+ dorsal mesoderm cells (frequent observance of LacZ+/Mef2+ or LacZ+/Lmd+ cells at the dorsal margin of the mesoderm), results were not fully conclusive due to insufficient specificity of the marker. Even in the wild type, low level expression was also detected in a few Mef2+/Lmd+ cells in the vicinity of developing abdominal CBs/OPCs and in a broader dorsal mesoderm region in thoracic segments; later stages also displayed expression in passing hemocytes. The somewhat broader expression of the marker in the wild type is actually consistent with the idea that some more cells obtain the competence to develop into cardiac cells than will be selected by opposing MAPK and Notch activities. Thus, if some pro-cardiogenic cells fail to get properly selected upon attenuation of EGF signaling they will not be discriminable from other cells of the region. A potential increase in the number of unselected pro-cardiogenic cells is technically difficult to prove since this pool is poorly defined and the number of missing progenitors is relatively small in comparison to the remaining dorsal mesoderm cells.

We modified wording in the respective paragraphs of the Results and Discussion sections to acknowledge the uncertainties regarding the fate of presumptive gCBs.

5) While the final figure shows a brief enhancer analysis, this aspect of the paper is under-developed. This point is specifically germane to Figure 7, for which there are a number of concerns:

A) There is no indication that pointed can bind specifically to the ETS sites in the enhancer, and that its binding is abrogated by the mutations.

Although we agree that there is currently no evidence for direct binding of Pnt to the ETS sites in the midE19 enhancer, we have provided several strong indications for this:

First, the midE19 enhancer responds to the absence of Pnt with a very severe drop in activity.

Second, upon ectopic Pnt expression the enhancer gains activity even in Tin-negative cardioblasts.

Third, the minimal enhancer version, mid180, loses activity upon mutation of a single motif that matches the well-characterized ETS binding signature (as compiled from plenty of in vitro as well as in vivo data in Hollenhorst, McIntosh, and Graves, 2011; see also Halfon, Carmena, Gisselbrecht, Sackerson, Jiménez, and Baylies, 2000).

Due to the sequence match with the well-established ETS binding signature, we think that additional in vitro binding studies would yield results that are entirely predictable and thus would not be helpful in generating new insights. Therefore we tried to detect binding in vivo by chromatin immunoprecipitation (ChIP) using anti-PntP1 (which may represent only a small fraction of bound Pnt) or anti-GFP with chromatin from C-terminally tagged Pnt::GFP embryos. However, enrichment was inconsistent for the ETS site-containing region of mid180 and never observed for the eve mesoderm enhancer. Since the latter is considered a well-established Pnt target (although no Pnt ChIP data are available), we attribute this to technical difficulties that are likely to be caused by the following obstacles: (1) gCB progenitors only represent a very small number of cells in the context of whole embryos, (2) Pnt is likely to bind many target genes in more abundant cell types, and (3) active Pnt may occupy targets only for a short time.

Nevertheless, we are still confident about the Pnt-midE19 interaction on the basis of our genetic data. We would like to emphasize that even in the unlikely case that Pnt only indirectly regulates mid expression or via a different enhancer, the regulatory logic in our model (now more in the focus in the simplified model version) would still be maintained. We acknowledge the fact that direct binding has not been validated in the Discussion.

B) Since the role for midline in cardiac diversification is expected to occur during stage 12, it is unclear why the enhancer analyses (panels D and E) are presented at stage 16.

There is a delay in the detectability of the GFP reporter and we find the current representation with the straight alignment of bilateral cardioblast rows more instructive. We have now expanded the previous Figure 7 by including reporter analysis in embryos at earlier stages (in part also stained for GFP RNA instead of GFP protein to enable earlier detection). For a more suitable presentation we decided to split this expanded figure into two separate main figures (Figure 8 and Figure 9). Simultaneously the former Figure 7—figure supplement 1 has been embedded into the main figure.

A notable observation is that the less robust mid180-GFP always shows identical signal strength in both sibling gCBs derived from a common progenitor, which implies that the level of mid180 enhancer activity is already established within the progenitor even though reporter expression is only detectable after this progenitor divides. The small, but noticeable delay with which this enhancer kicks in in comparison to midE19 and to endogenous activation could be due to loss of some auxiliary binding sites which would raise the threshold at which Pnt leads to enhancer activity (e.g., out of its genomic context, the minimal mid180 version could be "on hold" until PntP2 has activated sufficient PntP1).

C) Related to this, the midE19 enhancer is clearly not reporting the entire midline expression pattern, so how generally applicable are the findings from the analysis of just this single enhancer?

The pattern displayed by the midE19-driven reporter gene reflects the alternating pattern of early gCB-specific mid expression and it is responsive to Pnt activity just like the endogenous mid gene during germ band retraction stages (old Figure 7G, I; now Figure 9F, H). The observation that this enhancer does not drive gene expression in oCBs after germ band retraction as detected for mid in the genomic context (old Figure 7J, now Figure 9I), suggests that additional enhancers or interaction with other cis-regulatory regions are required to reproduce all aspects of cardiac mid expression. This is now stated more clearly in the manuscript. What causes the later uniform expression of mid in all cardioblasts is outside of the topic of this work as it is regulated by pnt-independent, yet unknown mechanisms (old Figure 7K, now Figure 9J).

D) Since midline is expressed at later stages throughout the cardiac tube, how does it fail to suppress seven-up at later stages (the authors discuss this later in the paper, but a mechanistic understanding is not apparent)?

One possible explanation is that the chromatin structure determining svp gene activity becomes fixed prior to appearance of Mid protein in oCBs. This is consistent with the observation that svp activation requires Tin (Ryan, Hendren, Helander, and Cripps, 2007), which is present in oCB progenitors but absent from maturing oCBs. We added this proposed explanation to the Discussion.

6) How does hedgehog impact EGF expression and receptor activity? This is a concern because, as the work stands, we are not left with a comprehensive understanding of how cardioblast diversification is triggered that incorporates existing published data.

See joint response to comments 6+7 below.

7) The question of spatial integration (in addition to temporal integration that is addressed in this paper), attributing the spatial cues to wg and in particular hh signaling, upstream of rho needs better elaboration. Also, the Discussion should be more explicit on the fact that the current studies mainly address a permissive/transducing role for pnt/edl rather than a spatially instructive role, and/or discuss what the scenarios could be that relate to spatially instructive signals.

To make the issue of spatial inputs more apparent and also to address the second part of this comment we have made modifications to the discussion, referring more extensively to published data (particularly from Liu, Qian, Wessells, Bidet, Jagla, and Bodmer, 2006) and mentioning some of our own unpublished observations regarding components of the Hh pathway in the final paragraph of the Discussion. Our current data are not in agreement with the view that the Hh pathway directly promotes oCB fate/svp expression (Ponzielli, Astier, Chartier, Gallet, Thérond, and Sémériva, 2002). Mutants with diminished Hh pathway activity, including some that were recovered by our EMS screen because of their partial CB losses (i.e. smo mutants), do not display a biased reduction of oCBs (E. Heyland, F. Karama, B. Schwarz and I. Reim; unpublished observations). On the other hand, loss of patched, which encodes a negative regulator of Hh signaling activity and therefore would be expected to favor oCBs, leads to a relative and in some alleles absolute reduction of oCBs in comparison gCBs, although absolute CB numbers are highly variable between embryos and alleles (E. Heyland, F. Karama, B. Schwarz and I. Reim; unpublished observations; Tao, Christiansen and Schulz, 2007). In the presumed amorphic mutant ptc9 we found an increase in CB numbers that was solely based on supernumerary gCBs. Although this may also be is caused indirectly via changes in the ectoderm, this observation is in agreement with the previously reported positive input of Hh signaling on rho expression (Liu, Qian, Wessells, Bidet, Jagla, and Bodmer, 2006) and the positive impact of rho on gCBs described in our manuscript. Therefore, we added inputs from Hh to the current working model (in the extended version), but labeled it with a question mark for unknown details. Since potentially specific effects of Hh signaling may be masked by interaction with ectodermal Wg signaling or other feedback mechanisms, this is not a matter of a few-months investigation, but a full-scale project. We are currently setting up such a project, because we agree with the critique that differences in Pnt activities, whether promoted by MAPK signaling or attenuated by Edl ultimately must be connected to segmental inputs.

8) Also, the gCBs come in two flavors Tin+/Lbe+ and Tin+ only; their distinction should be included in the Discussion.

In response to the reviewers request, we paid more attention to the distinction of Tin+/Lbe+ and Tin+/Lbe- gCB subtypes and analyzed the frequency of their retention in mutants with impaired EGF signaling. Although we did not detect a significant bias in the retention/loss of a particular (abdominal) gCB subtype, this analysis provided some valuable additional information, which we added to the manuscript (Figure 1—figure supplement 3). We found that residual gCBs usually occur either as Lbe+ or Lbe- pairs, but rarely as mixed Lbe+/Lbe- pairs or single cells. This further supports our notion that EGF function is required prior to completion of the final mitotic division at the gCB progenitor stage.


Article and author information

Author details

  1. Benjamin Schwarz

    Department of Biology, Division of Developmental Biology, Friedrich-Alexander University of Erlangen-Nürnberg, Erlangen, Germany
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
  2. Dominik Hollfelder

    Department of Biology, Division of Developmental Biology, Friedrich-Alexander University of Erlangen-Nürnberg, Erlangen, Germany
    Data curation, Investigation, Methodology
    Competing interests
    No competing interests declared
  3. Katharina Scharf

    Department of Biology, Division of Developmental Biology, Friedrich-Alexander University of Erlangen-Nürnberg, Erlangen, Germany
    Formal analysis, Investigation, Visualization
    Competing interests
    No competing interests declared
  4. Leonie Hartmann

    Department of Biology, Division of Developmental Biology, Friedrich-Alexander University of Erlangen-Nürnberg, Erlangen, Germany
    Formal analysis, Investigation, Visualization
    Competing interests
    No competing interests declared
  5. Ingolf Reim

    Department of Biology, Division of Developmental Biology, Friedrich-Alexander University of Erlangen-Nürnberg, Erlangen, Germany
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8069-5532


Deutsche Forschungsgemeinschaft (RE 2985/1-1)

  • Ingolf Reim

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We are grateful to Manfred Frasch for critical reading of the manuscript, Patrick Lo and Christoph Schaub for their contributions to the EMS screen, Edmar Heyland, Emi Vargatoth, Tanja Drechsler and Angela Bruns for technical assistance. We thank Manfred Frasch, Yasushi Hiromi, James Skeath, Hanh Nguyen, Frank Schnorrer, the Bloomington Stock Center and the Developmental Studies Hybridoma Bank (University of Iowa) for providing fly stocks or reagents.

Reviewing Editor

  1. Utpal Banerjee, University of California, Los Angeles, United States

Publication history

  1. Received: October 16, 2017
  2. Accepted: June 4, 2018
  3. Accepted Manuscript published: June 5, 2018 (version 1)
  4. Version of Record published: July 5, 2018 (version 2)


© 2018, Schwarz et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,069
    Page views
  • 159
  • 5

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Developmental Biology
    Yanyan Ding et al.
    Research Article

    Although thrombosis has been extensively studied using various animal models, our understanding of the underlying mechanism remains elusive. Here, using zebrafish model, we demonstrated that smarca5-deficient red blood cells (RBCs) formed blood clots in the caudal vein plexus. We further used the anti-thrombosis drugs to treat smarca5zko1049a embryos and found that a thrombin inhibitor, argatroban, partially prevented blood clot formation in smarca5zko1049a. To explore the regulatory mechanism of smarca5 in RBC homeostasis, we profiled the chromatin accessibility landscape and transcriptome features in RBCs from smarca5zko1049a and their siblings and found that both the chromatin accessibility at the keap1a promoter and expression of keap1a were decreased. Keap1 is a suppressor protein of Nrf2, which is a major regulator of oxidative responses. We further identified that the expression of hmox1a, a downstream target of Keap1-Nrf2 signaling pathway, was markedly increased upon smarca5 deletion. Importantly, overexpression of keap1a or knockdown of hmox1a partially rescued the blood clot formation, suggesting that the disrupted Keap1-Nrf2 signaling is responsible for the RBC aggregation in smarca5 mutants. Together, our study using zebrafish smarca5 mutants characterizes a novel role for smarca5 in RBC aggregation, which may provide a new venous thrombosis animal model to support drug screening and pre-clinical therapeutic assessments to treat thrombosis.

    1. Cell Biology
    2. Developmental Biology
    Maia Kinnebrew et al.
    Research Advance

    A long-standing mystery in vertebrate Hedgehog signaling is how Patched 1 (PTCH1), the receptor for Hedgehog ligands, inhibits the activity of Smoothened, the protein that transmits the signal across the membrane. We previously proposed (Kinnebrew et al., 2019) that PTCH1 inhibits Smoothened by depleting accessible cholesterol from the ciliary membrane. To directly test the effect of PTCH1 on accessible cholesterol, we measured the transport activity of PTCH1 using an imaging-based assay to follow the kinetics of cholesterol extraction from the plasma membrane of live cells by methyl-β-cyclodextrin. PTCH1 depletes accessible cholesterol in the outer leaflet of the membrane in a manner regulated by its ligand Sonic Hedgehog and the transmembrane potassium gradient. We propose that PTCH1 moves cholesterol from the outer to the inner leaflet of the membrane in exchange for potassium ion export. Our results show that proteins can change accessible cholesterol levels in membranes to regulate signaling reaction.