(A) Hematoxylin and Eosin (HE) and Sirius red staining of control (Ctrl) and Cdkn1c mutant (Cdkn1c-Mut) mouse Tibialis anterior (TA) muscles were performed to examine muscle histology, centrally …
(A) A few Cdkn1c mutant (Cdkn1cM/-) mice survived postnatally in a mixed CD1;B6 background. (B–C) Body weight average of control (Ctrl) and Cdkn1c mutant male (B) and female (C) mice. (D) Forelimb …
(A) Embryonic myosin (eMyHC)/LAMININ/DAPI, Hematoxylin and Eosin (HE), and Sirius red staining of twelve- to fifteen-week-old control (Ctrl) and Cdkn1c mutant mouse TA muscles were performed for …
(A) EdU (green)/MYOD (red)/DAPI (blue) staining of TA muscle sections of control (Ctrl) and Cdkn1c mutant (Cdkn1c-Mut) mice at day 3 after CTX injection. Arrows indicate EdU-MYOD+ differentiating …
(A) Time-course of tamoxifen (TMX) administration, muscle satellite cell harvest (FACS arrow) and culture (light gray bar for growth culture conditions, dark gray bar for differentiation culture …
(A) Time-course of tamoxifen administration, muscle satellite cell harvest (FACS arrow) and culture. Analyzed animals were Pax7CreERT2/+; Cdkn1cFlox(m)/+;RosamTmG (Cdkn1c cKO) and Pax7CreERT2/+; …
(A) Control (Ctrl) and Cdkn1c mutant (Cdkn1c-Mut) primary myoblasts are positive for both PAX7 and MYOD. (B) Under growth conditions, EdU+ cells are significantly higher in Cdkn1c mutant primary …
(A) Time-course of tamoxifen administration, intramuscular injury of TA muscle (CTX arrow), and muscle harvest (D7 arrow). (B–G) Cryosections of TA muscle were stained for histological and satellite …
(A) Satellite-cell-derived myoblasts (T24–T48) of single EDL myofibers stained with PAX7 (green) and CDKN1c (red). Arrowheads indicate PAX7+ cells. (B) Satellite cell-derived myoblasts of single EDL …
(A) Muscle satellite cells (MuSCs; T0) stained with PAX7 (green) and Cdkn1c (red) in single myofiber cultures of EDL muscles. (B) Cdkn1c (red) presence in TA muscle section. MuSCs were marked with …
(A–D) Immunofluorescence for PAX7 (A; green), MYOD (B; green), MYOGENIN (C; green) or KI67 (D; green) and Cdkn1c (red) at T72 in single myofiber cultures of EDL muscles and quantification of PAX7+ (A…
Chromatin immunoprecipitation followed by qPCR on C2C12 myogenic cells 4 days after differentiation induction. Enrichment was evaluated in myogenic regions that have previously been shown to be …
(A) Time-course of single myofiber culture, transduction of activated myoblasts with virus, and readouts. (B–D) Quantification of transduced (CFP+) myoblasts that were differentiating, as evaluated …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain, strain background (M. musculus) | Cdkn1ctm1Sje | The Jackson Laboratory; PMID: 9144284 | MGI: J40203, RRID:IMSR_JAX:003336 | |
Strain, strain background (M. musculus) | p57flox | PMID: 28196404 | Mouse line generated by the group of F.Relaix and characterized in Mademtzoglou et al. (2017); Genesis 55(4) doi: 10.1002/dvg.23025 | |
Strain, strain background (M. musculus) | Pax7CreERT2/+ | The Jackson Laboratory; PMID: 19554048 | MGI: J:150962; RRID:IMSR_JAX:012476 | Mouse line obtained from C.M. Fan |
Strain, strain background (M. musculus) | RosamTmG | The Jackson Laboratory; PMID: 17868096 | MGI: J:124702; RRID:IMSR_JAX:007576 | |
Genetic reagent (synthetic) | pGEMT-Easy vector | Promega | A1360 | |
Cell line (Homo sapiens) | 293T | DSMZ | ACC635; RRID:CVCL_0063 | https://www.dsmz.de/catalogues/details/culture/ACC-635.html?tx_dsmzresources_pi5%5BreturnPid%5D=192 |
Cell line (M. musculus) | C2C12 | American Type Culture Collection (ATCC); PMID: 28966089 | CRL-1772; RRID: CVCL_0188 | Cell line maintained in E. Gomes lab |
Antibody | anti-CD31-PE (monoclonal) | eBiosciences | 12-0311-81; RRID:AB_465631 | |
Antibody | anti-CD45-PE (monoclonal) | eBiosciences | 12-0451-81; RRID:AB_465667 | |
Antibody | anti-embryonic MyHC (mouse monoclonal) | DSHB | F1.652; RRID:AB_528358 | |
Antibody | anti-embryonic MyHC (mouse monoclonal) | Santa Cruz | sc53091; RRID:AB_670121 | |
Antibody | anti-GFP (chicken polyclonal) | Abcam | ab13970; RRID:AB_300798 | |
Antibody | anti-integrin a-biotin (mouse) | Miltenyi Biotec | 130-101-979; RRID:AB_2652472 | |
Antibody | anti-IgG (rabbit) | Diagenode | C15410206 | |
Antibody | anti-KI67 (mouse monoclonal) | BD Pharmingen | 556003; RRID:AB_396287 | |
Antibody | anti-Laminin (rabbit polyclonal) | Sigma-Aldrich | L9393; RRID:AB_477163 | |
Antibody | anti-Laminin (rat monoclonal) | Sigma-Aldrich | 4H8-2; RRID:AB_784266 | |
Antibody | anti-Laminin (rabbit polyclonal) | Novus Biological | NB300-144AF647 | |
Antibody | anti-MyHC (mouse monoclonal) | DSHB | mf20-c; RRID:AB_2147781 | |
Antibody | anti-MyoD (mouse monoclonal) | DAKO | M3512; RRID:AB_2148874 | |
Antibody | anti-MyoD (rabbit polyclonal) | Santa Cruz | sc-760; RRID:AB_2148870 | |
Antibody | anti-Myogenin (mouse monoclonal) | DSHB | F5D; RRID:AB_2146602 | |
Antibody | anti-p57 (goat polyclonal) | Santa Cruz | sc1039; RRID:AB_2078158 | |
Antibody | anti-p57 (mouse monoclonal) | Santa Cruz | sc56431; RRID:AB_2298043 | |
Antibody | anti-p57 (rabbit polyclonal) | Santa Cruz | sc8298; RRID:AB_2078155 | |
Antibody | anti-Pax7 (mouse monoclonal) | DSHB | PAX7-c; RRID:AB_528428 | |
Antibody | anti-Sca-1-PE (mouse) | eBiosciences | 12-5981-81; RRID:AB_466085 | |
Antibody | fab fragment affinity- purified antibody (goat) | Jackson ImmunoResearch | 115-007-003 | |
Sequence-based reagent | AGGGCATATCC AACAACAAACTT | Eurogentec | N/A | qPCR HPRT (Forward primer) |
Sequence-based reagent | GTTAAGCAGTA CAGCCCCAAA | Eurogentec | N/A | qPCR HPRT (Reverse primer) |
Sequence-based reagent | CTGAAGGACCA GCCTCTCTC | Eurogentec | N/A | qPCR p57 (Forward primer) |
Sequence-based reagent | AAGAAGTCGTT CGCATTGGC | Eurogentec | N/A | qPCR p57 (Reverse primer) |
Sequence-based reagent | ATCTGAGGTCA GCCATTTGGT | Eurogentec | N/A | ChIP qPCR Mef2a (Forward primer) |
Sequence-based reagent | GCTAAGGACAG CTGTGACCTG | Eurogentec | N/A | ChIP qPCR Mef2a (Reverse primer) |
Sequence-based reagent | TTAAAGACATGTG GCAACAGACTAC | Eurogentec | N/A | ChIP qPCR Lmn2b (Forward primer) |
Sequence-based reagent | TGCTCTTTCTGTA CTGTGTGGTG | Eurogentec | N/A | ChIP qPCR Lmn2b (Reverse primer) |
Sequence-based reagent | GGAGTGATTGA GGTGGACAGA | Eurogentec | N/A | ChIP qPCR Lincmd1 (Forward primer) |
Sequence-based reagent | CTCTCCCACCTG TTTGTGTCTT | Eurogentec | N/A | ChIP qPCR Lincmd1 (Reverse primer) |
Sequence-based reagent | AATTACAGCCG ACGGCCTCC | Eurogentec | N/A | ChIP qPCR Myogenin (Forward primer) |
Sequence-based reagent | CCAACGCCACA GAAACCTGA | Eurogentec | N/A | ChIP qPCR Myogenin (Reverse primer) |
Sequence-based reagent | CAGCTCCTTG CCCTGTGAAA | Eurogentec | N/A | ChIP qPCR Desmin-proximal (Forward primer) |
Sequence-based reagent | TGTAGCCCTCC TGACATCAC | Eurogentec | N/A | ChIP qPCR Desmin proximal (Reverse primer) |
Sequence-based reagent | CCAAAAGGG CCGATGAGGAA | Eurogentec | N/A | ChIP qPCR Desmin distal (Forward primer) |
Sequence-based reagent | TAGAGACAGA CCAGTGGCGG | Eurogentec | N/A | ChIP qPCR Desmin distal (Reverse primer) |
Commercial assay or kit | LightCycler 480 SYBR Green I Master | Roche-Sigma-Aldrich | 04887352001 | |
Commercial assay or kit | iDeal ChIP-seq kit | Diagenode | C01010051 | |
Commercial assay or kit | RNasy Micro Kit | QIAGEN | 74004 | |
Commercial assay or kit | Transcriptor First Strand cDNA Synthesis Kit | Roche-Sigma-Aldrich | 4379012001 | |
Chemical compound, drug | bFGF | Peprotech | 450–33 | 20 ng/ml |
Chemical compound, drug | bFGF | Thermo Fisher Scientific | PHG0263 | 20 ng/ml |
Chemical compound, drug | Bovine serum albumin (BSA) | Jackson ImmunoResearch | 10001620 | 0.2% |
Chemical compound, drug | Cardiotoxin | Latoxan | L8102 | 10 µM |
Chemical compound, drug | Cardiotoxin | Sigma-Aldrich | 217503–1 mg | 10 µM |
Chemical compound, drug | Chicken embryo extract | MP-Biomedical | 92850145 | 0.5% |
Chemical compound, drug | Chicken embryo extract | Seralab | CE-650-J | 1% |
Chemical compound, drug | collagen | BD Biosciences | 354236 | culture dish coating |
Chemical compound, drug | Collagenase type I | Sigma-Aldrich | C0130 | 0.2% |
Chemical compound, drug | Collagenase type I | Worthington Biochemical Corp | 9001-12-1 | |
Chemical compound, drug | Collagenase A | Roche-Sigma-Aldrich | 11088793001 | 0.2% w/v |
Chemical compound, drug | DAPI (4’,6-diamidino-2- phenylindole dihydrochloride) | Thermo Fisher Scientific | D1306 | |
Chemical compound, drug | Dispase II | Roche-Sigma-Aldrich | 4942078001 | 2.4 U/ml |
Chemical compound, drug | DNaseI | Roche-Sigma-Aldrich | 11284932001 | 10 ng/mL |
Chemical compound, drug | Dulbecco’s Modified Eagle’s Medium (DMEM) | Thermo Fisher Scientific | 41966 | single myofiber culture |
Chemical compound, drug | DMEM with GlutaMAX | Thermo Fisher Scientific | 61965 | myoblast culture |
Chemical compound, drug | EdU | Thermo Fisher Scientific | C10340 | 2 μM |
Chemical compound, drug | F-10 Ham's media | Sigma-Aldrich | N6635 | N/A |
Chemical compound, drug | Fetal bovine serum (FBS) | Thermo Fisher Scientific | 10270 | 20% |
Chemical compound, drug | Fetal calf serum (FCS) | Eurobio | CVFSVF00-01 | 10% (prol/tion medium), 2% (diff/tion medium) |
Chemical compound, drug | Fluoromount-G | Southern Biotech | 0100–01 | |
Chemical compound, drug | Hanks' Balanced Salt Solution (HBSS) | Thermo Fisher Scientific | 14025 | |
Chemical compound, drug | Hepes | Thermo Fisher Scientific | 15630 | 0.1M |
Chemical compound, drug | Horse serum | Thermo Fisher Scientific | 26050088 | 5% (coating), 10% (culture) |
Chemical compound, drug | L-glutamine | Thermo Fisher Scientific | 25030 | 20 mM |
Chemical compound, drug | matrigel | Corning Life Sciences | 354230 | 1:20 in DMEM |
Chemical compound, drug | Penicillin/streptomycin | Life Technologies | 15140 | 1X |
Chemical compound, drug | Pyruvate | Thermo Fisher Scientific | 11360 | 10 mM |
Software, algorithm | Photoshop CS5 | https://www.adobe.com/products/photoshop.html | RRID:SCR_014199 | |
Other (anti-biotin beads) | anti-biotin beads | Miltenyi Biotec | 130-090-485; RRID:AB_244365 | MACS |
Other (anti-PE beads) | anti-PE beads | Miltenyi Biotec | 130-048-801; RRID:AB_244373 | MACS |
Other (chamber slides) | chamber slide | Nalge Nunc International | 177445 | myoblast culture |
Other (culture plates) | petri dish | Sigma-Aldrich | Z692301 | single myofiber culture |
Other (LD column) | LD column | Miltenyi Biotec | 130-042-901 | MACS |
Other (MS column) | MS column | Miltenyi Biotec | 130-042-201 | MACS |
Other (grip strength meter) | grip strength meter | Columbus Instruments | 1027CSM-D54 |
Regulated gene/region | Forward primer | Reverse primer |
---|---|---|
Mef2a | ATCTGAGGTCAGCCATTTGGT | GCTAAGGACAGCTGTGACCTG |
Lmn2b | TTAAAGACATGTGGCAACAGACTAC | TGCTCTTTCTGTACTGTGTGGTG |
Lincmd1 | GGAGTGATTGAGGTGGACAGA | CTCTCCCACCTGTTTGTGTCTT |
Myogenin | AATTACAGCCGACGGCCTCC | CCAACGCCACAGAAACCTGA |
Desmin (proximal) | CAGCTCCTTGCCCTGTGAAA | TGTAGCCCTCCTGACATCAC |
Desmin (distal) | CCAAAAGGGCCGATGAGGAA | TAGAGACAGACCAGTGGCGG |