1. Developmental Biology
  2. Stem Cells and Regenerative Medicine

Cellular localization of the cell cycle inhibitor Cdkn1c controls growth arrest of adult skeletal muscle stem cells

  1. Despoina Mademtzoglou
  2. Yoko Asakura
  3. Matthew J Borok
  4. Sonia Alonso-Martin
  5. Philippos Mourikis
  6. Yusaku Kodaka
  7. Amrudha Mohan
  8. Atsushi Asakura  Is a corresponding author
  9. Frederic Relaix  Is a corresponding author
  1. IMRB U955-E10, F-94010, France
  2. Faculté de medecine, F-94000, Université Paris-Est Creteil, France
  3. University of Minnesota Medical School, United States
  4. Etablissement Français du Sang, France
  5. DHU Pepsy & Centre de Référence des Maladies Neuromusculaires GNMH, France
https://doi.org/10.7554/eLife.33337
Share this article
Cite this article
  1. Despoina Mademtzoglou
  2. Yoko Asakura
  3. Matthew J Borok
  4. Sonia Alonso-Martin
  5. Philippos Mourikis
  6. Yusaku Kodaka
  7. Amrudha Mohan
  8. Atsushi Asakura
  9. Frederic Relaix
(2018)
Cellular localization of the cell cycle inhibitor Cdkn1c controls growth arrest of adult skeletal muscle stem cells
eLife 7:e33337.
https://doi.org/10.7554/eLife.33337
  2. Download BibTeX
  3. Download .RIS
7 figures, 2 tables and 1 additional file

Figures

Figure 1 with 1 supplement
Download asset Open asset
Cdkn1c deficiency impairs normal muscle growth.

(A) Hematoxylin and Eosin (HE) and Sirius red staining of control (Ctrl) and Cdkn1c mutant (Cdkn1c-Mut) mouse Tibialis anterior (TA) muscles were performed to examine muscle histology, centrally …

https://doi.org/10.7554/eLife.33337.002
Figure 1—figure supplement 1
Download asset Open asset
Cdkn1c mutant mice display smaller body weight.

(A) A few Cdkn1c mutant (Cdkn1cM/-) mice survived postnatally in a mixed CD1;B6 background. (B–C) Body weight average of control (Ctrl) and Cdkn1c mutant male (B) and female (C) mice. (D) Forelimb …

https://doi.org/10.7554/eLife.33337.003
Figure 2 with 1 supplement
Download asset Open asset
CDKN1c deficiency delays muscle regeneration.

(A) Embryonic myosin (eMyHC)/LAMININ/DAPI, Hematoxylin and Eosin (HE), and Sirius red staining of twelve- to fifteen-week-old control (Ctrl) and Cdkn1c mutant mouse TA muscles were performed for …

https://doi.org/10.7554/eLife.33337.004
Figure 2—figure supplement 1
Download asset Open asset
Myoblasts in Cdkn1c mutant mice display delayed cell cycle exit during muscle regeneration.

(A) EdU (green)/MYOD (red)/DAPI (blue) staining of TA muscle sections of control (Ctrl) and Cdkn1c mutant (Cdkn1c-Mut) mice at day 3 after CTX injection. Arrows indicate EdU-MYOD+ differentiating …

https://doi.org/10.7554/eLife.33337.005
Figure 3 with 2 supplements
Download asset Open asset
Cdkn1c deficiency impairs myogenic differentiation.

(A) Time-course of tamoxifen (TMX) administration, muscle satellite cell harvest (FACS arrow) and culture (light gray bar for growth culture conditions, dark gray bar for differentiation culture …

https://doi.org/10.7554/eLife.33337.006
Figure 3—figure supplement 1
Download asset Open asset
Myogenic marker expression in proliferating myoblasts.

(A) Time-course of tamoxifen administration, muscle satellite cell harvest (FACS arrow) and culture. Analyzed animals were Pax7CreERT2/+; Cdkn1cFlox(m)/+;RosamTmG (Cdkn1c cKO) and Pax7CreERT2/+; …

https://doi.org/10.7554/eLife.33337.007
Figure 3—figure supplement 2
Download asset Open asset
Cdkn1c mutant myoblasts display increased proliferation and reduced differentiation.

(A) Control (Ctrl) and Cdkn1c mutant (Cdkn1c-Mut) primary myoblasts are positive for both PAX7 and MYOD. (B) Under growth conditions, EdU+ cells are significantly higher in Cdkn1c mutant primary …

https://doi.org/10.7554/eLife.33337.008
Figure 4 with 1 supplement
Download asset Open asset
MuSC-specific Cdkn1c ablation hinders muscle regeneration.

(A) Time-course of tamoxifen administration, intramuscular injury of TA muscle (CTX arrow), and muscle harvest (D7 arrow). (B–G) Cryosections of TA muscle were stained for histological and satellite …

https://doi.org/10.7554/eLife.33337.009
Figure 4—figure supplement 1
Download asset Open asset
In vivo MuSC-specific Cdkn1c ablation.
https://doi.org/10.7554/eLife.33337.010
Figure 5 with 1 supplement
Download asset Open asset
Cdkn1c cytoplasmic expression after satellite cell activation.

(A) Satellite-cell-derived myoblasts (T24–T48) of single EDL myofibers stained with PAX7 (green) and CDKN1c (red). Arrowheads indicate PAX7+ cells. (B) Satellite cell-derived myoblasts of single EDL …

https://doi.org/10.7554/eLife.33337.011
Figure 5—figure supplement 1
Download asset Open asset
Cdkn1c is not expressed in quiescent satellite cells.

(A) Muscle satellite cells (MuSCs; T0) stained with PAX7 (green) and Cdkn1c (red) in single myofiber cultures of EDL muscles. (B) Cdkn1c (red) presence in TA muscle section. MuSCs were marked with …

https://doi.org/10.7554/eLife.33337.012
Figure 6 with 2 supplements
Download asset Open asset
Cdkn1c expression and subcellular localization during satellite cell activation and differentiation.

(A–D) Immunofluorescence for PAX7 (A; green), MYOD (B; green), MYOGENIN (C; green) or KI67 (D; green) and Cdkn1c (red) at T72 in single myofiber cultures of EDL muscles and quantification of PAX7+ (A…

https://doi.org/10.7554/eLife.33337.013
Figure 6—figure supplement 1
Download asset Open asset
Lack of CDKN1c binding in myogenic regulatory regions.

Chromatin immunoprecipitation followed by qPCR on C2C12 myogenic cells 4 days after differentiation induction. Enrichment was evaluated in myogenic regions that have previously been shown to be …

https://doi.org/10.7554/eLife.33337.014
Figure 6—figure supplement 2
Download asset Open asset
Uncoupling of cell cycle exit and differentiation.

(A) Time-course of single myofiber culture, transduction of activated myoblasts with virus, and readouts. (B–D) Quantification of transduced (CFP+) myoblasts that were differentiating, as evaluated …

https://doi.org/10.7554/eLife.33337.015
Author response image 1
Download asset Open asset
Quantification of M-cadherin+ MuSCs in regenerating muscle of wildtype littermate (Wt; Pax7+;Cdkn1c+), Cre control (Pax7CreERT2), and Cdkn1c cKO (Pax7CreERT2;Cdkn1cFlox) mice at D7 post-cardiotoxin injection.
https://doi.org/10.7554/eLife.33337.019

Tables

Key resources table
Reagent type (species)
or resource		DesignationSource or referenceIdentifiersAdditional information
Strain, strain background
(M. musculus)		Cdkn1ctm1SjeThe Jackson Laboratory;
PMID: 9144284		MGI: J40203,
RRID:IMSR_JAX:003336
Strain, strain background
(M. musculus)		p57floxPMID: 28196404Mouse line generated by the
group of F.Relaix and
characterized in
Mademtzoglou et al. (2017);
Genesis 55(4) doi:
10.1002/dvg.23025
Strain, strain background
(M. musculus)		Pax7CreERT2/+The Jackson Laboratory;
PMID: 19554048		MGI: J:150962;
RRID:IMSR_JAX:012476		Mouse line obtained
from C.M. Fan
Strain, strain background
(M. musculus)		RosamTmGThe Jackson Laboratory;
PMID: 17868096		MGI: J:124702;
RRID:IMSR_JAX:007576
Genetic reagent (synthetic)pGEMT-Easy vectorPromegaA1360
Cell line (Homo sapiens)293TDSMZACC635;
RRID:CVCL_0063		https://www.dsmz.de/catalogues/details/culture/ACC-635.html?tx_dsmzresources_pi5%5BreturnPid%5D=192
Cell line (M. musculus)C2C12American Type Culture
Collection (ATCC);
PMID: 28966089		CRL-1772;
RRID: CVCL_0188		Cell line maintained
in E. Gomes lab
Antibodyanti-CD31-PE (monoclonal)eBiosciences12-0311-81;
RRID:AB_465631
Antibodyanti-CD45-PE (monoclonal)eBiosciences12-0451-81;
RRID:AB_465667
Antibodyanti-embryonic MyHC
(mouse monoclonal)		DSHBF1.652;
RRID:AB_528358
Antibodyanti-embryonic MyHC
(mouse monoclonal)		Santa Cruzsc53091;
RRID:AB_670121
Antibodyanti-GFP (chicken
polyclonal)		Abcamab13970;
RRID:AB_300798
Antibodyanti-integrin a-biotin
(mouse)		Miltenyi Biotec130-101-979;
RRID:AB_2652472
Antibodyanti-IgG (rabbit)DiagenodeC15410206
Antibodyanti-KI67 (mouse
monoclonal)		BD Pharmingen556003;
RRID:AB_396287
Antibodyanti-Laminin (rabbit
polyclonal)		Sigma-AldrichL9393;
RRID:AB_477163
Antibodyanti-Laminin (rat
monoclonal)		Sigma-Aldrich4H8-2;
RRID:AB_784266
Antibodyanti-Laminin (rabbit
polyclonal)		Novus BiologicalNB300-144AF647
Antibodyanti-MyHC (mouse
monoclonal)		DSHBmf20-c;
RRID:AB_2147781
Antibodyanti-MyoD (mouse
monoclonal)		DAKOM3512;
RRID:AB_2148874
Antibodyanti-MyoD (rabbit
polyclonal)		Santa Cruzsc-760;
RRID:AB_2148870
Antibodyanti-Myogenin
(mouse monoclonal)		DSHBF5D;
RRID:AB_2146602
Antibodyanti-p57 (goat polyclonal)Santa Cruzsc1039;
RRID:AB_2078158
Antibodyanti-p57 (mouse
monoclonal)		Santa Cruzsc56431;
RRID:AB_2298043
Antibodyanti-p57 (rabbit
polyclonal)		Santa Cruzsc8298;
RRID:AB_2078155
Antibodyanti-Pax7 (mouse
monoclonal)		DSHBPAX7-c;
RRID:AB_528428
Antibodyanti-Sca-1-PE (mouse)eBiosciences12-5981-81;
RRID:AB_466085
Antibodyfab fragment affinity-
purified antibody (goat)		Jackson ImmunoResearch115-007-003
Sequence-based reagentAGGGCATATCC
AACAACAAACTT		EurogentecN/AqPCR HPRT (Forward primer)
Sequence-based reagentGTTAAGCAGTA
CAGCCCCAAA		EurogentecN/AqPCR HPRT (Reverse primer)
Sequence-based reagentCTGAAGGACCA
GCCTCTCTC		EurogentecN/AqPCR p57 (Forward primer)
Sequence-based reagentAAGAAGTCGTT
CGCATTGGC		EurogentecN/AqPCR p57 (Reverse primer)
Sequence-based reagentATCTGAGGTCA
GCCATTTGGT		EurogentecN/AChIP qPCR Mef2a
(Forward primer)
Sequence-based reagentGCTAAGGACAG
CTGTGACCTG		EurogentecN/AChIP qPCR Mef2a
(Reverse primer)
Sequence-based reagentTTAAAGACATGTG
GCAACAGACTAC		EurogentecN/AChIP qPCR Lmn2b
(Forward primer)
Sequence-based reagentTGCTCTTTCTGTA
CTGTGTGGTG		EurogentecN/AChIP qPCR Lmn2b
(Reverse primer)
Sequence-based reagentGGAGTGATTGA
GGTGGACAGA		EurogentecN/AChIP qPCR Lincmd1
(Forward primer)
Sequence-based reagentCTCTCCCACCTG
TTTGTGTCTT		EurogentecN/AChIP qPCR Lincmd1
(Reverse primer)
Sequence-based reagentAATTACAGCCG
ACGGCCTCC		EurogentecN/AChIP qPCR Myogenin
(Forward primer)
Sequence-based reagentCCAACGCCACA
GAAACCTGA		EurogentecN/AChIP qPCR Myogenin
(Reverse primer)
Sequence-based reagentCAGCTCCTTG
CCCTGTGAAA		EurogentecN/AChIP qPCR Desmin-proximal
(Forward primer)
Sequence-based reagentTGTAGCCCTCC
TGACATCAC		EurogentecN/AChIP qPCR Desmin proximal
(Reverse primer)
Sequence-based reagentCCAAAAGGG
CCGATGAGGAA		EurogentecN/AChIP qPCR Desmin distal
(Forward primer)
Sequence-based reagentTAGAGACAGA
CCAGTGGCGG		EurogentecN/AChIP qPCR Desmin distal
(Reverse primer)
Commercial assay or kitLightCycler 480 SYBR
Green I Master		Roche-Sigma-Aldrich04887352001
Commercial assay or kitiDeal ChIP-seq kitDiagenodeC01010051
Commercial assay or kitRNasy Micro KitQIAGEN74004
Commercial assay or kitTranscriptor First Strand
cDNA Synthesis Kit		Roche-Sigma-Aldrich4379012001
Chemical compound, drugbFGFPeprotech450–3320 ng/ml
Chemical compound, drugbFGFThermo Fisher ScientificPHG026320 ng/ml
Chemical compound, drugBovine serum
albumin (BSA)		Jackson ImmunoResearch100016200.2%
Chemical compound, drugCardiotoxinLatoxanL810210 µM
Chemical compound, drugCardiotoxinSigma-Aldrich217503–1 mg10 µM
Chemical compound, drugChicken embryo extractMP-Biomedical928501450.5%
Chemical compound, drugChicken embryo extractSeralabCE-650-J1%
Chemical compound, drugcollagenBD Biosciences354236culture dish coating
Chemical compound, drugCollagenase type ISigma-AldrichC01300.2%
Chemical compound, drugCollagenase type IWorthington Biochemical Corp9001-12-1
Chemical compound, drugCollagenase ARoche-Sigma-Aldrich110887930010.2% w/v
Chemical compound, drugDAPI (4’,6-diamidino-2-
phenylindole
dihydrochloride)		Thermo Fisher ScientificD1306
Chemical compound, drugDispase IIRoche-Sigma-Aldrich49420780012.4 U/ml
Chemical compound, drugDNaseIRoche-Sigma-Aldrich1128493200110 ng/mL
Chemical compound, drugDulbecco’s Modified
Eagle’s Medium (DMEM)		Thermo Fisher Scientific41966single myofiber culture
Chemical compound, drugDMEM with GlutaMAXThermo Fisher Scientific61965myoblast culture
Chemical compound, drugEdUThermo Fisher ScientificC103402 μM
Chemical compound, drugF-10 Ham's mediaSigma-AldrichN6635N/A
Chemical compound, drugFetal bovine serum (FBS)Thermo Fisher Scientific1027020%
Chemical compound, drugFetal calf serum (FCS)EurobioCVFSVF00-0110% (prol/tion medium),
2% (diff/tion medium)
Chemical compound, drugFluoromount-GSouthern Biotech0100–01
Chemical compound, drugHanks' Balanced
Salt Solution (HBSS)		Thermo Fisher Scientific14025
Chemical compound, drugHepesThermo Fisher Scientific156300.1M
Chemical compound, drugHorse serumThermo Fisher Scientific260500885% (coating), 10% (culture)
Chemical compound, drugL-glutamineThermo Fisher Scientific2503020 mM
Chemical compound, drugmatrigelCorning Life Sciences3542301:20 in DMEM
Chemical compound, drugPenicillin/streptomycinLife Technologies151401X
Chemical compound, drugPyruvateThermo Fisher Scientific1136010 mM
Software, algorithmPhotoshop CS5https://www.adobe.com/products/photoshop.htmlRRID:SCR_014199
Other (anti-biotin beads)anti-biotin beadsMiltenyi Biotec130-090-485;
RRID:AB_244365		MACS
Other (anti-PE beads)anti-PE beadsMiltenyi Biotec130-048-801;
RRID:AB_244373		MACS
Other (chamber slides)chamber slideNalge Nunc International177445myoblast culture
Other (culture plates)petri dishSigma-AldrichZ692301single myofiber culture
Other (LD column)LD columnMiltenyi Biotec130-042-901MACS
Other (MS column)MS columnMiltenyi Biotec130-042-201MACS
Other (grip strength meter)grip strength meterColumbus Instruments1027CSM-D54
Table 1
Sequences of primers used for the ChIP-qPCR.
https://doi.org/10.7554/eLife.33337.016
Regulated gene/regionForward primerReverse primer
Mef2aATCTGAGGTCAGCCATTTGGTGCTAAGGACAGCTGTGACCTG
Lmn2bTTAAAGACATGTGGCAACAGACTACTGCTCTTTCTGTACTGTGTGGTG
Lincmd1GGAGTGATTGAGGTGGACAGACTCTCCCACCTGTTTGTGTCTT
MyogeninAATTACAGCCGACGGCCTCCCCAACGCCACAGAAACCTGA
Desmin (proximal)CAGCTCCTTGCCCTGTGAAATGTAGCCCTCCTGACATCAC
Desmin (distal)CCAAAAGGGCCGATGAGGAATAGAGACAGACCAGTGGCGG

Additional files

Transparent reporting form
https://doi.org/10.7554/eLife.33337.017

Download links