IRS-1 acts as an endocytic regulator of IGF-I receptor to facilitate sustained IGF signaling
- The University of Tokyo, Japan
- University of Applied Sciences Upper Austria, Austria
- RIKEN Systems and Structural Biology Center, Japan
- RIKEN Center for Life Science Technologies, Japan
- Japan Science and Technology Agency, Japan
- RIKEN Structural Biology Laboratory, Japan
- Austrian Competence Center for Feed and Food Quality, Safety and Innovation, Austria
Figures
Figure 1 with 1 supplement
IRS-1 interacts with the clathrin adaptor AP2 complex through its YxxΦ motifs.
(A) Yeast two-hybrid assay indicating the interaction of IRS-1 with the μ2 subunit of AP2. (B) The association of IRS-1 or IRS-2 with endogenous AP2 subunits was analyzed by immunoprecipitation in …
Figure 1—figure supplement 1
Three YxxΦ motifs in IRS-1 mediate the interaction with μ2 of AP2 complex.
(A) Sequence alignment of three IRS-1 YxxΦ peptides used for structural analysis. (B) Structural details of IRS-1 YxxΦ motif binding to C-μ2. The overall structures of C-μ2 with these peptides were …
Figure 2 with 1 supplement
IRS-1 promotes cell surface retention of activated IGF-IR via its YxxΦ motifs.
(A) Changes in cell surface IGF-IR following IGF-I stimulation in L6 cells were analyzed by surface biotinylation assay. Transferrin receptor (TfR) was evaluated as a loading control for cell …
Figure 2—figure supplement 1
Expression of IRS-1, but not IRS-2, inhibits the down-regulation of activated IGF-IR induced by long-term IGF-I stimulation.
(A) Phosphorylation of multiple Tyr residues in IGF-IR in L6 cells stimulated with IGF-I for the indicated time was analyzed by immunoprecipitation and immunoblotting with the indicated antibodies. …
Figure 3 with 4 supplements
Internalization of activated IGF-IR is dependent on the clathrin/AP2-mediated endocytic pathway.
(A) Knockdown of clathrin heavy chain (HC) by two different siRNAs blocked long-term IGF-I-induced reduction of phospho-IGF-IR in L6 cells. Ctrl, control. The data are representative of three …
Figure 3—figure supplement 1
AP2, but not AP1, is required for the targeting of activated IGF-IR from the plasma membrane into lysosomes.
(A) L6 cells were transfected with non-targeting or μ1 siRNA followed by IGF-I stimulation for the indicated time. Changes in phospho-IGF-IR were analyzed by immunoprecipitation and immunoblotting …
Figure 3—figure supplement 2
Effects of cycloheximide treatment and PTP1B D181A expression on surface IGF-IR changes after the ligand exposure.
(A) Changes in cell surface IGF-IR following IGF-I stimulation in L6 cells that were pre-treated with cycloheximide were analyzed by surface biotinylation assay. (B) L6 cells stably expressing …
Figure 3—figure supplement 3
Chase of internalized IGF-IR.
(A) L6 cells were surface-labeled with a cleavable biotin reagent at 4°C and then warmed to 37°C in the presence or absence of IGF-I for the indicated time. Biotin was removed from surface proteins …
Figure 3—figure supplement 4
Colocalization of IGF-IR with AP2 in response to the ligand treatment.
(A, B) L6 cells stably expressing IGF-IR-EGFP were stimulated with or without IGF-I stimulation for 1 hr. Colocalization of phospho-IGF-IR with AP2 (A) or clathrin heavy chain (B) was analyzed in …
Figure 4 with 2 supplements
IRS-1 inhibits the recruitment of active IGF-IR into clathrin-coated structures.
(A) Changes in surface phospho-IGF-IR following IGF-I stimulation in the presence of primaquine were analyzed in L6 cells stably expressing GFP, GFP-IRS-1 WT, or GFP-IRS-1 3YA by surface …
Figure 4—figure supplement 1
Effects of IRS-1 overexpression on AP2-positive spot formation and endocytosis of transferrin receptor.
(A) Co-immunoprecipitation of IGF-IR and transferrin receptor (TfR) in L6 cells stably expressing IGF-IR-FLAG. Immunoprecipitation and immunoblotting were performed with the indicated antibodies. (B)…
Figure 4—figure supplement 2
Effects of IRS-1 overexpression on endocytosis of integrin β1 and EGFR.
(A) Co-immunoprecipitation of IGF-IR and integrin β1 in L6 cells stably expressing integrin β1. Immunoprecipitation and immunoblotting were performed with the indicated antibodies. (B) L6 cells …
Figure 5 with 1 supplement
Depletion of IRS-1 accelerates AP2-dependent internalization of IGF-IR.
(A, B) L6 cells transfected with non-targeting (Ctrl) or IRS-1 siRNA were stimulated with IGF-I for the indicated time. Phosphorylation of IGF-IR was analyzed by immunoprecipitation and …
Figure 5—figure supplement 1
IRS-1 inhibits the targeting of IGF-IR into lysosomes.
(A) L6 cells stably expressing IGF-IR-EGFP were transfected with non-targeting or IRS-1 siRNA. The cells were stimulated with IGF-I in the presence of leupeptin and pepstatin A for 1 hr. Prior to …
Figure 6
mTOR-dependent degradation of IRS-1 is required for the initiation of IGF-IR internalization.
(A) Changes in IRS-1 and Akt phosphorylation following IGF-I stimulation were analyzed in L6 cells by immunoblotting. (B, C) L6 cells were treated with Torin1 or rapamycin followed by IGF-I …
Figure 7 with 1 supplement
IRS-1 is required for sustained activation of Akt and FoxO inactivation in response to IGF-I.
(A, B) Immunoblotting after treating with IGF-I for the indicated time in L6 cells stably expressing GFP, GFP-IRS-1 WT, or GFP-IRS-1 3YA (A). Immunoblots of phospho-Akt (S473) and phospho-FoxO1 …
Figure 7—figure supplement 1
Neither overexpression of IRS-2 nor solely blocking of IGF-IR internalization leads to sustained activation of Akt.
(A) Immunoblots of phospho-Akt (S473) in Figure 2—figure supplement 1C were quantified and the graph is shown as mean ± SEM of three independent experiments. (B) Immunoblotting after treating with …
Figure 8 with 1 supplement
IRS-1 is required for efficient down-regulation of atrophy-related genes mediated by IGF-I.
(A) Quantitative RT-PCR analysis of atrophy-related genes from L6 myotubes stimulated with IGF-I. Data are expressed as fold of the value at 0 hr of IGF-I stimulation. Values are mean ±SEM (n = 3). …
Figure 8—figure supplement 1
Long-term IGF-I stimulation suppresses the FoxO-regulated genes.
(A, B) Quantitative RT-PCR analysis of Smart and Musa1 from L6 myotubes stimulated with IGF-I (A), and of the FoxO-regulated genes from L6 myoblasts stimulated with IGF-I (B) is shown. Data are …
Figure 9
Model of IRS-1-mediated control for delayed IGF-IR internalization and its role in the sustained IGF signaling.
(A) The canonical view in which IRS-1 functions as a signaling mediator of IGF-IR to the PI3K-Akt pathway through their Tyr phosphorylation. The molecular basis for closed interactions between …
Tables
Table 1
Data collection and refinement statistics
https://doi.org/10.7554/eLife.32893.005| Y608 peptide complex | Y628 peptide complex | Y658 peptide complex | |
|---|---|---|---|
| Crystal parameters | |||
| Space group | P64 | P64 | P64 |
| Cell dimensions: | |||
| a, b, c (Å) | 126.07, 126.07, 73.40 | 126.19, 126.19, 74.11 | 125.48, 125.48, 74.14 |
| α, β, γ (°) | 90, 90, 120 | 90, 90, 120 | 90, 90, 120 |
| Data collection | |||
| Wavelength (Å) | 1.000 | 1.000 | 1.000 |
| Resolution (Å) | 50–2.63 (2.68–2.63)* | 50–3.10 (3.15–3.10) | 50–2.60 (2.64–2.60) |
| No. of unique reflections | 20035 | 12419 | 20659 |
| Multiplicity | 11.3 (10.9) | 11.3 (11.4) | 11.4 (11.5) |
| Completeness (%) | 100 (100) | 100 (100) | 100 (100) |
| Rmeas | 0.078 (1.504) | 0.103 (1.880) | 0.094 (2.069) |
| Rpim | 0.023 (0.455) | 0.031 (0.556) | 0.028 (0.608) |
| CC1/2 | (0.743) | (0.646) | (0.780) |
| Mean I/σ | 28.1 (1.8) | 24.8 (1.6) | 26.5 (1.6) |
| Refinement | |||
| Resolution (Å) | 43–2.62 | 36–3.10 | 36–2.60 |
| No. of reflections | 19977 | 12322 | 20589 |
| Rwork/Rfree | 0.185/0.223 | 0.194/0.251 | 0.192/0.227 |
| RMSD bond lengths (Å) | 0.008 | 0.010 | 0.009 |
| RMSD bond angles (°) | 0.948 | 1.194 | 0.965 |
| No. of atoms | |||
| Protein/peptide | 2003 | 2121 | 2118 |
| Water/ion | 2 | 0 | 34 |
| Ramachandran plot | |||
| Favored (%) | 95.5 | 92.3 | 95.4 |
| Outliers (%) | 0 | 0 | 0 |
| PDB accession code: | 5WRK | 5WRL | 5WRM |
-
*Values in parentheses are for highest resolution shell.
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | BL21 | Agilent Technologies | Agilent Technologies: 200133 | |
| Strain, strain background(Escherichia coli) | BL21-CodonPlus(DE3)-RIL | Agilent Technologies | Agilent Technologies: 230245 | |
| Cell line (Rattus norvegicus) | L6 | ATCC | ATCC: CRL-1458; RRID: CVCL_0385 | |
| Cell line (Homo sapiens) | 293T | ATCC | ATCC: CRL-3216; RRID: CVCL_0063 | |
| Cell line (Homo sapiens) | PLAT-E | PMID: 10871756 | RRID: CVCL_B488 | A kind gift from T. Kitamura, The University of Tokyo |
| Antibody | Rabbit polyclonal anti-phospho-IGF-IRβ (Tyr1131) | Cell Signaling Technology | Cell Signaling Technology: 3021; RRID: AB_331578 | IB 1:1000; IF 1:200 |
| Antibody | Rabbit monoclonal anti-phospho-IGF-IRβ (Tyr980) | Cell Signaling Technology | Cell Signaling Technology: 4568; RRID: AB_2122279 | IB 1:1000 |
| Antibody | Rabbit polyclonal anti-phospho-IGF-IRβ (Tyr1316) | Cell Signaling Technology | Cell Signaling Technology: 6113; RRID: AB_10545762 | IB 1:1000 |
| Antibody | Rabbit monoclonal anti-IGF-IRβ | Cell Signaling Technology | Cell Signaling Technology: 9750; RRID: AB_10950969 | IF 1:200 |
| Antibody | Rabbit polyclonal anti-Akt | Cell Signaling Technology | Cell Signaling Technology: 9272; RRID: AB_329827 | IB 1:1000 |
| Antibody | Rabbit polyclonal anti-phospho-Akt (Thr308) | Cell Signaling Technology | Cell Signaling Technology: 9275; RRID: AB_329828 | IB 1:1000 |
| Antibody | Rabbit polyclonal anti-phospho-Akt (Ser473) | Cell Signaling Technology | Cell Signaling Technology: 9271; RRID: AB_329825 | IB 1:1000 |
| Antibody | Rabbit monoclonal anti-phospho-p70 S6K (Thr389) | Cell Signaling Technology | Cell Signaling Technology: 9234; RRID: AB_2269803 | IB 1:1000 |
| Antibody | Rabbit polyclonal anti-phospho-FoxO1 (Thr24)/FoxO3a (Thr32) | Cell Signaling Technology | Cell Signaling Technology: 9464; RRID: AB_329842 | IB 1:1000 |
| Antibody | Rabbit polyclonal anti-phospho-FoxO1 (Sere256) | Cell Signaling Technology | Cell Signaling Technology: 9461; RRID: AB_329831 | IB 1:1000 |
| Antibody | Rabbit monoclonal anti-FoxO1 | Cell Signaling Technology | Cell Signaling Technology: 2880; RRID: AB_2106495 | IB 1:1000 |
| Antibody | Rabbit polyclonal anti-IGF-IRα | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-712; RRID: AB_671788 | IB 1:1000 |
| Antibody | Rabbit polyclonal anti-IGF-IRβ | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-713; RRID: AB_671792 | IB 1:1000; IP 1:200 |
| Antibody | Rabbit polyclonal anti-IRS-2 | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-8299; RRID: AB_2125783 | IB 1:1000 |
| Antibody | Mouse monoclonal anti-clathrin HC | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-12734; RRID: AB_627263 | IB 1:1000 |
| Antibody | Mouse monoclonal anti-α-adaptin | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-17771; RRID: AB_2274034 | IB 1:1000; IF 1:200 |
| Antibody | Rabbit polyclonal anti-p70 S6K | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-230; RRID: AB_632156 | IB 1:1000 |
| Antibody | Mouse monoclonal anti-HSP90 | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-7947; RRID: AB_2121235 | IB 1:2000 |
| Antibody | Rabbit polyclonal anti-γ-adaptin | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-10763; RRID: AB_2058329 | IB 1:1000 |
| Antibody | Mouse monoclonal anti-GFP | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-9996; RRID: AB_627695 | IB 1:1000; IP 1:200 |
| Antibody | Mouse monoclonal anti-ubiquitin (P4D1) | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-8017; RRID: AB_628423 | IB 1:200 |
| Antibody | Mouse monoclonal anti-FLAG M2 | Sigma-Aldrich | Sigma-Aldrich: F3165; RRID: AB_259529 | IB 1:2000 |
| Antibody | Anti-FLAG M2 agarose affinity gel | Sigma-Aldrich | Sigma-Aldrich: A2220; RRID: AB_10063035 | |
| Antibody | Mouse monoclonal anti-α-tubulin (DM1A) | Sigma-Aldrich | Sigma-Aldrich: T6199; RRID: AB_477583 | IB 1:2000 |
| Antibody | Mouse monoclonal anti-phospho-Tyr (4G10) | Sigma-Aldrich | Sigma-Aldrich: 05-1050X; RRID: AB_916370 | IB 1:1000 |
| Antibody | Rabbit polyclonal anti-IRS-1 | Upstate | Upstate: 06-248; RRID:AB_2127890 | IB 1:1000 |
| Antibody | Mouse monoclonal anti-myosin heavy chain | Upstate | Upstate: 05-716; RRID: AB_309930 | IF 1:200 |
| Antibody | Mouse monoclonal anti-Myc | Upstate | Upstate: 05-419; RRID: AB_309725 | IF 1:200 |
| Antibody | Rabbit polyclonal anti-p85 PI3 kinase | Upstate | Upstate: 06-195; RRID: AB_310069 | IB 1:1000 |
| Antibody | Mouse monoclonal anti-μ2 | BD Transduction Laboratories | BD Transduction Laboratories: 611350; RRID: AB_398872 | IB 1:1000 |
| Antibody | Mouse monoclonal anti-clathrin | abcam | abcam: ab2731; RRID: AB_303256 | IF 1:200 |
| Antibody | Rabbit monoclonal anti-integrin β1 | abcam | abcam: ab52971; RRID: AB_870695 | IB 1:1000 |
| Antibody | Mouse monoclonal anti-transferrin receptor (H68.4) | Invitrogen | Invitrogen: 13-6800; RRID: AB_86623 | IB 1:1000 |
| Antibody | Mouse monoclonal anti-integrin β1 (TS2/16) | Invitrogen | Invitrogen: 14-0299-82; RRID: AB_1210468 | IF 1:500 |
| Antibody | Rat monoclonal anti-HA (3F10) | Roche | Roche: 11-867-423-001; RRID: AB_10094468 | IF 1:200 |
| Antibody | Alexa 488-, 594- or 633- secondaries | Molecular Probes | IF 1:1000 | |
| Antibody | Rabbit polyclonal anti-IRS-1 | PMID: 23478262 | IP 1:200 | |
| Recombinant DNA reagent | pFLAG-CMV-IRS-1 1-865 (plasmid) | This paper | Vector: pFLAG-CMV; Insert: Rat IRS-1 1-865 | |
| Recombinant DNA reagent | pFLAG-CMV-IRS-1 1-542 (plasmid) | This paper | Vector: pFLAG-CMV; Insert: Rat IRS-1 1-542 | |
| Recombinant DNA reagent | pFLAG-CMV-IRS-1 1-259 (plasmid) | This paper | Vector: pFLAG-CMV; Insert: Rat IRS-1 1-259 | |
| Recombinant DNA reagent | pFLAG-CMV-IRS-1 (plasmid) | This paper | Vector: pFLAG-CMV; Insert: Rat IRS-1 full-length | |
| Recombinant DNA reagent | pFLAG-CMV-IRS-2 (plasmid) | PMID: 21168390 | Vector: pFLAG-CMV; Insert: human IRS-2 | |
| Recombinant DNA reagent | pMXs-Puro-EGFP-IRS-1 (plasmid) | This paper | Vector: pMXs-Puro; Insert: EGFP-IRS-1 wild-type | |
| Recombinant DNA reagent | pMXs-Puro-EGFP-IRS-1 3YA (plasmid) | This paper | Vector: pMXs-Puro; Insert: EGFP-IRS-1 3YA | |
| Recombinant DNA reagent | pMXs-Puro-EGFP-IRS-1ΔPTB (plasmid) | This paper | Vector: pMXs-Puro; Insert: EGFP-IRS-1 DPTB | |
| Recombinant DNA reagent | pMXs-Puro-EGFP (plasmid) | This paper | Vector: pMXs-Puro; Insert: EGFP | |
| Recombinant DNA reagent | pMXs-Puro-EGFP-IRS-2 (plasmid) | This paper | Vector: pMXs-Puro; Insert: EGFP-rat IRS-2 | |
| Recombinant DNA reagent | pIGF-IR-EGFP (plasmid) | This paper | Vector: pEGFP-N1; Insert: human IGF-IR | |
| Recombinant DNA reagent | pMXs-Puro-IGF-IR-FLAG (plasmid) | This paper | Vector: pMXs-Puro; Insert: IGF-IR-FLAG | |
| Recombinant DNA reagent | pMXs-Puro-IGF-IR-EGFP (plasmid) | This paper | Vector: pMXs-Puro; Insert: IGF-IR-EGFP | |
| Recombinant DNA reagent | pMXs-Puro-IGF-IR-HA-EGFP (plasmid) | This paper | Vector: pMXs-Puro; Insert: IGF-IR-HA-EGFP | |
| Recombinant DNA reagent | pMXs-Puro-integrinβ1 (plasmid) | This paper | Vector: pMXs-Puro; Insert: human integrin b1 | |
| Recombinant DNA reagent | EGFR-GFP (plasmid) | Addgene | Addgene: 32751 | |
| Recombinant DNA reagent | pσ2-mRFP (plasmid) | This paper | Vector: pCS2-mRFP4; Insert: rat s2 subunit | |
| Recombinant DNA reagent | pmRFP-C1 (plasmid) | This paper | ||
| Recombinant DNA reagent | pmRFP-IRS-1 (plasmid) | This paper | Vector: pmRFP-C1; Insert: rat IRS-1 | |
| Recombinant DNA reagent | pGEX-μ1 (plasmid) | PMID: 23478262 | Vector: pGEX-5X-3; Insert: mouse m1 | |
| Recombinant DNA reagent | pGEX-μ2 (plasmid) | This paper | Vector: pGEX-5X-3; Insert: mouse m2 | |
| Recombinant DNA reagent | pGEX-C-μ2 (plasmid) | This paper | Vector: pGEX-5X-3; Insert: mouse m2 C-terminal domain | |
| Recombinant DNA reagent | pET15b-C-μ2 (plasmid) | This paper | Vector: pET15b; Insert: rat m2 C-terminal domain | |
| Recombinant DNA reagent | pLV-hU6-EF1a-green | Biosettia | Biosettia: SORT-B05 | |
| Recombinant DNA reagent | pCAG-HIVgp | RIKEN | RDB04394 | |
| Recombinant DNA reagent | pCMV-VSV-G-RSV-Rev | RIKEN | REB04393 | |
| Sequence-based reagent | siRNA targeting clathrin #1 | RNAi Corp. | 5’-GUAUGCCUCUGAAUCGAAAGA-3’ | |
| Sequence-based reagent | siRNA targeting clathrin #2 | RNAi Corp. | 5’-CAGAAGAAUCGACGUUAUUUU-3’ | |
| Sequence-based reagent | siRNA targeting μ2 #1 | RNAi Corp. | 5’-CGAAGUGGCAUUUACGAAACC-3’ | |
| Sequence-based reagent | siRNA targeting μ2 #2 | RNAi Corp. | 5’-CUGCUUUGGGAUAGUAUGAGC-3’ | |
| Sequence-based reagent | siRNA targeting IRS-1 #1 | RNAi Corp. | 5’-CAAUGAGUGUGCAUAAACUUC-3’ | |
| Sequence-based reagent | siRNA targeting IRS-1 #2 | RNAi Corp. | 5’-GCCUCGAAAGGUAGACACAGC-3’ | |
| Sequence-based reagent | siRNA targeting μ1 | RNAi Corp. | 5’-CAGACGGAGAAUUCGAACUCA-3’ | |
| Sequence-based reagent | Non-targeting control siRNA | RNAi Corp. | 5’-GUACCGCACGUCAUUCGUAUC-3’ | |
| Sequence-based reagent | shRNA targeting LacZ | Invitrogen | 5’-GCTACACAAATCAGCGATTT-3’(targeting sequence) | |
| Sequence-based reagent | shRNA targeting IRS-1 #5 | Invitrogen | 5’-GCAGGCACCATCTCAACAATCC-3’(targeting sequence) | |
| Sequence-based reagent | shRNA targeting IRS-1 #6 | Invitrogen | 5’-GAGAATATGTGAATATTGAATC-3’(targeting sequence) | |
| Sequence-based reagent | Fbxo32-qPCR forward primer | Invitrogen | ACTTCTCGACTGCCATCCTG | |
| Sequence-based reagent | Fbxo32-qPCR reverse primer | Invitrogen | TCTTTTGGGCGATGCCACTC | |
| Sequence-based reagent | Trim63-qPCR forward primer | Invitrogen | GGGAACGACCGAGTTCAGAC | |
| Sequence-based reagent | Trim63-qPCR reverse primer | Invitrogen | GCGTCAAACTTGTGGCTCAG | |
| Sequence-based reagent | Fbxo30-qPCR forward primer | Invitrogen | TGCAGTGGGGGAAAAAGAAGT | |
| Sequence-based reagent | Fbxo30-qPCR reverse primer | Invitrogen | TGCAGTACTGAATCGCCACA | |
| Sequence-based reagent | Fbxo21-qPCR forward primer | Invitrogen | ACTCCATCGGGCTCGTTATG | |
| Sequence-based reagent | Fbxo21-qPCR reverse primer | Invitrogen | TGTTTCGGATCCACTCGTGC | |
| Sequence-based reagent | Map1lc3b-qPCR forward primer | Invitrogen | GCCGGAGCTTCGAACAAAGA | |
| Sequence-based reagent | Map1lc3b-qPCR reverse primer | Invitrogen | GCTTCTCACCCTTGTATCGC | |
| Sequence-based reagent | Gabarapl1-qPCR forward primer | Invitrogen | ACAACACTATCCCTCCCACC | |
| Sequence-based reagent | Gabarapl1-qPCR reverse primer | Invitrogen | GCTTCTGCCTCATTTCCCGTA | |
| Sequence-based reagent | Rn18s-qPCR forward primer | Invitrogen | TCCCAGTAAGTGCGGGTCATA | |
| Sequence-based reagent | Rn18s-qPCR reverse primer | Invitrogen | CGAGGGCCTCACTAAACCATC | |
| Peptide, recombinant protein | GST-μ1 | PMID: 23478262 | GST-tagged mouse m1 | |
| Peptide, recombinant protein | GST-μ2 | This study | GST-tagged mouse m2 | |
| Peptide, recombinant protein | GST-C-μ2 | This study | GST-tagged mouse m2 C-terminal domain | |
| Peptide, recombinant protein | His-C-μ2 | This study | 6×His-tagged rat m2 C-terminal domain | |
| Peptide, recombinant protein | GY(608)MPMSPG-IRS-1 peptide | Toray Research Center, Inc. | Used for co-crystalization | |
| Peptide, recombinant protein | DY(628)MPMSPK-IRS-1 peptide | Toray Research Center, Inc. | Used for co-crystalization | |
| Peptide, recombinant protein | GY(658)MMMSPS-IRS-1 peptide | Toray Research Center, Inc. | Used for co-crystalization | |
| Peptide, recombinant protein | recombinant human IGF-I | Astellas Pharma Inc. | A kind gift from T. Ohkuma,Astellas Pharma Inc. | |
| Peptide, recombinant protein | recombinant human EGF | Thermo Fisher Scientific | Thermo Fisher Scientific: PHG0315 | |
| Chemical compound, drug | Lipofectamine LTX | Invitrogen | Invitrogen: 15338100 | |
| Chemical compound, drug | Lipofectamine RNAiMAX | Invitrogen | Invitrogen: 13778075 | |
| Chemical compound, drug | leupeptin | PEPTIDE INSTITUTE, INC. | PEPTIDE INSTITUTE: 4041 | |
| Chemical compound, drug | pepstatin A | Sigma-Aldrich | Sigma-Aldrich: P5318-5MG | |
| Chemical compound, drug | Torin1 | Cayman Chemical | Cayman Chemical: 10997 | |
| Chemical compound, drug | rapamycin | Sigma-Aldrich | Sigma-Aldrich: 37094-10MG | |
| Chemical compound, drug | primaquine bisphosphate | Sigma-Aldrich | Sigma-Aldrich: 160393-1G | |
| Chemical compound, drug | cycloheximide | nacalai tesque | nacalai tesque: 06741-04 | |
| Chemical compound, drug | EZ-Link NHS-LC-Biotin | Pierce | Pierce: 21336 | |
| Chemical compound, drug | Biotin-SS-Sulfo-OSu | Dojindo | Dojindo: B572 | |
| Chemical compound, drug | LysoTracker Red DND-99 | Molecular Probes | Molecular Probes: L7528 | |
| Chemical compound, drug | Transferrin from human serum, Alexa Fluor 546 conjugate | Molecular Probes | Molecular Probes: T23364 | |
| Chemical compound, drug | Hoechst 33342 | Molecular Probes | Molecular Probes: H3570 | |
| Chemical compound, drug | ReverTra Ace qPCR Master Mix | TOYOBO | TOYOBO: FSQ-201 | |
| Chemical compound, drug | THUNDERBIRD SYBR qPCR Mix | TOYOBO | TOYOBO: QPS-201 | |
| Chemical compound, drug | cOmplete EDTA-free protease inhibitor cocktail | Roche | Roche: 11873580001 | |
| Software, algorithm | Fiji | PMID: 22743772 | RRID: SCR_002285 | |
| Software, algorithm | HKL2000 | PMID: 27754618 | ||
| Software, algorithm | CCP4 suite | PMID: 21460441 | RRID: SCR_007255 | |
| Software, algorithm | MOLREP | doi:10.1107/S0021889897006766 | ||
| Software, algorithm | REFMAC5 | PMID: 15299926 | RRID: SCR_014225 | |
| software, algorithm | PHENIX | PMID: 20124702 | RRID: SCR_014224 | |
| Software, algorithm | COOT | PMID: 15572765 | RRID: SCR_014222 | |
| Software, algorithm | PyMOL | The PyMOL Molecular Graphics System | RRID: SCR_000305 | |
| Other | Lenti-X Concentrator | Clontech | Clonetech: 631231 | |
| Other | Glutathione Sepharose 4B | GE Healthcare | GE Healthcare: 17075601 | |
| Other | Protein G Seharose Fast Flow | GE Healthcare | GE Healthcare: 17061801 | |
| Other | Streptavidin Agarose | Pierce | Pierce: 20347 | |
| Other | HisTrap HP column | GE Healthcare | GE Healthcare: 17524801 | |
| Other | HiTrap SP HP column | GE Healthcare | GE Healthcare: 17115101 | |
| Other | HiLoad 16/60 Superdex200 column | GE Healthcare | GE Healthcare: 17-1069-01 |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.32893.024
