1. Developmental Biology
  2. Stem Cells and Regenerative Medicine
Download icon

Cellular localization of the cell cycle inhibitor Cdkn1c controls growth arrest of adult skeletal muscle stem cells

  1. Despoina Mademtzoglou
  2. Yoko Asakura
  3. Matthew J Borok
  4. Sonia Alonso-Martin
  5. Philippos Mourikis
  6. Yusaku Kodaka
  7. Amrudha Mohan
  8. Atsushi Asakura  Is a corresponding author
  9. Frederic Relaix  Is a corresponding author
  1. IMRB U955-E10, F-94010, France
  2. Faculté de medecine, F-94000, Université Paris-Est Creteil, France
  3. University of Minnesota Medical School, United States
  4. Etablissement Français du Sang, France
  5. DHU Pepsy & Centre de Référence des Maladies Neuromusculaires GNMH, France
Research Article
Cite this article as: eLife 2018;7:e33337 doi: 10.7554/eLife.33337
7 figures, 2 tables and 1 additional file

Figures

Figure 1 with 1 supplement
Cdkn1c deficiency impairs normal muscle growth.

(A) Hematoxylin and Eosin (HE) and Sirius red staining of control (Ctrl) and Cdkn1c mutant (Cdkn1c-Mut) mouse Tibialis anterior (TA) muscles were performed to examine muscle histology, centrally located nucleated myofibers, and fibrosis. Scale bars, 100 μm. (B) Histogram showing the average of myofiber diameters (μm). (C) Histogram of average fibrotic area per TA muscle. (D) Fiber size (μm) distribution in control and Cdkn1c mutant mice. (E) Histogram of number of fibers with centrally located nuclei. (F) PAX7+ (green) MuSCs (arrows) on the myofibers isolated from EDL muscles of Cdkn1c mutant and control mice. MYOD (red) is not normally expressed in PAX7+ MuSCs at T0 (quiescence). DAPI (blue) shows all nuclei. Scale bars, 50 μm. (G) Numbers of PAX7+ satellite cells on the myofibers isolated from EDL. (H) Ratio of MYOD+ activated cells per PAX7+ MuSC on the myofibers isolated from EDL muscles of Cdkn1c mutant and control mice. (I) Immunofluorescence for PAX7 (green) and MYOD (red) at T72 in single myofiber cultures. Arrows and arrowheads show PAX7+MYOD- quiescent satellite cells and PAX7-MYOD+ differentiating cells, respectively. Scale bars, 50 μm. (J) Quantification of ratios of PAX7+ and MYOD+ cells per fiber at T72. Nuclei were counter-stained with DAPI. *p≤0.05, **p≤0.01.

https://doi.org/10.7554/eLife.33337.002
Figure 1—figure supplement 1
Cdkn1c mutant mice display smaller body weight.

(A) A few Cdkn1c mutant (Cdkn1cM/-) mice survived postnatally in a mixed CD1;B6 background. (B–C) Body weight average of control (Ctrl) and Cdkn1c mutant male (B) and female (C) mice. (D) Forelimb grip strength normalized for body weight control and Cdkn1c mutant mice. *p≤0.05, **p≤0.01.

https://doi.org/10.7554/eLife.33337.003
Figure 2 with 1 supplement
CDKN1c deficiency delays muscle regeneration.

(A) Embryonic myosin (eMyHC)/LAMININ/DAPI, Hematoxylin and Eosin (HE), and Sirius red staining of twelve- to fifteen-week-old control (Ctrl) and Cdkn1c mutant mouse TA muscles were performed for histological and fibrosis characterization 4, 7 or thirty days after cardiotoxin (CTX) injection. Scale bars, 100 μm. (B) Fiber size (μm) distribution in control (Ctrl) and Cdkn1c mutant (Cdkn1c-Mut) mice 7 (upper panel) or thirty (lower panel) days after CTX injection. (C) Histogram of average embryonic MyHC+ fiber diameters (μm) 4 days after CTX injection. (D) Histogram of average fiber diameters (μm) 7 and thirty days after CTX injection. (E) Fiber size (μm) distribution in control and Cdkn1c mutant mice thirty days after CTX injection. (F) Histogram of average fibrotic area per TA muscle. (G) PAX7+ (green) MuSCs (arrows) on the myofibers isolated from EDL muscles of Cdkn1c mutant and control mice thirty days after CTX injection. MYOD (red) is occasionally expressed in PAX7+ MuSCs (arrow heads). DAPI (blue) shows all nuclei. Scale bars, 50 μm. (H) Numbers of PAX7+ MuSCs on the EDL isolated myofibers . (I) Ratio of MYOD+ activated cells per PAX7+ MuSC on the myofibers isolated from EDL muscles of Cdkn1c mutant and control mice. Nuclei were counter-stained with DAPI. Scale bars, 100 μm. *p≤0.05, **p≤0.01.

https://doi.org/10.7554/eLife.33337.004
Figure 2—figure supplement 1
Myoblasts in Cdkn1c mutant mice display delayed cell cycle exit during muscle regeneration.

(A) EdU (green)/MYOD (red)/DAPI (blue) staining of TA muscle sections of control (Ctrl) and Cdkn1c mutant (Cdkn1c-Mut) mice at day 3 after CTX injection. Arrows indicate EdU-MYOD+ differentiating myoblasts. (B) Graph shows EdU±/MYOD ± cell ratio. (C) EdU (green)/PAX7 (red)/LAMININ (white)/DAPI (blue) staining of TA muscle sections of control (Ctrl) and Cdkn1c mutant (Cdkn1c-Mut) mice at day thirty after CTX injection. EdU+ or PAX7 + cells are indicated by green and red arrows, respectively. (D) Graph shows EdU±/PAX7± cell ratio per 1 mm2 section area. Scale bar, 50 μm. *p≤0.05 and **p≤0.01.

https://doi.org/10.7554/eLife.33337.005
Figure 3 with 2 supplements
Cdkn1c deficiency impairs myogenic differentiation.

(A) Time-course of tamoxifen (TMX) administration, muscle satellite cell harvest (FACS arrow) and culture (light gray bar for growth culture conditions, dark gray bar for differentiation culture conditions). Analyzed animals were Pax7CreERT2/+; Cdkn1cFlox(m)/+;RosamTmG (Cdkn1c cKO) and Pax7CreERT2/+; Cdkn1c+/+;RosamTmG (control; Ctrl); maternal inheritance of the imprinted Cdkn1c is indicated by superscript (m). (B) Cdkn1c transcript levels of control and Cdkn1c cKO myoblast cultures 3 days post-differentiation. ND; not detected. (C–D) Control (C) and Cdkn1c cKO (D) myoblast cultures were examined for CDKN1c protein (red) following three days under differentiation conditions. (E–N) Control and Cdkn1c cKO myoblast cultures were examined for EdU+ (light blue) cells (E, G, H), KI67+ cells (F), MYOGENIN+ cells (green; I, K, L), and myotube formation (J, M, N). Nascent myotubes were marked with myosin heavy chain (MyHC; green; M, N). Nuclei were counter-stained with DAPI (blue). Graphs show quantification of EdU and KI67 expression under growth conditions (E, F), MYOGENIN expression following 24 hr under differentiation conditions (I), and MyHC+ cells following 72 hr under differentiation conditions (J). Data show mean +SD, n = 3 animals. Asterisks indicate significance; *p≤0.05, ***p≤0.001. Scale bars, 40 μm (C, K), 1000 μm (G, M).

https://doi.org/10.7554/eLife.33337.006
Figure 3—figure supplement 1
Myogenic marker expression in proliferating myoblasts.

(A) Time-course of tamoxifen administration, muscle satellite cell harvest (FACS arrow) and culture. Analyzed animals were Pax7CreERT2/+; Cdkn1cFlox(m)/+;RosamTmG (Cdkn1c cKO) and Pax7CreERT2/+; Cdkn1c+/+;RosamTmG (control; Ctrl); maternal inheritance of the imprinted Cdkn1c is indicated by superscript (m). (B–D) Control and Cdkn1c cKO myoblast cultures were examined for PAX7 (B), MYOD (C), and MYOGENIN (D) expression in the EdU+ fraction, following 2-hr incubation with 2 μM EdU prior to cell fixation. Data show mean +SD, n = 3 animals. Asterisks indicate significance; *p≤0.05.

https://doi.org/10.7554/eLife.33337.007
Figure 3—figure supplement 2
Cdkn1c mutant myoblasts display increased proliferation and reduced differentiation.

(A) Control (Ctrl) and Cdkn1c mutant (Cdkn1c-Mut) primary myoblasts are positive for both PAX7 and MYOD. (B) Under growth conditions, EdU+ cells are significantly higher in Cdkn1c mutant primary myoblasts compared with control cells. By contrast, there is no difference for MyHC+ differentiating cells. (C) Under differentiation conditions, Cdkn1c mutant primary myoblasts display reduced differentiation kinetics detected by MyHC in both day 1 and 3. However, in day 5, myogenic differentiation is almost saturated in both control and Cdkn1c mutant primary myoblasts. Nuclei were counter-stained with DAPI. Scale bars, 50 μm. *p≤0.05, **p≤0.01.

https://doi.org/10.7554/eLife.33337.008
Figure 4 with 1 supplement
MuSC-specific Cdkn1c ablation hinders muscle regeneration.

(A) Time-course of tamoxifen administration, intramuscular injury of TA muscle (CTX arrow), and muscle harvest (D7 arrow). (B–G) Cryosections of TA muscle were stained for histological and satellite cell population characterization 7 days after CTX injection. Analyzed animals at (B-G) were wild-type littermates (Wt; Pax7+; Cdkn1c+; B–G), Cre control (Pax7CreERT2; B’–G’), and Cdkn1c cKO (Pax7CreERT2; Cdkn1cFlox; B’’–G’’). (B) HE staining for histologic characterization of the muscles. (C) Oil Red O staining for evaluation of fat infiltration of the muscles. (D–E) embryonic myosin (eMYHC, red)/LAMININ (LAM, green) immunofluorescence to mark newly formed myofibers post-regeneration. (F–G) PAX7 (red)/LAMININ (LAM, green) immunofluorescence to mark PAX7+ satellite cells. Nuclei in (D-G) were counter-stained with DAPI (blue). Scale bars, 50 μm. (H) Quantification of (F-G). Data show mean +SD, n ≥ 5 animals. Asterisks indicate significance; **p≤0.01.

https://doi.org/10.7554/eLife.33337.009
Figure 4—figure supplement 1
In vivo MuSC-specific Cdkn1c ablation.
https://doi.org/10.7554/eLife.33337.010
Figure 5 with 1 supplement
Cdkn1c cytoplasmic expression after satellite cell activation.

(A) Satellite-cell-derived myoblasts (T24–T48) of single EDL myofibers stained with PAX7 (green) and CDKN1c (red). Arrowheads indicate PAX7+ cells. (B) Satellite cell-derived myoblasts of single EDL myofibers stained with MYOD (green) and CDKN1c (red). Arrowheads indicate MYOD+ cells. Nuclei were counter-stained with DAPI. n ≥ 3. Scale bars, 40 μm. (C) CDKN1c (red) staining of TA muscle at 3 (D3) or t (D13) days after CTX injection. Asterisks indicate regions with cytoplasmic CDKN1c. # indicates central nuclei of newly formed fibers during muscle regeneration. Nuclei were counter-stained with DAPI. Scale bars, 20 μm.

https://doi.org/10.7554/eLife.33337.011
Figure 5—figure supplement 1
Cdkn1c is not expressed in quiescent satellite cells.

(A) Muscle satellite cells (MuSCs; T0) stained with PAX7 (green) and Cdkn1c (red) in single myofiber cultures of EDL muscles. (B) Cdkn1c (red) presence in TA muscle section. MuSCs were marked with PAX7 (green) and fibers were outlined with LAMININ (gray). Arrowheads indicate Cdkn1c + cells. Asterisks indicate satellite cells. Nuclei were counter-stained with DAPI. Scale bars, 40 μm.

https://doi.org/10.7554/eLife.33337.012
Figure 6 with 2 supplements
Cdkn1c expression and subcellular localization during satellite cell activation and differentiation.

(A–D) Immunofluorescence for PAX7 (A; green), MYOD (B; green), MYOGENIN (C; green) or KI67 (D; green) and Cdkn1c (red) at T72 in single myofiber cultures of EDL muscles and quantification of PAX7+ (A), MYOD+ (B), MYOGENIN+ (C) or KI67+ (D) cells that co-expressed CDKN1c over the time-course of the culture. Cytoplasmic (light blue) or nuclear (dark blue) localization of CDKN1c is indicated in the graphs. Scale bars, 40 μm. (E) Immunofluorescence for Cyant fluorescent protein (CFP, green), KI67 (purple), and CDKN1c (red) in transduced (i.e. CFP+) myoblasts at T72 in single myofiber cultures. Fibers were transduced with empty retroviruses (control; left panel), retroviruses expressing full-length Cdkn1c (Cdkn1c FL; middle panel) or Nuclear localization signal-deficient Cdkn1c (Cdkn1c–NLS; right panel). (F) Quantification of transduced (CFP+) myoblasts that were proliferating (KI67+). Nuclei were counter-stained with DAPI (blue). Scale bars, 20 μm. Data show mean +SD, n ≥ 3 animals, 20–32 fibers/animal. *p≤0.05 compared to control virus.

https://doi.org/10.7554/eLife.33337.013
Figure 6—figure supplement 1
Lack of CDKN1c binding in myogenic regulatory regions.

Chromatin immunoprecipitation followed by qPCR on C2C12 myogenic cells 4 days after differentiation induction. Enrichment was evaluated in myogenic regions that have previously been shown to be MYOD-regulated by the ChIP-sequencing study of Cao et al. (2010).

https://doi.org/10.7554/eLife.33337.014
Figure 6—figure supplement 2
Uncoupling of cell cycle exit and differentiation.

(A) Time-course of single myofiber culture, transduction of activated myoblasts with virus, and readouts. (B–D) Quantification of transduced (CFP+) myoblasts that were differentiating, as evaluated by expression of MYOGENIN at T48 (B) and T72 (C) or MYOD (T72; D). Data show mean +SD, n = 3 animals, 20–30 fibers/animal. *p≤0.05 compared to control virus. (E) Time-course of tamoxifen administration, muscle satellite cell harvest (FACS arrow) and culture, transduction of activated myoblasts with virus, and readouts. (F–G) Quantification of transduced (CFP+) myoblasts that were proliferating (KI67+; F) or differentiating (MYOGENIN+; G). Data show mean +SD, n = 3 animals. *p≤0.05. (A–G) Myoblasts were transduced with empty retroviruses (control), retroviruses expressing full-length Cdkn1c (Cdkn1c FL) or Nuclear localization signal-deficient Cdkn1c (Cdkn1c–NLS). Analyzed animals in (A-D) were wild-type C57BL/6. Analyzed animals in (E-G) were Pax7CreERT2/+; Cdkn1cFlox(m)/+;RosamTmG (Cdkn1c cKO); maternal inheritance of the imprinted Cdkn1c is indicated by superscript (m).

https://doi.org/10.7554/eLife.33337.015
Author response image 1
Quantification of M-cadherin+ MuSCs in regenerating muscle of wildtype littermate (Wt; Pax7+;Cdkn1c+), Cre control (Pax7CreERT2), and Cdkn1c cKO (Pax7CreERT2;Cdkn1cFlox) mice at D7 post-cardiotoxin injection.
https://doi.org/10.7554/eLife.33337.019

Tables

Key resources table
Reagent type (species)
or resource
DesignationSource or referenceIdentifiersAdditional information
Strain, strain background
(M. musculus)
Cdkn1ctm1SjeThe Jackson Laboratory;
PMID: 9144284
MGI: J40203,
RRID:IMSR_JAX:003336
Strain, strain background
(M. musculus)
p57floxPMID: 28196404Mouse line generated by the
group of F.Relaix and
characterized in
Mademtzoglou et al. (2017);
Genesis 55(4) doi:
10.1002/dvg.23025
Strain, strain background
(M. musculus)
Pax7CreERT2/+The Jackson Laboratory;
PMID: 19554048
MGI: J:150962;
RRID:IMSR_JAX:012476
Mouse line obtained
from C.M. Fan
Strain, strain background
(M. musculus)
RosamTmGThe Jackson Laboratory;
PMID: 17868096
MGI: J:124702;
RRID:IMSR_JAX:007576
Genetic reagent (synthetic)pGEMT-Easy vectorPromegaA1360
Cell line (Homo sapiens)293TDSMZACC635;
RRID:CVCL_0063
https://www.dsmz.de/catalogues/details/culture/ACC-635.html?tx_dsmzresources_pi5%5BreturnPid%5D=192
Cell line (M. musculus)C2C12American Type Culture
Collection (ATCC);
PMID: 28966089
CRL-1772;
RRID: CVCL_0188
Cell line maintained
in E. Gomes lab
Antibodyanti-CD31-PE (monoclonal)eBiosciences12-0311-81;
RRID:AB_465631
Antibodyanti-CD45-PE (monoclonal)eBiosciences12-0451-81;
RRID:AB_465667
Antibodyanti-embryonic MyHC
(mouse monoclonal)
DSHBF1.652;
RRID:AB_528358
Antibodyanti-embryonic MyHC
(mouse monoclonal)
Santa Cruzsc53091;
RRID:AB_670121
Antibodyanti-GFP (chicken
polyclonal)
Abcamab13970;
RRID:AB_300798
Antibodyanti-integrin a-biotin
(mouse)
Miltenyi Biotec130-101-979;
RRID:AB_2652472
Antibodyanti-IgG (rabbit)DiagenodeC15410206
Antibodyanti-KI67 (mouse
monoclonal)
BD Pharmingen556003;
RRID:AB_396287
Antibodyanti-Laminin (rabbit
polyclonal)
Sigma-AldrichL9393;
RRID:AB_477163
Antibodyanti-Laminin (rat
monoclonal)
Sigma-Aldrich4H8-2;
RRID:AB_784266
Antibodyanti-Laminin (rabbit
polyclonal)
Novus BiologicalNB300-144AF647
Antibodyanti-MyHC (mouse
monoclonal)
DSHBmf20-c;
RRID:AB_2147781
Antibodyanti-MyoD (mouse
monoclonal)
DAKOM3512;
RRID:AB_2148874
Antibodyanti-MyoD (rabbit
polyclonal)
Santa Cruzsc-760;
RRID:AB_2148870
Antibodyanti-Myogenin
(mouse monoclonal)
DSHBF5D;
RRID:AB_2146602
Antibodyanti-p57 (goat polyclonal)Santa Cruzsc1039;
RRID:AB_2078158
Antibodyanti-p57 (mouse
monoclonal)
Santa Cruzsc56431;
RRID:AB_2298043
Antibodyanti-p57 (rabbit
polyclonal)
Santa Cruzsc8298;
RRID:AB_2078155
Antibodyanti-Pax7 (mouse
monoclonal)
DSHBPAX7-c;
RRID:AB_528428
Antibodyanti-Sca-1-PE (mouse)eBiosciences12-5981-81;
RRID:AB_466085
Antibodyfab fragment affinity-
purified antibody (goat)
Jackson ImmunoResearch115-007-003
Sequence-based reagentAGGGCATATCC
AACAACAAACTT
EurogentecN/AqPCR HPRT (Forward primer)
Sequence-based reagentGTTAAGCAGTA
CAGCCCCAAA
EurogentecN/AqPCR HPRT (Reverse primer)
Sequence-based reagentCTGAAGGACCA
GCCTCTCTC
EurogentecN/AqPCR p57 (Forward primer)
Sequence-based reagentAAGAAGTCGTT
CGCATTGGC
EurogentecN/AqPCR p57 (Reverse primer)
Sequence-based reagentATCTGAGGTCA
GCCATTTGGT
EurogentecN/AChIP qPCR Mef2a
(Forward primer)
Sequence-based reagentGCTAAGGACAG
CTGTGACCTG
EurogentecN/AChIP qPCR Mef2a
(Reverse primer)
Sequence-based reagentTTAAAGACATGTG
GCAACAGACTAC
EurogentecN/AChIP qPCR Lmn2b
(Forward primer)
Sequence-based reagentTGCTCTTTCTGTA
CTGTGTGGTG
EurogentecN/AChIP qPCR Lmn2b
(Reverse primer)
Sequence-based reagentGGAGTGATTGA
GGTGGACAGA
EurogentecN/AChIP qPCR Lincmd1
(Forward primer)
Sequence-based reagentCTCTCCCACCTG
TTTGTGTCTT
EurogentecN/AChIP qPCR Lincmd1
(Reverse primer)
Sequence-based reagentAATTACAGCCG
ACGGCCTCC
EurogentecN/AChIP qPCR Myogenin
(Forward primer)
Sequence-based reagentCCAACGCCACA
GAAACCTGA
EurogentecN/AChIP qPCR Myogenin
(Reverse primer)
Sequence-based reagentCAGCTCCTTG
CCCTGTGAAA
EurogentecN/AChIP qPCR Desmin-proximal
(Forward primer)
Sequence-based reagentTGTAGCCCTCC
TGACATCAC
EurogentecN/AChIP qPCR Desmin proximal
(Reverse primer)
Sequence-based reagentCCAAAAGGG
CCGATGAGGAA
EurogentecN/AChIP qPCR Desmin distal
(Forward primer)
Sequence-based reagentTAGAGACAGA
CCAGTGGCGG
EurogentecN/AChIP qPCR Desmin distal
(Reverse primer)
Commercial assay or kitLightCycler 480 SYBR
Green I Master
Roche-Sigma-Aldrich04887352001
Commercial assay or kitiDeal ChIP-seq kitDiagenodeC01010051
Commercial assay or kitRNasy Micro KitQIAGEN74004
Commercial assay or kitTranscriptor First Strand
cDNA Synthesis Kit
Roche-Sigma-Aldrich4379012001
Chemical compound, drugbFGFPeprotech450–3320 ng/ml
Chemical compound, drugbFGFThermo Fisher ScientificPHG026320 ng/ml
Chemical compound, drugBovine serum
albumin (BSA)
Jackson ImmunoResearch100016200.2%
Chemical compound, drugCardiotoxinLatoxanL810210 µM
Chemical compound, drugCardiotoxinSigma-Aldrich217503–1 mg10 µM
Chemical compound, drugChicken embryo extractMP-Biomedical928501450.5%
Chemical compound, drugChicken embryo extractSeralabCE-650-J1%
Chemical compound, drugcollagenBD Biosciences354236culture dish coating
Chemical compound, drugCollagenase type ISigma-AldrichC01300.2%
Chemical compound, drugCollagenase type IWorthington Biochemical Corp9001-12-1
Chemical compound, drugCollagenase ARoche-Sigma-Aldrich110887930010.2% w/v
Chemical compound, drugDAPI (4’,6-diamidino-2-
phenylindole
dihydrochloride)
Thermo Fisher ScientificD1306
Chemical compound, drugDispase IIRoche-Sigma-Aldrich49420780012.4 U/ml
Chemical compound, drugDNaseIRoche-Sigma-Aldrich1128493200110 ng/mL
Chemical compound, drugDulbecco’s Modified
Eagle’s Medium (DMEM)
Thermo Fisher Scientific41966single myofiber culture
Chemical compound, drugDMEM with GlutaMAXThermo Fisher Scientific61965myoblast culture
Chemical compound, drugEdUThermo Fisher ScientificC103402 μM
Chemical compound, drugF-10 Ham's mediaSigma-AldrichN6635N/A
Chemical compound, drugFetal bovine serum (FBS)Thermo Fisher Scientific1027020%
Chemical compound, drugFetal calf serum (FCS)EurobioCVFSVF00-0110% (prol/tion medium),
2% (diff/tion medium)
Chemical compound, drugFluoromount-GSouthern Biotech0100–01
Chemical compound, drugHanks' Balanced
Salt Solution (HBSS)
Thermo Fisher Scientific14025
Chemical compound, drugHepesThermo Fisher Scientific156300.1M
Chemical compound, drugHorse serumThermo Fisher Scientific260500885% (coating), 10% (culture)
Chemical compound, drugL-glutamineThermo Fisher Scientific2503020 mM
Chemical compound, drugmatrigelCorning Life Sciences3542301:20 in DMEM
Chemical compound, drugPenicillin/streptomycinLife Technologies151401X
Chemical compound, drugPyruvateThermo Fisher Scientific1136010 mM
Software, algorithmPhotoshop CS5https://www.adobe.com/products/photoshop.htmlRRID:SCR_014199
Other (anti-biotin beads)anti-biotin beadsMiltenyi Biotec130-090-485;
RRID:AB_244365
MACS
Other (anti-PE beads)anti-PE beadsMiltenyi Biotec130-048-801;
RRID:AB_244373
MACS
Other (chamber slides)chamber slideNalge Nunc International177445myoblast culture
Other (culture plates)petri dishSigma-AldrichZ692301single myofiber culture
Other (LD column)LD columnMiltenyi Biotec130-042-901MACS
Other (MS column)MS columnMiltenyi Biotec130-042-201MACS
Other (grip strength meter)grip strength meterColumbus Instruments1027CSM-D54
Table 1
Sequences of primers used for the ChIP-qPCR.
https://doi.org/10.7554/eLife.33337.016
Regulated gene/regionForward primerReverse primer
Mef2aATCTGAGGTCAGCCATTTGGTGCTAAGGACAGCTGTGACCTG
Lmn2bTTAAAGACATGTGGCAACAGACTACTGCTCTTTCTGTACTGTGTGGTG
Lincmd1GGAGTGATTGAGGTGGACAGACTCTCCCACCTGTTTGTGTCTT
MyogeninAATTACAGCCGACGGCCTCCCCAACGCCACAGAAACCTGA
Desmin (proximal)CAGCTCCTTGCCCTGTGAAATGTAGCCCTCCTGACATCAC
Desmin (distal)CCAAAAGGGCCGATGAGGAATAGAGACAGACCAGTGGCGG

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)