Cellular diversity in the Drosophila midbrain revealed by single-cell transcriptomics
- The University of Oxford, United Kingdom
Figures
Figure 1 with 4 supplements
Drop-seq reveals neuronal clusters in the Drosophila brain.
(A) Schematic of the experimental procedure. Drosophila brains were dissected and dissociated prior to Drop-seq. After sequencing and alignment, a digital expression matrix containing information …
-
Figure 1—source data 1
Digital Expression Matrix.
Zip-archive containing individual digital expression matrices of all 8 biological replicates.
- https://doi.org/10.7554/eLife.34550.007
-
Figure 1—source data 2
List of marker genes for each cluster in Figure 1.
Table showing the average log-fold change values of marker genes for each incluster, including adjusted p-values.
- https://doi.org/10.7554/eLife.34550.008
Figure 1—figure supplement 1
Preliminary validation of Drop-seq on insect cells.
(A) Schematic of a Drop-seq experiment that was run to analyze a mixture of Drosophila (S2; blue) and Spodoptera (Sf9; red) cells. (B) Scatter plot (Barnyard) indicating the number of transcripts …
Figure 1—figure supplement 2
– Comparison of different quality filters.
(A–C) Left: histograms representing the distribution of numbers of UMIs per cell selected with cutoffs of 200 (A), 800 (B) and 1800 (C) UMIs per cell. Right: t-SNE plots of the same data set as in Fi…
Figure 1—figure supplement 3
– t-SNE plot showing all eight replicates.
t-SNE plot as in Figure 1B, with cells from each replicate in a different color.
Figure 1—figure supplement 4
– Sex-determination of individual neurons.
(A) Histogram showing the number of UMIs per neuron. The dashed line indicates the threshold that was chosen to separate roX1-positive and roX1-negative neurons. (B) t-SNE plot showing putative male …
Figure 2 with 1 supplement
Identification of Kenyon Cells and mushroom body-specific genes.
(A) mCherry labeling of MB008B neurons in the Drosophila brain. Neuropil, labeled by nc82 anti-Brp antibody, is shown in grey. (B) Expression of mCherry in the t-SNE-clustered brain cells shown in Fi…
-
Figure 2—source data 1
Primer pairs used for qPCR.
List of primer pairs and UPL probe numbers used for qPCR show in Figure 2—figure supplement 1.
- https://doi.org/10.7554/eLife.34550.011
Figure 2—figure supplement 1
– Confirmation of Kenyon Cell type specific gene expression using qPCR on FAC-sorted cells.
Relative difference of expression levels for some of the genes identified in Figure 2F. For each gene, in each replicate, expression values were normalized to the lowest ΔCt across the three lobes. …
Figure 3
Sub-populations of olfactory projection neurons.
(A) Re-clustering of the two Projection Neuron (PN) clusters from Figure 1B. Clusters are color-coded. (B) Dot plots showing the main markers distinguishing PN populations from each other (pairwise …
Figure 4 with 1 supplement
Genetic markers of glial subtypes.
(A) Re-clustering of the glial and astrocyte populations identified in Figure 1B. The same three sub-clusters are identified. (B) Violin plots showing the main markers that distinguish glial …
Figure 4—figure supplement 1
Expression levels of glia-specific genes and Ilp 6.
(A–B) tSNE plots showing the expression levels of the neuronal markers embryonic lethal abnormal vision (elav) and neuronal synaptobrevin (nSyb). (C–E) tSNE plots showing the expression levels of …
Figure 5
Distribution of fast-acting neurotransmitters.
(A) t-SNE plot showing the distribution of cells expressing vesicular acetylcholine transporter (VAChT, cholinergic neurons), vesicular glutamate transporter (VGlut, glutamatergic neurons) and glutam…
Figure 6
Co-expression of neuropeptides with fast-acting neurotransmitters.
(A) Radar plots showing the co-expression of 16 neuropeptides with the three fast-acting neurotransmitters. Data represents the relative abundance of cells expressing a neuropeptide and either VAChT …
Figure 7
Genetic markers and co-transmission in monoaminergic neurons.
(A) Expression of the Vesicular Monoamine Transporter (Vmat) labels three clusters from Figure 1B (cells in indigo, highlighted with arrowheads and circles. (B) Re-clustering of the three cell …
Figure 8
Localization of genes involved in dopamine metabolism and signaling.
(A) Schematic of a dopaminergic synapse, representing the major proteins involved in dopamine signaling and metabolism. Drawing inspired by Yamamoto and Seto (2014) (B) Dot plots showing the …
Figure 9
Expression patterns of nicotinic acetylcholine receptor subunits.
(A) Prevalence of nicotinic receptor subunits. (B) Heatmap showing Pearson correlation coefficient Z-scores for each receptor subunit pair.
Figure 10
Co-expression of neuronal activity markers.
Heatmap showing Pearson correlation coefficient Z-scores of activity-regulated genes, as reported by Chen et al., 2016 (histogram on top). Ten most highly upregulated genes following …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Drosophila melanogaster) | MB008B | Bloomington Drosophila Stock Center | RRID:BDSC_68291 | |
| Genetic reagent (D. melanogaster) | MB131B | Bloomington Drosophila Stock Center | RRID:BDSC_68265 | |
| Genetic reagent (D. melanogaster) | MB461B | Bloomington Drosophila Stock Center | RRID:BDSC_68327 | |
| Genetic reagent (D. melanogaster) | uas-mCherry (III) | other | uas-mCherry(III) | lab stock |
| Cell line (D. melanogaster) | Drosophila S2 Cells in Schneider's Medium | Gibco, Waltham, MA | R69007 | |
| Cell line (Spodoptera frugiperda) | Sf9 cells in Sf-900 III SFM | Gibco | 12659–017 | |
| Sequence-based reagent | Template switch oligo | Sigma, St. Louis, MO | AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG | |
| Chemical compound, drug | Schneider's medium | Gibco | 21720–001 | |
| Chemical compound, drug | FBS | Sigma | F0804 | |
| Chemical compound, drug | penicillin-streptomycin | Gibco | 15070–063 | |
| Chemical compound, drug | Sf-900 III SFM | Gibco | 12658019 | |
| Chemical compound, drug | DPBS (calcium and magnesium free) | Gibco | 14190–086 | |
| Chemical compound, drug | Papain | Sigma | P4762 | |
| Chemical compound, drug | Collagenase | Sigma | C2674 | |
| Chemical compound, drug | d(−)−2-amino-5-phosphonovaleric acid | Sigma | A8054 | |
| Chemical compound, drug | 6,7-dinitroquinoxaline-2,3-dione | Sigma | D0540 | |
| Chemical compound, drug | tetrodotoxin | Abcam, UK | ab120054 | |
| Other | 10 µm CellTrix strainer | Sysmex, Japan | 04-0042-2314 | |
| Other | Fuchs-Rosental hemocytometer | VWR, Radnor, PA | 631–1096 | |
| Commercial assay or kit | Single Cell RNA-Seq system | Dolomite Bio, UK | 3200537 | |
| Chemical compound, drug | Barcoded Beads SeqB | ChemGenes Corp., Wilmington, MA | ||
| Chemical compound, drug | Ficoll PM-400 | VWR | 17-0300-10 | |
| Chemical compound, drug | N-Lauroylsarcosine sodium salt solution | Sigma | L7414 | |
| Chemical compound, drug | QX200 Droplet generation oil for EvaGreen | Biorad, Hercules, CA | 1864006 | |
| Chemical compound, drug | DTT | Life Technologies, Carlsbad, CA | P2325 | |
| Chemical compound, drug | Maxima H Minus Reverse Transcriptase | Thermo Scientific, Waltham, MA | EP0753 | |
| Chemical compound, drug | Exonuclease I | NEB, Ipswich, MA | M0293L | |
| Sequence-based reagent | SMART PCR primer | Sigma | AAGCAGTGGTATCAACGCAGAGT | |
| Chemical compound, drug | Hifi HotStart Readymix | Kappa Biosystems, Switzerland | KK2602, KK2611 | |
| Chemical compound, drug | Agencourt AMPure XP beads | Beckman-Coulter, Brea, CA | A63880 | |
| Commercial assay, kit | Bioanalyzer High-Sensitivity DNA kit | Agilent, Santa Clara, CA | 5067–4626 | |
| Commercial assay, kit | Nextera XT DNA Sample Preparation Kit | Illumina, San Diego, CA | FC-131–1024 | |
| Sequence-based reagent | New-P5-SMART PCR hybrid | Sigma | AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG CCT GTC CGC GGA AGC AGT GGT ATC AAC GCA GAG T*A*C | |
| Commercial assay, kit | PicoPure™ RNA Isolation Kit | Applied Biosystems, Foster City, CA | KIT0204 | |
| Commercial assay, kit | SuperScript III First-Strand Synthesis SuperMix | Invitrogen, Carlsbad, CA | 18080400 | |
| Commercial assay, kit | QIAquick PCR Purification Kit | Qiagen, Germany | 28106 | |
| Commercial assay, kit | Universal Probe Library system | Roche, Switzerland | 04683633001,04869877001 | |
| Commercial assay, kit | LightCycler® 480 Probes Master | Roche | 4887301001 | |
| Commercial assay, kit | SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing | Takara Clontech, Japan | 634890 | |
| Commercial assay, kit | TruSeq RNA Library Prep Kit v2 | Illumina | RS-122–2001 |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.34550.021
