SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation
- Indian Institute of Science, India
- University of Chicago, United States
Figures
Figure 1
Acetylation of GSK3β increased in pathological cardiac hypertrophy.
(A) Scatter plot showing cardiac hypertrophy, as measured by Heart weight/Tibia Length (HW/TL) ratio of 8 weeks old 129/Sv mice treated with either vehicle or isoproterenol (ISO) at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 9–10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. (B) Scatter plot representing left ventricular posterior wall thickness of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. (C) Scatter plot indicating the contractile functions of heart as represented by ejection fraction of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. (D) Histogram showing GSK3β activity assay in heart lysates of vehicle or ISO-treated 8 weeks old 129/Sv mice. Mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody, clone GSK-4B (Sigma). The immunoprecipitated GSK3β was incubated with the peptide substrate in the presence of γ−32P-ATP. The incorporation of 32P into the GSK3β peptide substrate, which contains specific phosphorylation residues of GSK3β was measured. n = 10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. (E) Eight weeks old 129/Sv mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy) and the affinity resin immobilized with protein A/G. Western blotting analysis was performed to detect the levels of GSK3β acetylation (Ac-Lys) by anti-acetyl-lysine antibody. IgG was used as negative control in this assay. Heart tissue lysates (WCL) were probed for indicated proteins by western blotting. ANP was used as a positive control to assess cardiac hypertrophy in ISO infused mice. n = 4 mice per group. # marked western blotting images denotes SIRT2 antibody (#12650; Cell Signaling), used in this assay detects single band. (F) Histogram showing relative acetylated GSK3β in vehicle and ISO-treated mice heart tissues, as measured from Figure 1E. Signal intensities of acetylated GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 mice per group. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. (G) GSK3β was immunoprecipitated from heart tissues of 8 weeks old 129/Sv mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology), and the affinity resin with protein A/G immobilized. Western blotting was performed to detect GSK3β interaction with p300 using anti-p300 antibody. IgG was used as a negative control. Whole cell lysates (WCL) were probed for the presence of GSK3β and p300 by western blotting. (H) Co-localization of GSK3β with p300 was assessed in 293 T cells by confocal microscopy. The antibodies used are anti-GSK3β (sc-9166, Santacruz), and p300 (05–257, Millipore). DAPI was used to stain the nucleus. Expanded images (right small boxes) show yellow color in the merge image, indicating the co-localization of GSK3β (Green) and p300 (Red) in the nucleus. (I) In vitro binding assay to test the direct interaction between GSK3β and p300. Recombinant p300 (Millipore # 2273152) was incubated with recombinant GST or GST-GSK3β, purified from E. coli BL21 (DE3) by affinity chromatography using Glutathione Sepharose 4B. (J) Western blotting analysis showing the acetylation and activity of GSK3β in rat neonatal cardiomyocytes infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Depletion of p300 was confirmed by western blotting. GSK3β was immunoprecipitated from control and p300-KD cells using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology) and the affinity resin immobilized with protein A/G. Western blotting was performed to detect acetylation of GSK3β using the anti Ac-Lysine antibody. GSK3β activity was measured by assessing the phosphorylation of glycogen synthase (p–GS). Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cardiomyocyte lysates (WCL). (K) Histogram showing the quantification of relative acetylated GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured from Figure 1J. Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of acetylated GSK3β and GSK3β were quantified by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. (L) Histogram depicting the activity of GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from Figure 1J. Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of phospho-glycogen synthase and glycogen synthase were measured by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. (M) Western blotting analysis showing the acetylation of GSK3β in rat neonatal cardiomyocytes infected with either control (Ad-null) or p300 overexpressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting. GSK3β was immunoprecipitated using anti-GSK3β antibody (sc-9166, Santacruz) and the affinity resin with protein A/G immobilized. Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cell lysates (WCL). (N) Western blotting analysis showing the activity of GSK3β in rat neonatal cardiomyocytes infected with control (Ad-null) or p300 expressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting and the activity of GSK3β was probed by assessing the levels of p-GS and GS by western blotting. (O) Histogram showing the activity of GSK3β in control (Ad-Null) or p300 overexpressing (Ad-p300) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from Figure 1N. Signal intensities of phospho-glycogen synthase and glycogen synthase were assessed by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. (P) In vitro kinase assay showing the activity of acetylated and non-acetylated GSK3β. Human GSK3β with HA tag was overexpressed in HeLa cells by transfection of the plasmid pcDNA3-HA-GSK3β. HA-GSK3β was immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich) and the HA-GSK3β was acetylated by recombinant p300 (Millipore), in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide. n = 6 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.
Figure 2 with 3 supplements
Molecular modeling and molecular dynamics simulations of GSK3β wild-type and K183 acetylated mutant.
(A) Annotation of representative tandem mass spectra of trypsin-digested GSK3β, depicting K150 and K183 acetylation. (B) Representation of the acetylation sites on the crystal structure of GSK3β (PDB ID 4NM0): (i) surface (ii) cartoon representation. (iii) Magnified active site representing position of K183 and (iv) magnified active site representing position of acetylated K183 (acK183). (C) Nucleotide-binding site in GSK3β crystal structure (PDB ID 4NM0) representing ADP, nucleotide interacting residues and K183. (D) Overlay of the wild-type (blue) and acK183 mutant (orange) of GSK3β representing the surface of ADP nucleotide, at random snapshots in the MD trajectory. (E) Overlay of protein backbone Cα RMSD plots of the five 20 ns MD trajectories in wild type. (F) Overlay of ADP nucleotide RMSD plots of the five 20 ns MD trajectories in wild type. (G) Overlay of the distance between the NZ atom of K85 and α-phosphate of ADP as a function of time for two stable trajectories (dark blue/cyan – wild type, pink/red – acK183). (H) Overlay of protein backbone Cα RMSD plots of the five 20 ns MD trajectories in acK183 mutant. (I) Overlay of ADP nucleotide RMSD plots of the five 20 ns MD trajectories in acK183 mutant. (J) Overlay of the distance between the NZ atom of K85 and β-phosphate of ADP as a function of time for two stable trajectories (dark blue/cyan – wild type, pink/red – acK183). (K) Histogram showing binding of γ−32P-ATP to recombinant wild type and mutants of His-GSK3β. Plasmids encoding wild type and mutants of His-GSK3β were transformed into E. coli BL21 (DE3). His-GSK3β and its mutants were purified by Ni-NTA affinity chromatography. n = 4 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. (L) Histogram showing activity of HA-tagged WT or mutants of GSK3β. HA-tagged human GSK3β or its mutants were overexpressed in HeLa cells by transfection of their respective plasmids. HA-GSK3β or its mutants were immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich). The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide as described in the Materials and methods section. GSK3β-DN - GSK3β-K85A; Dominant negative. GSK3β-CA- GSK3β S9A; catalytically active. n = 4 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.
Figure 2—figure supplement 1
Protein backbone Cα RMSF plots of the wild type (dark blue) and Ac-K183 mutant (red).
https://doi.org/10.7554/eLife.32952.004
Figure 2—figure supplement 2
Homology alignment of GSK3β between different species.
https://doi.org/10.7554/eLife.32952.005
Figure 2—figure supplement 3
Stoichiometry for GSK3β-K150, -K183 acetylation.
https://doi.org/10.7554/eLife.32952.006
Figure 3 with 5 supplements
SIRT2 binds to, deacetylates and activates GSK3β.
(A) Western blot analysis of acetylated GSK3β in heart samples of 9 months old WT and SIRT2-KO littermates. GSK3β was immunoprecipitated from heart tissue lysates of WT and SIRT2-KO mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy), and the affinity resin immobilized with protein A/G. Western blotting was performed to detect GSK3β acetylation by anti-Ac-Lysine antibody. IgG was used as a negative control. Whole cell lysates (WCL) were probed for the SIRT2 and GAPDH by western blotting. n = 4 mice per group. (B) Histogram showing relative acetylated GSK3β in 9 months old WT and SIRT2-KO mice heart tissues, as measured from Figure 3A. Signal intensities of acetylated GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. (C) GSK3β was immunoprecipitated from heart tissue lysates of 8 weeks old 129/Sv mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy ), and the affinity resin immobilized with protein A/G. GSK3β interaction with SIRT2 was tested by western blotting using anti-SIRT2 antibody. IgG was used as negative control. Heart lysates was probed for indicated proteins by western blotting. (D) In vitro binding assay to test the interaction between GSK3β and SIRT2. Flag-SIRT2 was overexpressed in 293 cells by a plasmid encoding human Flag-SIRT2. Recombinant His or His-GSK3β was purified from E. coli BL21 (DE3) by Ni-NTA affinity chromatography and were incubated with 293 T cell lysates overexpressing human Flag-SIRT2. Interaction between GSK3β and SIRT2 was tested by western blotting. # marked western images denotes SIRT2 antibody used in this assay detects single band. (E) In vitro deacetylation assay showing SIRT2 as GSK3β deacetylase. Human HA-GSK3β was overexpressed in HeLa cells by transfection of the plasmid pcDNA3-HA-GSK3β. HA-GSK3β was immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich) and the HA-GSK3β was acetylated by recombinant p300 (Millipore), in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. The acetylated HA-GSK3β was further incubated with either Flag-tagged SIRT2 or SIRT2-H187Y, which were immunoprecipitated from HEK 293 cell lysates overexpressing respective plasmids encoding Flag-tagged WT or SIRT2-H187Y using agarose beads conjugated to anti-Flag antibody (Sigma A2220). The deacetylation reaction was carried out in the presence or absence of NAD+ in a HDAC buffer. GSK3β acetylation was analyzed by western blotting using anti-Ac-Lysine antibody. # marked western images denotes SIRT2 antibody used in this assay detects single band. (F) In vitro kinase assay depicting the activity of acetylated and deacetylated GSK3β. Human HA-GSK3β was overexpressed in HeLa cells by transfection of the plasmid pcDNA3-HA-GSK3β. Recombinant HA-GSK3β was immunoprecipitated using HA-coupled beads and was acetylated by recombinant p300 in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. Acetylated GSK3β was further deacetylated by either Flag-tagged WT or SIRT2-H187Y (SIRT2-HY), a catalytic inactive mutant of SIRT2, which was immunoprecipitated from HEK 293 cells, overexpressed with plasmid encoding Flag-tagged WT or SIRT2-H187Y using agarose beads conjugated to anti-Flag antibody (Sigma A2220). The deacetylation reaction was carried out in the presence or absence of NAD+ in a HDAC buffer and further enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide, as described in the Materials and methods section. n = 5. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. (G) Western blot analysis of acetylated GSK3β from control or SIRT2-depleted (SIRT2-KD) cardiomyocytes. Neonatal rat cardiomyocytes were transfected with either non-targeting (control) or siRNA targeting SIRT2 using Lipofectamine RNAiMAX reagent for 72 hr. SIRT2 depletion was confirmed by Western blotting. Total cellular acetylation was probed by anti-Ac-Lysine antibody to test the effect of SIRT2 depletion in cardiomyocytes. GSK3β was immunoprecipitated from these cell lysates using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy), and the affinity resin immobilized with protein A/G. Western blotting was performed to detect acetylation of GSK3β by anti-Ac-Lysine antibody. Cell lysates (WCL) from control and SIRT2-KD cardiomyocytes were probed for indicated proteins by western blotting. (H) Western blotting analysis of hearts lysates from 9 months old WT and SIRT2-KO mice littermates for indicated proteins. n = 4 mice per group. (I) Histogram showing activity of GSK3β in WT and SIRT2-KO mice hearts at 9 months of age. GSK3β was immunoprecipitated from the heart lysates of WT and SIRT2-KO mice using anti-GSK3β antibody, clone GSK-4B (Sigma). The immunoprecipitated GSK3β was incubated with the peptide substrate in the presence of γ−32P-ATP. The incorporation of 32P into the GSK3β Peptide Substrate, which contains specific phosphorylation residue of GSK3β was measured. n = 6 mice per group. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. (J) In vitro deacetylation assay to test whether SIRT2 deacetylates K183 residue of GSK3β. HA-tagged GSK3β or GSK3β-K183R was overexpressed in HeLa cells and was immunoprecipitated using HA-coupled beads. HA-tagged WT-GSK3β or GSK3β-K183R were incubated with Flag-SIRT2 immunoprecipitated from HEK 293 T cells using agarose beads conjugated to Anti-Flag antibody (Sigma A2220). The deacetylation reaction was carried out in the presence or absence of NAD+ in a deacetylation buffer. Acetylation status of GSK3β was analyzed by western blotting. # marked western images denotes SIRT2 antibody used in this assay detects single band. (K) Histogram showing relative acetylation of HA-tagged GSK3β or GSK3β-K183R, which was incubated with Flag-SIRT2. The data is generated from Figure 3J. Signal intensities of acetylated-GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. (L) Histogram showing binding of γ−32P-ATP to acetylated and deacetylated His-GSK3β. Recombinant His-GSK3β was purified from E. coli BL 21 (DE3) by Ni-NTA affinity chromatography. Purified His-GSK3β was acetylated by recombinant p300 in the presence of Ac-CoA in HAT buffer. Acetylated His-GSK3β was further deacetylated by Flag-SIRT2 immunoprecipitated from HEK 293 T cells. The binding of γ−32P-ATP to acetylated and deacetylated His-GSK3β was assessed by the protocol described in Materials and methods section. n = 4. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. (M) Histogram showing activity of WT or mutants of GSK3β. HA-tagged WT or mutants of GSK3β was immunoprecipitated from HeLa cells transfected with respective plasmids using HA-coupled agarose beads. The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide, as described in the Materials and methods section. n = 4. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.
Figure 3—figure supplement 1
Western blotting analysis showing acetylation and phosphorylation of GSK3β and its downstream target GS in HeLa cells overexpressing the Sirtuin isoforms, SIRT1-SIRT7.
Cells were transiently overexpressed with either pcDNA-Flag or pcDNA-Flag-SIRT1-7 plasmid for 48 hr, and western blotting was performed to detect the indicated proteins. HeLa cell lysates (WCL) were probed with Flag-antibody for detecting the expression of Sirtuins. GSK3β was immunoprecipitated from these overexpressed lysates using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechology) and tested for its acetylation by western blotting using anti-Ac-Lys antibody.
Figure 3—figure supplement 2
Western blotting analysis of vehicle or SIRT2 inhibitor, AGK2-(10 µM, 12 hr) treated rat neonatal cardiomyocytes for indicated proteins.
Acetylation of tubulin at K40, which is a specific deacetylation target of SIRT2 was probed to test the efficacy of SIRT2 inhibition. GSK3β was immunoprecipitated from these cell lysates using anti-GSK3β antibody, and the affinity resin immobilized with protein A/G. GSK3β acetylation was detected by Western blotting.
Figure 3—figure supplement 3
Representative confocal images of vehicle or AGK2 (10 µM, 12 hr) treated HeLa cells stained with GSK3β (Green).
MnSOD was used to localize the mitochondria (Red). DAPI was used to stain the nucleus (Blue).
Figure 3—figure supplement 4
Representative confocal images of HA-tagged WT or mutants of GSK3β transiently overexpressed in GSK3β-deficient mouse embryonic fibroblasts.
Immunostaining was performed using HA antibody to localize WT and mutants of GSK3β (Red).
Figure 3—figure supplement 5
Western blot analysis of 9 months old WT and SIRT2-KO mice heart samples for indicated proteins.
n = 4 mice per group.
Figure 4
Molecular modeling of acetylated GSK3α.
(A) Western blot analysis showing acetylation status of both isoforms of GSK3 in control or SIRT2 depleted (SIRT2-KD) cardiomyocytes. Neonatal rat cardiomyocytes were transfected with either non-targeting or siRNA pool targeting SIRT2 using Lipofectamine RNAiMAX reagent for 72 hr. SIRT2 depletion was confirmed by western blotting. GSK3 was immunoprecipitated from cell lysates using anti-GSK3 antibody and the affinity resin immobilized with protein A/G. Western blotting was performed to detect GSK3α/β acetylation by anti-Ac-Lysine antibody. Cell lysates was probed for SIRT2 and actin antibodies by western blotting. (B) Histogram showing relative acetylated-GSK3α and GSK3β in control and SIRT2-depleted (SIRT2-KD) cardiomyocytes, as measured from Figure 4A. Signal intensities of acetylated-GSK3α and acetylated-GSK3β were measured by densitometry analysis (ImageJ software). n = 3. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. (C) Histogram showing enzymatic activity of acetylated and deacetylated GSK3α. Recombinant HA- GSK3α was immunoprecipitated from HeLa cells overexpressing pcDNA-HA-GSK3α using HA-coupled agarose beads. Immunoprecipitated HA-GSK3α was acetylated by p300 in the presence of Acetyl-CoA (Ac-CoA) in HAT buffer. Acetylated GSK3α was further deacetylated by Flag-SIRT2 immunoprecipitated from HEK 293 T cells overexpressing plasmid encoding Flag-tagged SIRT2-WT using agarose beads conjugated to anti-Flag antibody (Sigma A2220). The enzymatic activity of GSK3α was measured against glycogen synthase (GS)-peptide. n = 5. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. (D) Annotation of representative tandem mass spectra of trypsin-digested GSK3α, depicting K99, K246 acetylation. (E) Protein sequence alignment of the modeled region of GSK3α and the structure of GSK3β. (F) Cartoon, surface representation of the homology model of GSK3α (highlighted is the adenine nucleotide-binding pocket and position of K246 residue).
Figure 5 with 1 supplement
GSK3β is required for the anti-hypertrophic role of SIRT2 deacetylase.
(A) Western blotting analysis depicting the activity of GSK3 inhibitor X (GSK3-X). Neonatal rat cardiomyocytes were treated with vehicle or 500 nM GSK3-X for 48 hr and the activity of GSK3 was assessed by monitoring the phosphorylation of GS by specific antibody. (B) [3H]-leucine incorporation into total cellular protein of control (Ad-GFP) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated with either vehicle or 500 nM GSK3 inhibitor X (GSK3-X) for 48 hr. Cardiomyocytes were infected with adenoviral vectors encoding either GFP or SIRT2 for 24 hr prior to GSK3-X treatment. After the GSK3-X treatment, cardiomyocytes were stimulated with either vehicle or 20 µM ISO for 24 hr and the [3H]-leucine incorporation was monitored. c.p.m. counts per minute. n = 10. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. (C) Histogram showing quantification of relative cardiomyocyte area in control (Ad-Null) and SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated with either vehicle or 500 nM GSK3 inhibitor X (GSK3-X) for 48 hr. Cardiomyocytes were infected with adenoviral vectors encoding either control or SIRT2 for 24 hr prior to GSK3-X treatment. After the GSK3-X treatment, cardiomyocytes were stimulated with either vehicle or 20 µM ISO for 24 hr and the relative cardiomyocyte area is quantified as described in Materials and methods section. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. (D) Representative confocal images depicting perinuclear expression of ANP in control (Ad-Null) or SIRT2-overexpressing (Ad-SIRT2) cardiomyocytes treated with either vehicle or ISO (20 µM, 24 hr), with or without GSK3 inhibitor X (GSK3-X, 500 nM, 48 hr). Scale bar = 20 µm. ANP (Green), Myomesin (Red), Hoechst (Blue). (E) Western blotting analysis for puromycin incorporation in control or SIRT2-depleted (SIRT2-KD) neonatal rat cardiomyocytes infected with adenovirus expressing either control (Ad-luc shRNA) or p300 shRNA (Ad-p300-shRNA) 48 hr. p300 depletion was confirmed by western blotting. Pulse of puromycin was given 30 min prior to harvesting of cardiomyocytes and puromycin incorporation into nascent proteins was tested using anti-puromycin antibody. # marked Western images denotes SIRT2 antibody used in this assay detects single band. (F) Histogram showing relative puromycin levels in control or SIRT2-depleted (SIRT2-KD) cardiomyocytes infected with adenovirus expressing either control (Ad-luc shRNA) or p300 shRNA (Ad-p300-shRNA). The data is generated from Figure 5E. Signal intensities of puromycin and actin were measured by densitometry analysis using ImageJ software. n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. (G) Western blotting analysis of GSK3β acetylation and activity in heart lysates of vehicle or anacardic acid (p300 inhibitor) treated 9 months old WT and SIRT2-KO mice littermates. Anacardic acid was injected intraperitoneal at the dose of 5 mg/kg/day for 10 days in mice. Peanut oil was used as vehicle. GSK3β was immunoprecipitated from heart lysates of WT and SIRT2-KO mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology), and the affinity resin with protein A/G immobilized. Western blotting was performed to detect GSK3β acetylation by anti-Ac-Lysine antibody. GSK3β activity was measured by detecting the phosphorylation of GS. SIRT2 depletion was confirmed by western blotting. Whole cell lysates (WCL) was probed for indicated proteins by western blotting. (H) Histogram showing relative GSK3β acetylation in heart lysates of vehicle or anacardic acid (5 mg/kg/day for 10 days) treated 9 months old WT and SIRT2-KO mice from Figure 5G. n = 3. Signal intensities of GSK3β and acetylated-GSK3β was measured by densitometry analysis using ImageJ software. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. (I) Scatter plot depicting HW/TL ratio of 9 months old WT and SIRT2-KO mice treated with either vehicle or anacardic acid, (p300-INH), at the dose of 5 mg/kg/day for 10 days. n = 5 mice per group. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. (J) Scatter plot showing left ventricular posterior wall thickness of 9 months old WT and SIRT2-KO mice treated with either vehicle or anacardic acid (p300-INH), at the dose of 5 mg/kg/day for 10 days. n = 6–8 mice per group. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. (K) Scatter plot depicting cardiac contractile functions, as measured by ejection fraction of 9 months old WT and SIRT2-KO mice treated with either vehicle or anacardic acid (p300-INH), at the dose of 5 mg/kg/day for 10 days. n = 6–8 mice per group. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values.
Figure 5—figure supplement 1
GSK3 inhibition abrogates anti-hypertrophic role of SIRT2 deacetylase.
(A) Western blotting analysis to confirm the activity of LiCl. Neonatal rat cardiomyocytes were treated with 20 mM LiCl for 48 hr and the activity of GSK3β was assessed by monitoring the phosphorylation of p-GS. (B) [3H]-leucine incorporation into total cellular protein of control (Ad-GFP) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated either with vehicle or ISO (20 µM, 24 hr), with or without LiCl (20 mM, 48 hr). c.p.m. counts per minute. n = 10. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. (C) Histogram showing quantification of relative cardiomyocyte area in control (Ad-Null) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated either with vehicle or ISO (20 µM, 24 hr), with or without LiCl (20 mM, 48 hr). Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. (D) Representative confocal images depicting perinuclear expression ANP in control (Ad-Null) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated either with vehicle or ISO (20 µM, 24 hr), with or without 20 mM LiCl. Scale bar = 20 µm. α- Actinin (Green), ANP (Red) and Hoechst (Blue).
Author response image 1
Models of GSK3B and BIN2.
(A) Surface representation of the crystal structure of GSK3B (PDB ID 4NM0, blue) and the homology model of BIN2 (salmon), highlighted are the analogous acetylation sites. (B) Overlay of the crystal structure of GSK3B (PDB ID 4NM0, blue) and the model of BIN2 (salmon). (I) Representation of analogous acetylation sites K183 (GSK3B) and K167 (BIN2), K205 (GSK3B) and K189 (BIN2). (II) Side-chain interaction between the residue K205 and N213 in crystal structure of GSK3B (PDB ID 4NM0).
Tables
Key resources table
| Reagent type (species) or resources | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, A2:A128 strain background (Mus musculus, C57BL/6J) | Sirt2 knockout mice, JAX Stock #012772 - B6.129-Sirt2 < tm1.1Fwa>/J | Jackson Laboratories, USA | ||
| Strain, strain background (Mus musculus, 129/SvJ) | WT, JAX stock # 000691 | Jackson Laboratories, USA | ||
| Cell line (human) | HeLa | ATCC | ||
| Cell line (human) | HEK 293 | ATCC | ||
| Cell line (mouse) | GSK3β-KO fibroblasts | James Woodgett, Mount Sinai Hospital, Toronto, Canada | ||
| Strain, (Wistar rats) | WT | Central Animal Facility, Indian Institute of Science, India | P1-P2 pups used for primary cardiomyocytes culture | |
| Antibody | anti-GSK3β | Cell Signaling Technology | 9315 | 1:1000 diluted in 5% BSA |
| Antibody | anti-GSK3β | Santa Cruz Biotechnology | sc-9166 | 1:1000 diluted in 5% milk for Western blotting 1:200 diluted in 1% BSA for immuno-fluorescence |
| Antibody | anti-Acetylated-Lysine | Cell Signaling Technology | 9681 | 1:1000 diluted in 5% BSA |
| Antibody | anti-Acetylated-Lysine | Cell Signaling Technology | 9441 | 1:1000 diluted in 5% BSA |
| Antibody | anti-GSK3β Ser-9 | Cell Signaling Technology | 9336 | 1:1000 diluted in 5% BSA |
| Antibody | anti-GSK3β Tyr 279/216 | Merck Millipore | 05–413 | 1:250 diluted in 5% BSA |
| Antibody | anti-Phospho-β-Catenin | Cell Signaling Technology | 9561 | 1:2000 diluted in 5% BSA |
| Antibody | anti-β-Catenin | Cell Signaling Technology | 8480 | 1:1000 diluted in 5% BSA |
| Antibody | anti-SIRT2 | Sigma-Aldrich | S8447 | 1:2000 diluted in 5% BSA |
| Antibody | anti-SIRT2 | Merck Millipore | 09–843 | 1:1000 diluted in 5% BSA |
| Antibody | anti-SIRT2 | Cell Signaling Technology | 12650 | 1:1000 diluted in 5% BSA |
| Antibody | anti-ANP | Abcam | 14348 | 1:250 diluted in 5% BSA |
| Antibody | anti-ANP | Cloud-Clone Corporation | PAA225Ra03 | 1:200 diluted in 1% BSA |
| Antibody | anti-GAPDH | Santa Cruz Biotechnology | sc-25778 | 1:1000 diluted in 5% milk |
| Antibody | anti-p300 | Merck Millipore | 05–257 | 1:1000 diluted in 5% BSA for Western blotting, 1:200 diluted in 1% BSA for immuno-fluorescence |
| Antibody | anti-phospho-Glycogen Synthase | Merck Millipore | 07–817 | 1:1000 diluted in 5% BSA |
| Antibody | anti-Glycogen Synthase | Cell Signaling Technology | 3893 | 1:1000 diluted in 5% BSA |
| Antibody | anti-β -actin (HRP-conjugate) | Cell Signaling Technology | 12262 | 1:3000 diluted in 5% BSA |
| Antibody | anti-β -actin (HRP-conjugate) | Sigma-Aldrich | A3854 | 1:3000 diluted in 5% BSA |
| Antibody | anti-GSK3 α/β | Merck Millipore | 04–903 | 1:1000 diluted in 5% BSA |
| Antibody | anti-puromycin | Developmental Studies Hybridoma Bank | PMY-2A4 | 1:500 diluted in 5% BSA |
| Antibody | anti-NFATc2 | Thermo Fisher Scientific | MA1-025 | 1:100 diluted in 5% BSA |
| Antibody | anti-Flag | Sigma-Aldrich | F2555 | 1:2000 diluted in 5% BSA |
| Antibody | anti-α-Tubulin | Cell Signaling Technology | 2144 | 1:2000 diluted in 5% BSA |
| Antibody | anti-Acetyl-α-Tubulin (Lys40) | Cell Signaling Technology | 5335 | 1:1000 diluted in 5% BSA |
| Antibody | anti-SIRT1 | Santa Cruz Biotechnology | sc-15404 | 1:1000 diluted in 5% milk |
| Antibody | anti-SIRT3 | Cell Signaling Technology | 5490 | 1:1000 diluted in 5% BSA |
| Antibody | anti-SIRT4 | Cloud-Clone Corporation | PAE914Hu01 | 1:500 diluted in 5% BSA |
| Antibody | anti-SIRT5 | Cloud-Clone Corporation | PAE915Mu01 | 1:500 diluted in 5% BSA |
| Antibody | anti-SIRT6 | Cell Signaling Technology | 12486 | 1:1000 diluted in 5% BSA |
| Antibody | anti-SIRT7 | Cloud-Clone Corporation | PAE917Hu01 | 1:500 diluted in 5% BSA |
| Antibody | anti-HA | Sigma-Aldrich | H9658 | 1:2000 diluted in 5% BSA |
| Antibody | anti-HA | Santa Cruz Biotechnology | sc-805 | 1:100 diluted in 1% BSA for immuno-fluorescence |
| Antibody | anti-p300 | Merck Millipore | 05–257 | 1:1000 diluted in 5% BSA for Western, 1:100 diluted in1% BSA for immuno-fluorescence |
| Antibody | anti-SOD2 | Santa Cruz Biotechnology | sc-515068 | 1:200 diluted in 5% milk |
| Antibody | anti-α -Actinin | Sigma-Aldrich | A5044 | 1:200 diluted in 5% BSA |
| Antibody | Clean-Blot IP Detection Reagent | Thermo Fisher Scientific | 21230 | 1:2000–5000 diluted in 5% milk |
| Antibody | anti-rabbit HRP | Santa Cruz Biotechnology | sc-2004 | 1:5000 diluted in 1% milk |
| Antibody | anti-mouse HRP | Santa Cruz Biotechnology | sc-2005 | 1:5000 diluted in 1% milk |
| Antibody | anti-mouse HRP | Thermo Fisher Scientific | 31430 | 1:5000 diluted in 1% milk |
| Antibody | anti-rabbit HRP | Thermo Fisher Scientific | 31460 | 1:5000 diluted in 1% milk |
| Antibody | anti-rabbit IgG light chain HRP | Abcam | ab99697 | 1:5000 diluted in 1% milk |
| Antibody | Donkey anti-mouse, Alexa Fluor 488 | Thermo Fisher Scientific | A-21202 | 1:200 diluted in 5% BSA |
| Antibody | Goat anti-rabbit, Alexa Fluor 546 | Thermo Fisher Scientific | A-11035 | 1:200 diluted in 5% BSA |
| Antibody | Ni-NTA Agarose | Qiagen | 30230 | |
| Antibody | ANTI-FLAG M2 Affinity Agarose Gel | Sigma-Aldrich | A2220 | |
| Antibody | Glutathione Sepharose 4B | GE healthcare | 17-0756-01 | |
| Antibody | Monoclonal Anti-HA−Agarose antibody produced in mouse | Sigma-Aldrich | A2095 | |
| Antibody | Protein A/G Agarose | Santa Cruz Biotechnology | sc-2003 | |
| Transfected construct | pcDNA3 Flag HA | Addgene | Plasmid 10792 | 1436 pcDNA3 Flag HA plasmid DNA was a gift from William Sellers |
| Transfected construct (human) | HA GSK3 beta wt pcDNA3 | Addgene | Plasmid 14753 | PMID: 7715701 |
| Transfected construct (human) | HA GSK3 alpha wt | Modified Addgene, plasmid15896 | This paper | |
| Transfected construct (human) | HA GSK3 beta S9A pcDNA3 | Addgene | Plasmid 14754 | PMID: 7980435 |
| Transfected construct (human) | HA GSK3 beta K85A pcDNA3 | Addgene | Plasmid 14755 | HA GSK3 beta K85A pcDNA3 was a gift from Jim Woodgett |
| Transfected construct (human) | HA GSK3 beta K150Q pcDNA3 | Modified Addgene, plasmid14753 | This paper | For, caccggcagggtctgctgcgcgcggctataatg; Rev, cattatagccgcgcgcagcagaccctgccggtg; |
| Transfected construct (human) | HA GSK3 beta K150R pcDNA3 | Modified Addgene, plasmid 14754 | This paper | For, attatagccgcgcgagacagaccctgccg; Rev, cggcagggtctgtctcgcgcggctataat; |
| Transfected construct (human) | HA GSK3 beta K183Q pcDNA3 | Modified Addgene, plasmid 14755 | This paper | For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc; |
| Transfected construct (human) | HA GSK3 beta K183R pcDNA3 | Modified Addgene, plasmid14756 | This paper | For, aggttctgcggtctaatatcgcgatggcaaatgcca; Rev, tggcatttgccatcgcgatattagaccgcagaacct. |
| Transfected construct (human) | GST-GSK3β | This paper | ||
| Transfected construct (human) | HIS- GSK3β | This paper | ||
| Transfected construct (human) | HIS- GSK3β-K183R | This paper | ||
| Transfected construct (human) | HIS- GSK3β-K183Q | This paper | ||
| Transfected construct (human) | SIRT1 Flag | Addgene | Plasmid 13812 | PMID: 12620231 |
| Transfected construct (human) | SIRT2 Flag | Addgene | Plasmid 13813 | PMID: 12620231 |
| Transfected construct (human) | SIRT3 Flag | Addgene | Plasmid 13814 | PMID: 12620231 |
| Transfected construct (human) | SIRT4 Flag | Addgene | Plasmid 13815 | PMID: 12620231 |
| Transfected construct (human) | SIRT5 Flag | Addgene | Plasmid 13816 | PMID: 12620231 |
| Transfected construct (human) | SIRT6 Flag | Addgene | Plasmid 13817 | PMID: 12620231 |
| Transfected construct (human) | SIRT7 Flag | Addgene | Plasmid 13818 | PMID: 12620231 |
| Transfected construct (human) | SIRT2-H187Y Flag | Modified from Addgene, plasmid 13818 | For 5'atgtgtagaaggtgccatacgcctccaccaagtcc3'- Rev 5'ggacttggtggaggcgtatggcaccttctacacat3'. | |
| Infected construct (human) | Ad-Null | Vector Biolabs | Adenovirus 1300 | |
| Infected construct (human) | Ad-GFP | Vector Biolabs | Adenovirus 1060 | |
| Infected construct (human) | Ad-SIRT2 | Vector Biolabs | Adenovirus 1519 | |
| Infected construct (human) | Ad-h-EP300 | Vector Biolabs | Adenovirus ADV-207954 | |
| Infected construct (human) | Ad-luc-shRNA | B. Thimmapaya, Northwestern University, Chicago, IL, USA | PMID: 26667039 | |
| Infected construct (human) | Ad-h-EP300-shRNA | B. Thimmapaya, Northwestern University, Chicago, IL, USA | PMID: 26667039 | |
| Recombinant protein | p300 | Merck Millipore | 14–418 | http://dx.doi.org/10.1038/s41418-018-0069-8 |
| Sequence-based reagent | SMART pool: siGENOME Non-Targeting siRNA 1 | Dharmacon | D-001206-13-50 | 100 nM siRNA transfected by Lipofectamine RNAiMAX Transfection Reagent |
| Sequence-based reagent | SMART pool: siGENOME Rat Sirt2 siRNA | Dharmacon | M-082072-01-0010 | 100 nM SMARTpool siRNA transfected by Lipofectamine RNAiMAX Transfection Reagent |
| Commercial assay or kit | GSK-3 Activity Assay Kit | Sigma-Aldrich | CS0990 | PMID: 26667039 |
| Commercial assay or kit | QuikChange Site-Directed Mutagenesis Kit | Agilent Technologies | 200518 | PMID: 26667039 Sequences verified by sequencing, SciGenom Labs |
| Commercial assay or kit | GenElute HP Plasmid Midiprep Kit | Sigma-Aldrich | NA0200 | |
| Commercial assay or kit | GEnElute HP Plasmid Miniprep Kit | Sigma-Aldrich | PLN70 | |
| Commercial assay or kit | Qubit dsDNA HS assay kit | Thermo Fisher Scientific | Q32851 | PMID: 25871545 |
| Chemical compound, drug | Lipofectamine 2000 Transfection Reagent | Thermo Fisher Scientific | 11668019 | |
| Chemical compound, drug | Lipofectamine RNAiMAX Transfection Reagent | Thermo Fisher Scientific | 13778150 | |
| Chemical compound, drug | Horse serum, heat inactivated | Thermo Fisher Scientific | 26050088 | |
| Chemical compound, drug | Fetal Bovine Serum | Thermo Fisher Scientific | 10500064 | |
| Chemical compound, drug | Penicillin-Streptomycin | Thermo Fisher Scientific | 15070063 | |
| Chemical compound, drug | Gelatin, Type B | Sigma-Aldrich | G9382 | 0.2% w/v |
| Chemical compound, drug | D-glucose | Sigma-Aldrich | G8270 | 0.01 M prepared in PBS |
| Chemical compound, drug | Collagenase, Type II | Thermo Fisher Scientific | 17101015 | 0.4 mg/ml prepared in Trypsin-PBS-Glucose |
| Chemical compound, drug | Trypsin | Thermo Fisher Scientific | 15050057 | 0.2% prepared in PBS-Glucose |
| Chemical compound, drug | Trypsin-EDTA | Thermo Fisher Scientific | 25200056 | 0.1% prepared in PBS |
| Chemical compound, drug | Isoproterenol | Sigma-Aldrich | I6504 | https://doi.org/10.1172/JCI39162 |
| Chemical compound, drug | AGK2 | Cayman Chemical | 13145 | http://dx.doi.org/10.1038/s41418-018-0069-8 |
| Chemical compound, drug | Lithium chloride | Sigma-Aldrich | 203637 | PMID: 20926980 |
| Chemical compound, drug | GSK-3 Inhibitor X | Calbiochem | CAS 740841-15-0 - | PMID: 16984885 |
| Chemical compound, drug | Anacardic Acid | Cayman Chemical | CAS16611840 | PMID: 28513807 |
| Chemical compound, drug | Puromycin | VWR | J593 | |
| Chemical compound, drug | Fluoromount-G | Southern Biotech | 0100–01 | |
| Chemical compound, drug | Hoechst 33342 | Thermo Fisher Scientific | H3570 | |
| Chemical compound, drug | Dulbecco's Modified Eagle's Medium- High glucose | Sigma-Aldrich | D5648 | |
| Chemical compound, drug | Isoflurane | Sosrane Neon Laboratories Ltd | ||
| Chemical compound, drug | Nicotinamide | Sigma-Aldrich | N3376 | |
| Chemical compound, drug | Trichostatin A | Sigma-Aldrich | T8552 | |
| Chemical compound, drug | ProLong Gold Antifade Mounting medium with DAPI | Thermo Fisher Scientific | P36931 | |
| Chemical compound, drug | Acrylamide | Sigma-Aldrich | A9099 | |
| Chemical compound, drug | Tris | Sigma-Aldrich | T6066 | |
| Chemical compound, drug | Hydrochloric acid | Fischer Scientific | 29505 | |
| Chemical compound, drug | Sodium-dodecyl sulphate | VWR | 0227 | |
| Chemical compound, drug | Ammonium persulphate | Sigma-Aldrich | A3678 | |
| Chemical compound, drug | TEMED | Sigma-Aldrich | T7024 | |
| Chemical compound, drug | Sodium chloride | Merck Millipore | 106404 | |
| Chemical compound, drug | Triton X-100 | Sigma-Aldrich | T8787 | |
| Chemical compound, drug | EDTA | Sigma-Aldrich | E5134 | |
| Chemical compound, drug | EGTA | Sigma-Aldrich | 324626 | |
| Chemical compound, drug | sodium pyrophosphate | Sigma-Aldrich | 221368 | |
| Chemical compound, drug | sodium orthovanadate | Sigma-Aldrich | 450243 | |
| Chemical compound, drug | Tween-20 | Sigma-Aldrich | P9416 | |
| Chemical compound, drug | cOmplete, Mini Protease Inhibitor Cocktail | Sigma-Aldrich | 11836153001 ROCHE | |
| Chemical compound, drug | PMSF | Sigma-Aldrich | P7626 | |
| Chemical compound, drug | 2X Laemmli Sample Buffer | Bio-Rad | 161–0737 | |
| Chemical compound, drug | β-mercaptoethanol | VWR | 0482 | |
| Chemical compound, drug | DMSO | Sigma-Aldrich | D8418 | |
| Chemical compound, drug | Clarity ECL Western Blotting Substrate | BioRad | 5060 | |
| Chemical compound, drug | SuperSignal West Pico chemiluminescent Substrate | Thermo Fisher Scientific | 34080 | |
| Chemical compound, drug | IPTG | Sigma-Aldrich | I6758 | |
| Chemical compound, drug | Glycerol | PUREGENE | PG-4580 | |
| Chemical compound, drug | Sodium hydroxide | Sigma-Aldrich | 221465 | |
| Chemical compound, drug | Calcium chloride | Sisco Research Laboratories | 70650 | |
| Chemical compound, drug | formaldehyde solution | Sigma-Aldrich | F1635 | |
| Chemical compound, drug | Bovine serum albumin | HIMEDIA | MB083 | |
| Chemical compound, drug | Glycine | Fischer Scientific | 12835 | |
| Chemical compound, drug | Non-fat-milk | HIMEDIA | GRM1254 | |
| Chemical compound, drug | Methanol | Honeywell | 230–4 | |
| Chemical compound, drug | Bis-acrylamide | Sigma-Aldrich | M7279 | |
| Chemical compound, drug | Sodium deoxycholate | Sigma-Aldrich | D6750 | |
| Chemical compound, drug | Sodium bicarbonate | Sigma-Aldrich | S6014 | |
| Chemical compound, drug | Bio-Rad Protein Assay Dye Reagent Concentrate | Bio-Rad | 5000006 | |
| Chemical compound, drug | Ampicillin | VWR | 0339 | |
| Chemical compound, drug | Leucine-free minimal essential medium | Thermo fisher Scientific | 30030 | |
| Chemical compound, drug | DTT | Sigma-Aldrich | DTT-RO | |
| Chemical compound, drug | Sodium butyrate | Sigma-Aldrich | 567430 | |
| Chemical compound, drug | Magnesium chloride | Sigma-Aldrich | M8266 | |
| Chemical compound, drug | Sodium fluoride | Sigma-Aldrich | 450022 | |
| Chemical compound, drug | Glutathione-reduced | Sigma-Aldrich | G4251 | |
| Chemical compound, drug | Bromophenol blue | Sigma-Aldrich | B8026 | |
| Chemical compound, drug | HEPES | Sigma Aldrich | H3784 | |
| Chemical compound, drug | ATP | Cell Signaling Technology | 9804 | |
| Chemical compound, drug | γ−32P-ATP | Bhabha Atomic Research Centre, India | ||
| Chemical compound, drug | [3H]leucine | Amersham Biosciences | TRK510 | |
| Chemical compound, drug | NAD+ | Sigma Aldrich | NAD100-RO-Roche | |
| Equipment | VisualSonics high-frequency ultrasound system | Vevo 1100 | ||
| Equipment | SDS-PAGE Gel running apparatus | Bio-Rad | ||
| Equipment | Western blotting apparatus | Bio-Rad | ||
| Equipment | Scintillation counter | Beckman | ||
| Equipment | Chemiluminescence imager | Chemidoc Touch, Biorad, USA | ||
| Equipment | ThermoMixer C | Eppendorf | ||
| Equipment | Power-pack | Bio-Rad | ||
| Equipment | LSM 880 confocal microscope | Zeiss | ||
| Equipment | Tissue-culture ware | Eppendorf | ||
| Software, algorithm | GraphPad Prism 5 | GraphPad Software | ||
| Software, algorithm | QuickChange Primer Design | Agilent Genomics | ||
| Software, algorithm | ImageJ | National Institutes of Health | ||
| Software, algorithm | ZEN 5 | Zeiss | ||
| Software, algorithm | Image Lab | Bio-Rad | ||
| Software, algorithm | Mascot data explorer software | Matrix Science, London, United Kingdom | ||
| Software, algorithm | Scaffold_2.1.03 | Proteome Software, Inc., Portland, OR | ||
| Software, algorithm | Swiss-model tool | ExPASy web server | PMID:24782522 | |
| Software, algorithm | UCSF Chimera software package | Resource for Biocomputing, Visualization, and Informatics, NHI | PMID:15264254 | |
| Software, algorithm | GROMACS simulation package, version 5.0.4 | |||
| Software, algorithm | PyTMs plugin of PyMOL | https://doi.org/10.1186/s12859-014-0370-6 | ||
| Miscellaneous | Osmotic Minipumps | ALZET | Models 2002, 2001 | PMID: 19652361 |
| Miscellaneous | Cover-slip 18 mm | Blue Star Slides | ||
| Miscellaneous | PVDF membrane Amersham Hybond P | GE Healthcare | 10600023 | |
| Miscellaneous | Nitrocellulose paper | Biorad | ||
| Miscellaneous | Cell culture wares | Eppendorf | ||
| Miscellaneous | Sigma cell scraper | Sigma-Aldrich | SIAL0010 |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.32952.016
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation
eLife 7:e32952.
https://doi.org/10.7554/eLife.32952
