1. Biochemistry and Chemical Biology
  2. Structural Biology and Molecular Biophysics
Download icon

Synthetic single domain antibodies for the conformational trapping of membrane proteins

  1. Iwan Zimmermann
  2. Pascal Egloff
  3. Cedric AJ Hutter
  4. Fabian M Arnold
  5. Peter Stohler
  6. Nicolas Bocquet
  7. Melanie N Hug
  8. Sylwia Huber
  9. Martin Siegrist
  10. Lisa Hetemann
  11. Jennifer Gera
  12. Samira Gmür
  13. Peter Spies
  14. Daniel Gygax
  15. Eric R Geertsma  Is a corresponding author
  16. Roger JP Dawson  Is a corresponding author
  17. Markus A Seeger  Is a corresponding author
  1. University of Zurich, Switzerland
  2. Therapeutic Modalities, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd, Switzerland
  3. University of Applied Sciences and Arts Northwestern Switzerland, Switzerland
  4. Goethe University Frankfurt, Germany
Tools and Resources
Cite this article as: eLife 2018;7:e34317 doi: 10.7554/eLife.34317
6 figures, 7 tables, 3 data sets and 1 additional file

Figures

Figure 1 with 6 supplements
Selection of sybodies against membrane proteins within three weeks.

(A) Three synthetic libraries exhibiting highly variable randomized surfaces (concave, loop and convex) each harboring a diversity of 9 × 1012 were designed based on thermostabilized nanobody frameworks. CDR1, CDR2 and CDR3 are colored in yellow, orange and red, respectively. (B) The in vitro selection platform is built as a selection cascade, starting with 1012 sybodies displayed on ribosomes for pre-enrichment, followed by a focused phage display library of 107 clones and binder identification by ELISA (typically 96 clones). The platform builds on fragment exchange (FX) cloning using Type IIS restriction sites encoded on the phage display (pDX_init) and expression vector (pSb_init) backbones, which generate AGT and GCA sticky ends for PCR-free subcloning. Key elements for reliable selections against membrane proteins are the shape variability of the sybody libraries, exceptionally high experimental diversities using ribosome display and the change of display system during the selection process.

https://doi.org/10.7554/eLife.34317.002
Figure 1—figure supplement 1
Variable sybody scaffolds based on three camelid nanobodies.

CDR1, CDR2 and CDR3 are colored in yellow, orange and red, respectively. In the left panel, crystal structures of camlid nanobodies in complex with GFP (PDB: 3K1K) (A), a GPCR (PDB: 3P0G) (B) and Lysozyme (PDB: 1ZVH) (C) are shown, which served as starting point to delineate scaffolds for randomization. Nanobody residues contacting the target proteins are depicted as sticks. The target proteins are colored in blue. In the middle panel, homology models of three framework nanobodies are shown as cartoons and randomized residues (defined as serines and threonines in these examples) are highlighted as sticks. The three sybody libraries exhibit a concave (A), loop (B) or convex (C) binding surface, respectively. The right panel shows the randomized surface of the three libraries with the side chains of the randomized positions highlighted in color. Note that the concave library contains randomized residues outside of the CDR regions, which are colored in purple.

https://doi.org/10.7554/eLife.34317.003
Figure 1—figure supplement 2
Framework sequences and randomized positions.

(A and B) Sequences of the framework sybodies are aligned with the sequences of their natural precursors. The frameworks of the concave and the loop library are identical (A) while the convex library has its own scaffold (B). Residues of the natural precursor nanobodies differing from the framework sequence are marked in blue. The three CDR regions are underlined. Invariant CDR residues contributing to the hydrophobic core of the respective scaffold are marked in green. Note that the differently shaped libraries exhibit alternative sets of invariant CDR residues that precisely match the corresponding scaffolds. This harmonization is a critical and unprecedented feature of our synthetic nanobdy libraries, as it allows for the first time to include variable CDR lengths without the risk of scaffold destabilization. Randomized residues are highlighted as red S (for which randomization mixture one was used), as red T (mix 2) and orange T (mix 3). (C) Amino acid composition of randomized positions obtained by three different trinucleotide randomization mixtures. The rationale behind the three randomization mixtures is provided in the main text.

https://doi.org/10.7554/eLife.34317.004
Figure 1—figure supplement 3
Biophysical characterization of sybodies.

Three framework sybodies representing the concave, the loop and the convex library and containing serines and threonines in the randomized positions were generated by gene synthesis (sequences provided in Figure 1—figure supplement 2). (A) SEC analysis of periplasmatically expressed concave, loop and convex framework sybodies using a Superdex 75 300/10 GL column. (B) Determination of melting temperature (Tm) of framework sybodies and their natural precursors 3K1K and 1ZVH using dye SYPRO Orange (ThermoFluor). Representative data of two technical replicates are shown.

https://doi.org/10.7554/eLife.34317.005
Figure 1—figure supplement 4
Ribosome display of single domain antibodies.

(A) The non-randomized convex sybody was either purified containing a C-terminal 3x-FLAG tag or displayed on ribosomes containing the same tag using the commercial kit PUREfrexSS (GeneFrontier). 3C protease cleavage was used to liberate the displayed sybody from the ribosomal complex. Western blotting analysis using anti-3x-FLAG antibody and purified sybody as standard revealed a display efficiency of 82% of input mRNA for ribosome display. (B) 106 mRNA molecules encoding the GFP-specific 3K1K nanobody were displayed on ribosomes using PUREfrexSS together with 1012 mRNA molecules encoding the non-randomized convex sybody. The ribosomal complexes were pulled down using either biotinylated GFP or MBP immobilized on magnetic beads. The mRNA of isolated ribosomal complexes was isolated, reverse transcribed and the resulting cDNA was analyzed by qPCR performing technical triplicates. This analysis revealed that 84.6 ± 3.5% (error corresponds to standard deviation) of the input 3K1K mRNA was retrieved on GFP-coated beads, while virtually no background binding of the non-randomized convex sybody nor 3K1K binding to MBP was observed.

https://doi.org/10.7554/eLife.34317.006
Figure 1—figure supplement 5
FX cloning vector series for phage display and purification of sybodies and nanobodies.

Sybody pools from ribosome display (or nanobodies from immunized camelids) are amplified with primers containing restriction sites of Type IIS enzyme BspQI (isoschizomer of SapI) to generate AGT and GCA overhangs. BspQI restriction sites generating the same overhangs were introduced into the backbones of vector pDX_init for phage display and pSb_init for periplasmatic expression and attachment of Myc- and His-tag. Note that in pDX_init and pSb_init the BspQI restriction sites are part of the sybody open reading frame. Finally, sybodies/nanobodies are sub-cloned from pSb_init to the destiny vectors pBXNPH3 or pBXNPHM3 for periplasmic expression. Tag-less sybodies/nanobodies for structural biology purposes can be obtained by 3C protease cleavage. Importantly, the vector series permits for PCR-free subcloning once the sybodies have been inserted into phage display vector pDX_init. The vectors were made available through Addgene (for Addgene IDs, see Table 3).

https://doi.org/10.7554/eLife.34317.007
Figure 1—figure supplement 6
Improvement of the sybody selection procedure.

(A) Three rounds of ribosome display using the same type of magnetic beads for target immobilization (Dynabeads Myone Streptavidin T1) failed to generate sybodies against ABC transporter TM287/288. Pool enrichment against TM287/288 compared to negative control AcrB was poor. No positive ELISA hits were identified. (B) Sybody selections against TM287/288 were performed applying one round of ribosome display followed by two rounds of phage display using Dynabeads Myone Streptavidin T1 for target immobilization. The pool was enriched approximately 30 fold and a few positive ELISA hits were found. Purification of identified sybodies failed. (C) Sybody selections against ABC transporter IrtAB, a homologue of TM287/288 sharing a sequence identity of 27%, was performed as in (B), but using different immobilization chemistries (Dynabeads Myone Streptavidin T1 for ribosome display, Maxisorp microtiter plates for the first phage display round and Dynabeads Myone Streptavidin C1 for the second phage display round) to suppress accumulation of background binders. Strong enrichment was observed and a high number of positive ELISA hits were identified. Only 27% of positive ELISA hits were unique sybodies with moderate affinities. (D) Final optimized sybody selection protocol as described in the materials and methods section. Diversity bottlenecks were removed by using Taq DNA polymerase for cDNA amplification and increasing the working volume of the first phage display round. An off-rate selection step was introduced in the second phage display round. Enrichment and number of ELISA hits was similar to the selection shown in (C). The number of unique ELISA hits increased to 83% and high affinity binders were obtained. The binders obtained in (D) against TM287/288 are described in detail in main Figures 3 and 4.

https://doi.org/10.7554/eLife.34317.008
Figure 2 with 4 supplements
Structural and biochemical characterization of convex sybody Sb_MBP#1.

(A) Crystal structure of the Sb_MBP#1/MBP complex. MBP is shown as blue surface, the convex sybody Sb_MBP#1 is shown as grey cartoon with CDRs 1–3 colored in yellow, orange and red, respectively. Sybody residues mediating contacts to MBP are shown as sticks. (B) Maltose and sybody Sb_MBP#1 compete for binding to MBP. In the depicted Schild analysis, the sybody affinity ratios determined in the presence (KD’) and absence (KD) of maltose is plotted against the maltose concentration. The binding affinity for maltose KD,maltose was determined as 1.0 µM. The allosteric constant α amounts to 0.017, that is the ratio KD’/KD saturates at a value of 58.

https://doi.org/10.7554/eLife.34317.011
Figure 2—figure supplement 1
Sybody selections against MBP.

(A) Sybodies were selected against MBP using three rounds of ribosome display and MBP immobilized on magnetic beads. Sybodies were expressed in pSb_init and analyzed by ELISA. (B) Binder enrichment was monitored using qPCR by comparing the cDNA output after panning against the target MBP versus the control protein GFP. (C) ELISA analysis of convex pool after selection round 3. MBP-specific DARPin off7 was used as positive control (Binz et al., 2004). (D) SEC analysis of sybody Sb_MBP#3 alone and in complex with MBP using a Superdex 200 300/10 GL column. (E) SDS-PAGE analysis of Sb_MBP#3/MBP complex after SEC. (F) KD, kon and koff values of the highest affinity sybodies obtained from the concave, loop and convex library, as measured by SPR. (G) SPR traces of the loop sybody exhibiting an affinity of 0.5 nM.

https://doi.org/10.7554/eLife.34317.012
Figure 2—figure supplement 2
Validation of sybody library design.

Comparison of homology model of non-randomized convex sybody based on the coordinates of 1ZVH with the structure of selected convex sybody Sb_MBP#1 (determined in complex with MBP). CDR residues contributing to the hydrophobic core are highlighted as green sticks, randomized residues as sticks colored in yellow, orange and red for CDR1, CDR2 and CDR3, respectively.

https://doi.org/10.7554/eLife.34317.013
Figure 2—figure supplement 3
Detailed analysis of sybody-MBP complex structures.

(A) Structures of MBP (blue) in complex with Sb_MBP#1–3 (grey with CDR1, CDR2 and CDR3 in yellow, orange and red, respectively). The coordinates of MBP were used to perform superimposition. (B) Interaction of Sb_MBP#1 with MBP, shown along the MBP cleft from both sides. Sybody residues contacting MBP (distance ≤4 Å) are shown as sticks. (C) Detailed view of interacting residues of sybodies Sb_MBP#1–3. In the left panel, four randomized residues of CDR3 which are invariant among the three binders are labeled. (D) Sequence alignment of Sb_MBP#1–3. The CDR regions are underlined.

https://doi.org/10.7554/eLife.34317.014
Figure 2—figure supplement 4
Biophysical analysis of sybody-MBP interactions.

(A) SPR analysis of interaction between sybody Sb_MBP#1 (analyte) and biotinylated MBP (ligand), determined as technical triplicates for each analyte concentration. Concentrations of Sb_MBP#1: 0, 4.7, 14.1, 42.2, 126.7, 380 nM. Data were fitted with a 1:1 binding model to obtain kon, koff and KD, kinetics. Inset shows binding equilibrium data to determine KD, equilibrium. Sybodies Sb_MBP#2 and Sb_MBP#3 were analyzed accordingly. (B) Data table summarizing the values obtained from SPR analysis shown in (A). (C) Displacement of 500 nM Sb_MBP#1 bound to immobilized MBP by addition of increasing maltose concentrations was monitored using the Octet RED96 System.

https://doi.org/10.7554/eLife.34317.015
Conformational trapping of ABC transporter TM287/288.

(A) In the absence of nucleotides, ABC transporter TM287/288 adopts its inward-facing (IF) state and captures substrates from the cytoplasm. ATP binding is required to achieve a partial population of the outward-facing (OF) state, which allows for substrate exit to the cell exterior. Sybodies were selected in the presence of ATP against the transporter mutant TM287/288(E517A), which is incapable of ATP hydrolysis and predominantly populates the OF state in this condition. (B) SPR analysis of loop sybody Sb_TM#26 in the presence and absence of ATP using wildtype TM287/288 and TM287/288(E517A) as ligands. Concentrations of Sb_TM#26: 0, 1, 3, 9, 27, 81 nM. (C) ATPase activities of wildtype TM287/288 at increasing concentrations of Sb_TM#26. Error bars report the standard deviation of technical triplicates. IC50 corresponds to the sybody concentration required for half-maximal inhibition and y0 to the residual ATPase activity at saturating sybody concentrations.

https://doi.org/10.7554/eLife.34317.018
Figure 4 with 3 supplements
Analysis of sybodies raised against ABC transporter TM287/288.

(A) Binding affinities of 31 sybodies belonging to the concave, loop and convex library were determined by kinetic SPR measurements using the ProteOn XPR36 Protein Interaction Array System in the presence and absence of ATP and using wildtype TM287/288 and the ATPase-deficient mutant TM287/288(E517A) as ligands. Binders which exhibit an affinity increase of at least ten-fold against TM287/288(E517A) in the presence of ATP were defined as state-specific and are marked in blue. (B) Phylogenetic trees of sybodies specific against TM287/288 as determined by ELISA. Note that some of the sybodies were not analyzed by SPR either due to low yields during purification or poor SPR data.

https://doi.org/10.7554/eLife.34317.019
Figure 4—figure supplement 1
Sequence alignment of concave sybodies raised against TM287/288.
https://doi.org/10.7554/eLife.34317.020
Figure 4—figure supplement 2
Sequence alignment of loop sybodies raised against TM287/288.
https://doi.org/10.7554/eLife.34317.021
Figure 4—figure supplement 3
Sequence alignment of convex sybodies raised against TM287/288.
https://doi.org/10.7554/eLife.34317.022
Figure 5 with 1 supplement
Conformation-specific binding of Sb_ENT1#1 to the inhibition state of human ENT1.

(A) Snake plot of human ENT1. (B) SPR analysis of Sb_ENT1#1 binding to biotinylated ENT1 revealing a KD of 40 nM. (C) Scintillation proximity assay thermal shift (SPA-TS) analysis of human ENT1 in the presence and absence of Sb_ENT1#1 using [3H]-NBTI inhibitor. Error bars correspond to standard deviations of technical triplicates. Sb_ENT1#1 stabilizes an inhibited conformation as evidenced by a shift of the apparent melting temperature (Tm) by 6.1°C and (D) a 7-fold increase of the absolute SPA signal measured at 30.1°C.

https://doi.org/10.7554/eLife.34317.023
Figure 5—figure supplement 1
Sequence of Sb_ENT1#1.
https://doi.org/10.7554/eLife.34317.024
Figure 6 with 2 supplements
Inhibition-state specific sybodies against human GlyT1.

(A) Schematic of a GlyT1 homolog (PDP ID: 4M48) embedded in a lipid bilayer, illustrating the limited number of surface-accessible epitopes. (B) RP8-HPLC analysis of sybody-GlyT complexes previously separated by SEC. (C, D) SPR analysis of Sb_GlyT1#1 (KD = 307 nM) and Sb_GlyT1#6 (KD = 494 pM). Due to a slow off-rate, SPR analysis of Sb_GlyT1#6 was performed in a single cycle measurement. (E) SPR analysis reveals binding of Sb_GlyT1#1–4 to the GlyT1/Sb_GlyT1#6 complex, indicating the presence of two binding epitopes. Sb_GlyT1#5 and Sb_GlyT1#7 compete for binding with Sb_GlyT1#6. (F) SPA-TS analysis of Sb_GlyT1#1–7 using [3H]-Org24598 reuptake inhibitor. Shifts of the melting temperature (Tm) are highest for Sb_GlyT1#6 and Sb_GlyT1#7 with values of 8.8 and 10°C, respectively, and correlate well with (G) increased absolute SPA signals measured at 19°C.

https://doi.org/10.7554/eLife.34317.025
Figure 6—figure supplement 1
Sequence alignment of sybodies raised against GlyT1.
https://doi.org/10.7554/eLife.34317.026
Figure 6—figure supplement 2
SPR analysis of sybodies raised against ENT1 and GlyT1.

Data were fitted using a 1:1 binding model. Representative data of replicates measured on two different SPR chips are shown.

https://doi.org/10.7554/eLife.34317.027

Tables

Table 1
Features of the three sybody libraries.
https://doi.org/10.7554/eLife.34317.009
LibraryTemplate PDB
entry/target
Binding interface
in template
Length of CDR3Number of randomized
residues in library
Theoretical diversity
of library
concave3K1K/GFP672 Å26 aa158.3 × 1017
loop3P0G/GPCR901 Å212 aa164.3 × 1019
convex1ZVH/Lysozyme533 Å216 aa182.8 × 1022
Table 2
DNA sequences of non-randomized sybodies and flanking regions for ribosome display
https://doi.org/10.7554/eLife.34317.010
Framework sequence concaveCAGGTTCAGCTGGTTGAGAGCGGTGGTGGCCTGGTCCAAGCTGGCGGTTCGCTGCGTCTGAGCTGCGCCGCAAGCGGTTT
CCCGGTGAGCAGCAGCACGATGACCTGGTATCGTCAGGCACCGGGCAAAGAACGTGAGTGGGTCGCGGCGATTTCCAGCT
CTGGTAGCACCACGACCTACGCAGATTCTGTTAAGGGCCGCTTTACCATCAGCCGCGACAACGCGAAGAATACGGTCTAT
TTGCAGATGAATAGCCTGAAACCGGAAGATACCGCGGTTTACTACTGTACCGTGACCGTGGGTAGCACGTACACGGGCCA
AGGTACCCAAGTGACTGTGAGC
Framework sequence loopCAGGTTCAGCTGGTTGAGAGCGGTGGTGGCCTGGTCCAAGCTGGCGGTTCGCTGCGTCTGAGCTGCGCCGCAAGCGGTTT
CCCGGTGAGCAGCAGCACGATGACCTGGTATCGTCAGGCACCGGGCAAAGAACGTGAGTGGGTCGCGGCGATTTCCAGCT
CTGGTAGCACCACGACCTACGCAGATTCTGTTAAGGGCCGCTTTACCATCAGCCGCGACAACGCGAAGAATACGGTCTAT
TTGCAGATGAATAGCCTGAAACCGGAAGATACCGCGGTTTACTACTGTAACGTGAAAGACAGCGGTAGCTCCAGCAGCTC
CTACGACTATTGGGGCCAAGGTACCCAAGTGACTGTGAGC
Framework sequence convexCAAGTCCAGCTGGTGGAATCGGGTGGTGGTAGCGTCCAGGCGGGTGGTAGCCTGCGTCTGAGCTGTGCGGCTAGCGGCTC
TATTTCCAGCATCACGTACCTGGGCTGGTTTCGCCAGGCACCGGGCAAAGAGCGTGAGGGCGTCGCAGCGCTGAGCACCA
GCTCCGGTACCACCTACTACGCGGACAGCGTTAAGGGTCGTTTCACGGTGAGCCTGGACAACGCCAAGAATACCGTGTAT
CTGCAAATGAACAGCTTGAAACCGGAAGATACTGCTTTGTATTACTGCGCGGCAGCCAGCAGCGGCTCCAGCAGCCCGCT
GTCTAGCAGCAGCTATACGTACTGGGGTCAGGGCACCCAAGTTACCGTTTCT
5’ flank ribosome displayTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATATCC
ATGGGTAGT
3’ flank ribosome displayGCAAAGCTTTATATGGCCTCGGGGGCCGAATTCGGATCTGGTGGCCAGAAGCAAGCTGAAGAGGCGGCAGCGAAAGCGGC
GGCAGATGCTAAAGCGAAGGCCGAAGCAGATGCTAAAGCTGCGGAAGAAGCAGCGAAGAAAGCGGCTGCAGACGCAAAGA
AAAAAGCAGAAGCAGAAGCCGCCAAAGCCGCAGCCGAAGCGCAGAAAAAAGCCGAGGCAGCCGCTGCGGCACTGAAGAAG
AAAGCGGAAGCGGCAGAAGCAGCTGCAGCTGAAGCAAGAAAGAAAGCGGCAACTGAAGCTGCTGAAAAAGCCAAAGCAGA
AGCTGAGAAGAAAGCGGCTGCTGAAAAGGCTGCAGCTGATAAGAAAGCGGCAGCAGAGAAAGCTGCAGCCGACAAAAAAG
CAGCAGAAAAAGCGGCTGCTGAAAAGGCAGCAGCTGATAAGAAAGCAGCGGCAGAAAAAGCCGCCGCAGACAAAAAAGCG
GCAGCGGCAAAAGCTGCAGCTGAAAAAGCCGCTGCAGCAAAAGCGGCCGCAGAGGCAGATGATATTTTCGGTGAGCTAAG
CTCTGGTAAGAATGCACCGAAAACGGGGGGAGGGGCGAAAGGGAACAATGCTTCGCCTGCCGGGAGTGGTAATACTAAAA
ACAATGGCGCATCAGGGGCCGATATCAATAACTATGCCGGGCAGATTAAATCTGCTATCGAAAGTAAGTTCTATGACGCA
TCGTCCTATGCAGGCAAAACCTGTACGCTGCGCATAAAACTGGCACCCGATGGTATGTTACTGGATATCAAACCTGAAGG
TGGCGATCCCGCACTTTGTCAGGCTGCGTTGGCAGCAGCTAAACTTGCGAAGATCCCGAAACCACCAAGCCAGGCAGTAT
ATGAAGTGTTCAAAAACGCGCCATTGGACTTCAAACCGTAG
Table 3
FX cloning vectors for phage display and sybody production
https://doi.org/10.7554/eLife.34317.016
Vector nameDescriptionResistance markerAddgene ID
pDX_initE.coli entry and expression vector for FX cloning system, N-terminal PelB signal sequence and C-terminal fusion to PIII for phage display using M13 phages. Nanobodies and sybodies are inserted and excised using SapI or BspQI.Amp#110101
pSb_initE.coli entry and expression vector for FX cloning system, N-terminal PelB signal sequence and C-terminal Myc- and 6xHis-tag. Nanobodies and sybodies are inserted and excised using SapI or BspQI.Cm#110100
pBXNPH3E. coli expression vector for FX cloning system, N-terminal PelB signal sequence followed by 10xHisTag and 3C cleavage site. Nanobodies and sybodies are inserted using SapI or BspQI.Amp#110098
pBXNPHM3E.coli expression vector for FX cloning system, N-terminal PelB signal sequence followed by 10xHisTag, maltose binding protein and 3C cleavage siteAmp#110099
SB_concavepBXNPHM3 containing non-randomized framework sybody of the concave libraryAmp#110102
SB_looppBXNPHM3 containing non-randomized framework sybody of the loop libraryAmp#110103
SB_convexpBXNPHM3 containing non-randomized framework sybody of the convex libraryAmp#110104
Table 4
Data collection and refinement statistics
https://doi.org/10.7554/eLife.34317.017
Sb_MBP#1
(PDB: 5M13)
Sb_MBP#2
(PDB: 5M14)
Sb_MBP#3
(PDB: 5M15)
Data Collection
Space groupP212121 (19)P212121 (19)P212121 (19)
Cell dimensions
a, b, c (Å)58.298
82.789
102.583
57.890
57.950
281.540
57.030
57.780
286.530
α, β, γ (°)90.00
90.00
90.00
90.00
90.00
90.00
90.00
90.00
90.00
Resolution (Å)50–1.3750–1.650–1.9
Rmeas (%) 1)6.5 (60.9)5.9 (124)7.8 (146.6)
II15.26 (3.47)16.98 (1.82)21.44 (2.17)
CC1/2 (%)99.9 (86.3)99.9 (68.5)100 (60.5)
Completeness (%)99.4 (97.7)100 (100)100 (100)
Redundancy6.16.512.9
Refinement
Resolution (Å)50–1.3750–1.650–1.9
No. reflections (work/test)102618/5131126118/630775931/3797
Rwork/Rfree (%)16.82/18.6019.04/21.5620.92/25.70
No. atoms
Protein387376407619
Water6941040422
B-factor (Å2)
Total20.134.450.1
R.m.s deviations
Bond lengths (Å)0.0050.0030.003
Bond angles (°)0.7500.5910.623
  1. 1) Values in parentheses are for the last resolution shell

Table 5
Characterization of sybodies raised against ENT1 and GlyT1.
https://doi.org/10.7554/eLife.34317.028
Sybodykon [M−1S−1]koff [s−1]KD [M] (kinetics)KD [M] (equilibrium)ΔTm(SPA-TS) [°C]SPA signal (fold increase)
Sb ENT1#11.86E+057.44E-034.00E-086.17
Sb_GlyT1#11.88E+055.77E-023.07E-070.91.2
Sb_GlyT1#2*3.68E+049.28E-022.52E-061.51.1
Sb_GlyT1#3**1.54E-071.71.1
Sb_GlyT1#4**4.761E-072.11.5
Sb_GlyT1#54.54E+053.72E-028.19E-082.61.5
Sb_GlyT1#6***1.00E+054.99E-054.94E-108.81.6
Sb GlyT1#7***2.01E+041.85E-049.18E-09101.8
Table 6
List of Primers
https://doi.org/10.7554/eLife.34317.029
Primers for library assembly
(triplets designated 111, 222 and 333 correspond to the trinucleotide mixtures 1–3 for randomization; all primers in 5’ to 3’ orientation)
CDR1_a_bGCA AGC GGT TTC CCG GTG 111 111 111 222 ATG 333 TGG TAT CGT CAG GCA CCG G
CDR1_cC TGT GCG GCT AGC GGC 111 ATT 111 111 ATC 222 TAC CTG GGC TGG TTT CGC C
CDR2_a_bGA AGA CCT GTC GCG GCG ATT 111 AGC 111 GGT 111 222 ACG 333 TAC GCA GAT TCT GTT AAG GGC CG
CDR2_cCGA AGA CCT GCA GCG CTG 111 ACC 111 111 GGT 222 ACC TAC TAC GCG GAC AGC G
CDR3_aGA AGA CCT GCG GTT TAC TAC TGT 333 GTG 222 GTG GGT 111 222 TAC 333 GGC CAA GGT ACC CAA GTG AC
CDR3_bCGC GAA GAC CTC GTG AAA GAC 111 GGT 111 111 111 111 111 TAC GAC TAT TGG GGC CAA GGT ACC CAA GTG AC
CDR3_cGAA GAC CTC TGC GCG GCA GCC 111 111 GGC 111 111 111 CCG CTG 111 111 111 111 TAT 222 TAC TGG GGT CAG GGC ACC CAA GTT ACC GTT TCT
FW1_a_b_forCAG GTT CAG CTG GTT GAG AGC
FW1_a_b_revCAC CGG GAA ACC GCT TGC
FW1_c_forCAA GTC CAG CTG GTG GAA TCG
FW1_c_revGCC GCT AGC CGC ACA G
FW2_a_b_revATG CAT GGT CTC ACG ACC CAC TCA CGT TCT TTG CCC GGT GCC TGA CGA TAC CA
FW2_c_revATG CAT GGT CTC ACT GCG ACG CCC TCA CGC TCT TTG CCC GGT GCC TGG CGA AAC CAG CCC AGG
FW3_a_b_forCGC AGA TTC TGT TAA GGG CCG
FW3_c_forACC TAC TAC GCG GAC AGC G
FW4_a_b_revGCT CAC AGT CAC TTG GGT ACC TTG GCC
FW4_c_revAGA AAC GGT AAC TTG GGT GCC CTG
Link1_a_b_forATG CAT GAA GAC CTG TCG CGG CG
Link1_a_b_revATG CAT GGT CTC ACG ACC CAC
Link1_c_forTAT ATC GAA GAC CTG CAG CGC TG
Link1_c_revATG CAT GGT CTC ACT GCG ACG
Link2_a_forTAT ATC GAA GAC CTG CGG TTT ACT ACT G
Link2_a_revATG CAT GGT CTC ACC GCG GTA TCT TCC GGT TTC
Link2_b_forATG CAT GGT CTC ACC GCG GTA TCT TCC GGT TTC
Link2_b_revATG CAT GGT CTC ACA CGT TAC AGT AGT AAA CCG CGG
Link2_c_forATA TAT GAA GAC CTC TGC GCG GC
Link2_c_revATG CAT GGT CTC AGC AGT AAT ACA AAG CAG TAT CTT CCG G
Primers for vector construction
pBXNPH3_#1CAG CAG TCC GGC AGC AGC GGT CGG CAG CAG GTA TTT CAT GGT TAA TTC CTC CTG TTA GCC
pBXNPH3_#2CTC CTC GCT GCC CAG CCT GCA ATG GCC GCA GAT CAC CAT CAT CAT CAC CAT CAT CAT CAT CAT TTA
pBXNPHM3_#1ATA TAT GCG GCC GCC ATA GTG ACT GGA TAT GTT G
pBXNPHM3_#2CAT GGT TAA TTC CTC CTG TTA GCC CAA AAA
pBXNPHM3_#3AAA TAC CTG CTG CCG ACC GCT GCT GCT GGT
pBXNPHM3_#4ATA TAT GCG GCC GCA TTA GGC ACC CCA GGC TTT A
pBXNPH3_blunt_forCTC ATG ACC AAA ATC CCT TAA CGT GAG
pBXNPH3_EcoRI_revATA TAT GAA TTC ATG GGG AGA CCC CAC ACT AC
pDX_init_#1ATA TAT GCT CTT CAA GCG GAA GAG AGC CCA ATA CGC AAA CCG
pDX_init_#2CGT TAG TAA ATG AAT TTT CTG TAT GAG GTT TTG
pDX_init_#3GAA CCT GAA GCC CAG TAC CCG TAC
pDX_init_#4CGT ACG GGT ACT GGG CTT CAG GTT
pDX_init_#5TAT AAC TTG AAG AGC CGG CTG CCA TGG CCG GCT GGG CC
pDX_init_#6TAT AGC AGG AAG AGC TCA CCA CCA TCA CCA TCA CGA ACC TG
pDX_init_#7TAT AGC TCT TCA AGT CTG CCC ACA TAT ACC TGC CGT TC
pDX_init_#8TAT AGC TCT TCC TGC AGA CAC GTG TCA CGT GAG GCC
Cm_EcoRI_forGCT CAT GAA TTC CCC GCG CG
Cm_blunt_revGTG CAA TGT AAC ATC AGA GAT TTT GAG ACA C
Nb_init_forATG CAG GAA GAG CTG GCG AAC AAA AAC TCA TCT CAG AAG AGG ATC TG
Nb_init_revATA CTT GAA GAG CCG GCC ATT GCA GGC TGG GCA G
RD_FX_pRDV_forATA TAT GCT CTT CTG CAA AGC TTT ATA TGG CCT CGG GGG C
RD_FX_pRDV_rev1TAT ATA GCT CTT CAA CTA CCC ATG GAT ATA TCT CCT TCT TAA AGT TAA AC
pRDV_SL_forAGA CCA CAA CGG TTT CCC TCT AGA AAT AAT TTT GTT TAA CTT TAA G
pRDV_SL_revCCC TAT AGT GAG TCG TAT TAA TTT CGA TGG
GS-Linker_FWGGC GGT GGC GGT AGT AGA AGA GCG AGC TGC AGA CTG
GS-Linker_RVGCC GGA ACC ACT TGG ACC TTG AAA CAA AAC TTC TAA ATG ATG
Primers for target amplification
GFP_FX_FWTAT AGC TCT TCT AGT CAA TTC AGC AAA GGA GAA GAA CTT TTC
GFP_FX_RVTAT AGC TCT TCT TGC TGC ACT AGT TTT GTA GAG CTC ATC C
MBP_FX_FWATA TAT GCT CTT CTA GTA AAA TCG AAG AAG GTA AAC TGG TAA TCT GG
MBP_FX_RVTAT ATA GCT CTT CAT GCG CTA CCC GGA GTC TGC GC
IrtAB_FX_FWATA TAT GCT CTT CTA GTC TTC GTG GAC TGG GTG CCC GCG ACC AT
IrtAB_FX_RVTAT ATA GCT CTT CAT GCC CGT GCC GTC GAC CCG ATC GCC CAC TC
Primers for ribosome and phage display
Med_FX_forATA TGC TCT TCT AGT CAG GTT CAG CTG GTT GAG AGC G
Med_FX_revTAT AGC TCT TCA TGC GCT CAC AGT CAC TTG GGT ACC
Long_FX_forATA TGC TCT TCT AGT CAA GTC CAG CTG GTG GAA TCG
Long_FX_revTAT AGC TCT TCA TGC AGA AAC GGT AAC TTG GGT GCC C
RT_PrimerCTT CAG TTG CCG CTT TCT TTC TTG
Medium_ORF_forAGT CAG GTT CAG CTG GTT GAG AGC G
Medium_ORF_revTGC GCT CAC AGT CAC TTG GGT ACC
Long_ORF_forAGT CAA GTC CAG CTG GTG GAA TCG
Long_ORF_revTGC AGA AAC GGT AAC TTG GGT GCC C
5'_flank _forCGA AAT TAA TAC GAC TCA CTA TAG GGA GAC
tolAk_revCCG CAC ACC AGT AAG GTG TGC GGT TTC AGT TGC CGC TTT CTT TCT
tolAk_2CCG CAC ACC AGT AAG GTG TGC
5'_flank _revTAT AGC TCT TCA ACT ACC CAT GGA TAT ATC TCC
3’_flank_forTAT AGC TCT TCT GCA AAG CTT TAT ATG GCC TC
Medium_ORF_5'_revCGC TCT CAA CCA GCT GAA CCT GAC T
Long_ORF_5'_revCGA TTC CAC CAG CTG GAC TTG ACT
Medium_ORF_3’_forGGT ACC CAA GTG ACT GTG AGC GCA
Long_ORF_3'_forGGG CAC CCA AGT TAC CGT TTC TGC A
Primers for qPCR
qPCR_RD_5’_forGGG AGA CCA CAA CGG TTT CCC
qPCR_ RD_S and M_5’_revCAC CGG GAA ACC GCT TGC GGC
qPCR_ RD_L_5’_revGCC GCT AGC CGC ACA GCT C
qPCR_ RD_tolA_3’_forGCC GAA TTC GGA TCT GGT GGC
qPCR_ RD_tolA_3’_revCTG CTT CTT CCG CAG CTT TAG C
qPCR_PD_pDX_forGAC GTT CCG GAC TAC GGT TCC
qPCR_PD_pDX_revCAC AGA CAG CCC TCA TAG TTA GC
qPCR_3K1K_forAGT GCC GGT GAT CGT AGC AG
qPCR_3K1K_revCCC AAT ATT CAA AGC CCA CGT T
Table 7
Primers and megaprimers used to assembly the sybody libraries
https://doi.org/10.7554/eLife.34317.030
LibraryCDRRandomized primerMegaprimerAssembly primerOuter primers
concaveCDR1CDR1_a_bMegaprimer 1FW2_a_b_revFW1_a_b_for/Link1_a_b_rev
CDR2CDR2_a_bMegaprimer 2Link1_a_b_for/Link2_a_rev
CDR3CDR3_aLink2_a_for/FW4_a_b_rev
loopCDR1CDR1_a_bMegaprimer 1FW2_a_b_revFW1_a_b_for/Link1_a_b_rev
CDR2CDR2_a_bMegaprimer 3Link1_a_b_for/Link2_b_rev
CDR3CDR3_bLink2_b_for/FW4_a_b_rev
convexCDR1CDR1_cMegaprimer 4FW2_c_revFW1_c_for/Link1_c_rev
CDR2CDR2_cMegaprimer 5Link1_c_for/Link2_c_rev
CDR3CDR3_cLink2_c_for/FW4_c_rev

Data availability

Diffraction data have been deposited in PDB under the accession codes 5M13, 5M14 and 5M15. Vectors have been deposited at Addgene under accession IDs #110098 - #110104

The following previously published data sets were used
  1. 1
    Synthetic nanobody in complex with MBP
    1. Iwan Zimmermann
    2. Pascal Egloff
    3. Markus A Seeger
    (2017)
    Publicly available at the RCSB Protein Data Bank (accession no. 5M13).
  2. 2
    Synthetic nanobody in complex with MBP
    1. Iwan Zimmermann
    2. Pascal Egloff
    3. Markus A Seeger
    (2017)
    Publicly available at the RCSB Protein Data Bank (accession no. 5M14).
  3. 3
    Synthetic nanobody in complex with MBP
    1. Iwan Zimmermann
    2. Pascal Egloff
    3. Markus A Seeger
    (2017)
    Publicly available at the RCSB Protein Data Bank (accession no. 5M15).

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)