Predicting the likelihood and intensity of mosquito infection from sex specific Plasmodium falciparum gametocyte density
- London School of Hygiene and Tropical Medicine, United Kingdom
- Radboud University Medical Center, Netherlands
- Institut de Recherche en Sciences de la Santé, Direction, Burkina Faso
- MIVEGEC (UM-CNRS 5290-IRD 224), France
- University of Science, Techniques and Technologies of Bamako, Mali
- Université de Douala, Cameroon
- University of California, San Francisco, United States
- Centre National de Recherche et de Formation sur le Paludisme, Burkina Faso
- Imperial College London, United Kingdom
Figures
Figure 1 with 1 supplement
Gametocyte density in natural infections.
The density of female gametocytes and male gametocytes is presented in panel (A) for samples from Ouelessebougou, Mali (red), Yaoundé, Cameroon (green), Bobo-Dioulasso, Burkina Faso (blue) and …
-
Figure 1—source data 1
Raw data presented in Figure 1.
- https://doi.org/10.7554/eLife.34463.004
-
Figure 1—source data 2
Description of the statistical model determining the shape of the relationship between female gametocyte density and male gametocyte density.
- https://doi.org/10.7554/eLife.34463.005
Figure 1—figure supplement 1
Relationship between total gametocyte densities as measured by microscopy or female gametocyte densities quantified by Pfs25 quantitative reverse-transcriptase PCR.
Relationship is shown separately for each of the different sites, be it (A) Ouelessebougou, Mali (red), (B) Bobo-Dioulasso, Burkina Faso (blue), (C) Yaoundé, Cameroon (green), and (D) Balonghin, …
Figure 2 with 2 supplements
The relationship between Plasmodium falciparum gametocyte density and the proportion of mosquitoes that develop oocysts.
(A) The association with female gametocyte density. The solid black line indicates the best-fit statistical model with grey shaded 95% Bayesian credible intervals (CI). Infectivity depends on both …
-
Figure 2—source data 1
Raw data presented in Figure 2.
- https://doi.org/10.7554/eLife.34463.010
-
Figure 2—source data 2
Description of the statistical model determining the shape of the relationship between gametocyte density and mosquito infection.
- https://doi.org/10.7554/eLife.34463.011
Figure 2—figure supplement 1
Site-specific differences in the relationship between Plasmodium falciparum female gametocyte density and the proportion of mosquitoes that develop oocysts.
Figure is the same as Figure 2A but without the scaling the mean proportion of mosquitoes infected to the Mali dataset. Panel (A) shows all sites together whilst (B–E) show figures for each site …
Figure 2—figure supplement 2
Relationship between female gametocyte density and the proportion of infected mosquitoes for different male gametocyte densities for experiments from Mali (n = 71).
Points are coloured according to gametocyte sex ratio: green >= 16% male, brown <16% male (16% is the median value). At low and intermediate female densities (between 1 and 100 female gametocytes …
Figure 3 with 1 supplement
Associations between mean oocyst density; the proportion of mosquitoes that develop oocysts; and gametocyte density.
(A) The relationship between mean oocyst density and the proportion of mosquitoes that develop oocysts (red = Ouelessebougou, Mali, green = Yaoundé, Cameroon, blue = Bobo Dioulasso, Burkina Faso, …
Figure 3—figure supplement 1
Site-specific differences in the relationship between Plasmodium falciparum female gametocyte density and the proportion of mosquitoes that develop oocysts.
Figure is the same as Figure 3B but without the scaling average oocyst density to the Mali dataset. Panel (A) shows all sites together whilst (B–E) show figures for each site independently. Point …
Author response image 1
Tables
Table 1
Characteristics of gametocyte carriers and mosquito feeding assays.
https://doi.org/10.7554/eLife.34463.006| Ouelessebougou, Mali | Bobo Dioulasso, Burkina Faso | Balonghin, Burkina Faso | Yaoundé, Cameroon | |
|---|---|---|---|---|
| Number of experiments | 71 | 19 | 45 | 13 |
| Enrolment criteria: | Detection of gametocytes by microscopy | Detection of gametocytes by microscopy | Detection of gametocytes by molecular QT-NASBA | Detection of gametocytes by microscopy |
| Period and season of data collection | January 2013-November 2014 (dry and wet season) | April-June 2016 (dry season) | October-November 2014 (wet season) | October-December 2015 (wet season) |
| P. falciparum parasite prevalence in cross-sectional surveys in the study area (microscopy) | 70.2% in children < 5 years, 2015–16 (Mahamar et al., 2017) | 40.9–61.7% in children 1–9 years, 2014–2015 (Hien et al., 2017) | 59.7% in children < 15 years, 2014 wet season (Gonçalves et al., 2017) | 44.7–55.6% in children 4–15 years, 2013–2014 (Sandeu et al., 2017) |
| Age, median (IRQ) | 11 (7–25) | 5–15 (range)* | 10 (8–13) | 9 (6–11) |
| Asexual parasite prevalence % (n/N) | 64.8 (46/71) | 73.7 (14/19) | 73.3 (33/45) | 76.9 (10/13) |
| Asexual parasite density per µL, median (IQR) | 432 (96–2880) | 360 (240–1040) | 658 (336–1237) | 944 (288–4224) |
| Total gametocyte density per µL, median (IQR) | 62.8 (31.4–146.8) | 19.2 (10.5–26.1) | 4.0 (0.6–11.0) | 64.4 (11.7–126.2) |
| Percentage of male gametocytes, median (IQR) | 14% (7–25%) | 51% (39–66%) | 30% (18–40%) | 32% (27–53%) |
| Number of mosquitoes examined per experiment, median (IQR) | 70 (63–79) | 29 (28–30) | 40 (35–45) | 37 (32–45) |
| Infectious individuals, % (n/N) | 74.7 (53/71) | 84.2 (16/19) | 22.2 (10/45) | 76.9 (10/13) |
| Infected mosquitoes, % (n/N) | 17.0 (842/4960) | 39.2 (208/531) | 3.5 (63/1783) | 38.1 (184/483) |
-
*the age of individual gametocyte donors was not recorded in Bobo Dioulasso; gametocyte carriers were recruited from the age range 5–15 years; asexual parasite density was determined by microscopy, gametocyte density by quantitative reverse transcriptase PCR. QT-NASBA = Pfs25 mRNA quantitative nucleic acid sequence based amplification.
Table 2
Primer sequences for the Pfs25 female marker, and male marker PfMGET.
https://doi.org/10.7554/eLife.34463.014| Gene target | Forward primer | Reverse primer |
|---|---|---|
| Pfs25 | GAAATCCCGTTTCATACGCTTG | AGTTTTAACAGGATTGCTTGTATCTAA |
| PFMGET | CGGTCCAAATATAAAATCCTG | GTGTTTTTAATGCTGGAGCTG |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.34463.015
